Reprogramming of Dermal Fibroblasts into Osteo-Chondrogenic Cells

Size: px
Start display at page:

Download "Reprogramming of Dermal Fibroblasts into Osteo-Chondrogenic Cells"

Transcription

1 Stem Cell Reports, Volume 8 Supplemental Information Reprogramming of Dermal Fibroblasts into Osteo-Chondrogenic Cells with Elevated Osteogenic Potency by Defined Transcription Factors Yinxiang Wang, Ming-Hoi Wu, May Pui Lai Cheung, Mai Har Sham, Haruhiko Akiyama, Danny Chan, Kathryn S.E. Cheah, and Martin Cheung

2

3

4

5 Supplemental Figure Legends Figure S1. Screening for the optimal culture conditions and overexpression of KMS into mouse embryonic stem cells does not lead to the formation of SOX9-EGFP+/RUNX2+ nodules. Related to Figure 1. (A) Quantification of KMS-transformed nodules formed from d9 to 14 when cultured in conventional medium on SNL feeder. (B) Quantification of KMS-transformed nodules formed from d9 to 14 when cultured in hypoxic condition (2% O2). Data are expressed as means ± SD. 3 independent experiments are represented in A and B. (C) Retroviral transduction of KMS into mouse embryonic stem cells (ESCs) derived from Sox9-EGFP KI mice generated nodules expressing SOX9-EGFP from d14 to 16 compared to control without transduction in which none of the nodules expressed GFP and RUNX2 in all time points examined. Phase images show morphology of KMStransduced ESCs and control cells. Scale bar: 100µm. Figure S2. Generation of KMS-reprogrammed SOX9-EGFP+/RUNX2+ nodules by dox-inducible lentiviral system and screening for the minimal number of transcription factors for direct conversion of MDFs into SOX9-EGFP+/RUNX2+ nodules. Related to Figure 2. (A) MDFs transduced with dox-inducible lentiviral KMS vectors did not form nodules and/or express GFP and/or RUNX2 in all time points examined following 2 or 4 days of dox treatment whereas nodules began to form on day 10, expressed GFP and RUNX2 from d11 to 13 and maintained GFP but not RUNX2 expression on day 14 following 8 or 10 days of dox treatment. Insets in top right corner show phase images of transduced MDFs or nodules after dox treatment at the indicated time points. (B) Panels showing double immunofluorescence of anti-gfp and anti-runx2 on MDFs reprogrammed with KS, MS, KLF4, c-myc or SOX9 in mtesr medium from d10 to 14 and phase images of their corresponding transduced MDFs. (C) Micrographs of reprogrammed cells on d14. The scale bar represents 50 µm in A, 100 µm in B and C. Figure S3. Molecular characterization of KMS- and KM-reprogrammed SOX9-EGFP+/RUNX2+ nodules. Related to Figures 3 and 4. Real-time RT-PCR analysis of transcript levels for Sox9 (A), Runx2 (B), Col2a1 (C), Sox5 (D), Sox6 (E), CD9 (F), CD73 (G), Col10 (H), Osteopontin (I), Osteocalcin (J), Osterix (K), Cola1 (L), Ihh (M), Ppr (N), Gremlin 1 (O), Oct4 (P), Sox2 (Q), PPAry1 (R), Mmp3 (S) and Igf2 (T) in reprogrammed nodules with KMS or KM. mrna levels from each gene was normalized to Gapdh with fold change relative to MDFs. Data are expressed as means ± SEM. 3 independent experiments are represented in A-T. *p<0.05; **p< 0.01; ***p < 0.001

6 Table S1. List of primers used for real time RT-PCR amplification in this study. Related to Figures 3,4 and S3. Markers Forward primer 5-3 Reverse primer 5-3 Runx2 GGAGCTCGGCGGAGTAGTTC CTGTGGTTACCGTCATGGCC endo-sox9 AGCTCACCAGACCCTGAGAA TCCCAGCAATCGTTACCTTC ex-sox9 CTGGGAACAACCCGTCTACA CACCAGACCAACTGGTAATG Col2a1 TTCCACTTCAGCTATGGCGAT GACGTTAGCGGTGTTGGGAG Sox5 GACAGAAAGAGAATCCATTGGT TTCTTGATCAGCTCTTCCATCT Sox6 CTAAGAATGTCTTCCAAGCAAG AAGTAGTTTTTCCATGCAGGAG Ihh GGCTTCGACTGGGTGTATTA CGGTCCAGGAAAATAAGCAC Ppr ACAAAGGGTGGACGCCAGCA GCGGTCGCAGCGTCTGTAGG Col10a1 GCCAAGCAGTCATGCCTGAT GACACGGGCATACCTGTTACC Col1a1 GCAACAGTCGCTTCACCTACA CAATGTCCAAGGGAGCCACAT Osterix CGCTTTGTGCCTTTGAAAT CCGTCAACGACGTTATGC Osteocalacin CAGACACCATGAGGACCATC GGACTGAGGCTCTGTGAGGT Osteopontin CTTTCACTCCAATCGTCCCTA GCTCTCTTTGGAATGCTCAAGT Ppar-γ1 CCACCAACTTCGGAATCAGCT TTTGTGGATCCGGCAGTTAAGA Oct4 TCTTTCCACCAGGCCCCCGGCTC TGCGGGCGGACATGGGGAGATCC Sox2 TAGAGCTAGACTCCGGGCGATG TTGCCTTAAACAAGACCACGAAA A Mmp3 TGCTGTCTTTGAAGCATTTGGGT T GCACTTCCTTTCACAAAGACTCAG A Igf2 ACAACTTCGATTTGAACCACAT GAGAGCTCAAACCATGCAAACT TC Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA ex-klf4 CCCAGTGTGGTGGTACGGGAAAT GTCGTTGAACTCCTCGGTCT C ex-c-myc CCCAGTGTGGTGGTACGGGAAAT C GCTCGCTCTGCTGTTGCTGGTGATA G Gremlin1 AAGTGACAGAATGAATCGCACC GGACTGGGTCTGCTCAGAGT CD9 CTGGCATTGCAGTGCTTGCTA AACCCGAAGAACAATCCCAGC CD73 CAAATCCCACACAACCACTG TGCTCACTTGGTCACAGGAC endo: endogenous; ex: exogenous

7 Supplemental Experimental Procedures Immunofluorescence Transduced fibroblasts were cultured in 24-well plate and washed with PBS briefly before fixing in 4% paraformaldehyde (PFA) for 10 minutes. Cells were washed and permeabilized with PBS+0.1% Tween 20 (PBST) before blocking with 1% bovine serum albumin (BSA) in PBST for 30 mins at room temperature (R.T). Cells were then incubated with sheep anti-gfp (Ab-direct, ) and rabbit Anti-RUNX2 (Abcam, ab76956) diluted in blocking buffer at 4 C. After overnight incubation, cells were washed three times 20 mins each with PBST before incubating with anti-sheep-igg-fitc (Invitrogen, A11015) and anti-rabbit-igg-cy3 (Jackson Immuno Research Laboratories, Inc, ) for 2 hours at R.T. After washing three times in PBST, cells were mounted with DAPI (VECTASHIELD Hard SetTM) and photographed in an inverted fluorescence microscope (OLYMPUS BX51). Real Time RT-PCR RNA was extracted from reprogrammed nodules, MDFs, ESCs, P10 tibia growth plate, MSCs, osteoblasts, adipocytes and sorted SOX9-EGFP + cells using RNAspin Mini kit (GE Healthcare) and treated with DNase to remove any contaminating genomic DNA based on the manufacturer s protocol. 1µg of RNA was reversetranscribed with Superscript III Reverse Transcriptase (Invitrogen) and oligo(dt) 20 primer. For real-time PCR analysis, 2ul of cdna with 200nM primers was mixed with Power SYBR Green PCR Master Mix (Applied Biosystems) in a total reaction volume of 25µl. Real time PCR reaction was performed in a 96-well Optical Reaction Plate and run on the ABI StepOnePlus Real-Time PCR System with the following parameters: Holding stage: 95 C, 1 min. Cycling stage (40 cycles): 95 C, 15s; 60 C, 1 min. Melting curve stage: 95 C, 15s, 60 C, 1 min, 95 C, 15s. Each sample was run in triplicates and level of transcripts from each gene was normalized to endogenous Gapdh control. The primers used are listed in Table S1. In vitro differentiation For chondrogenic differentiation, reprogrammed SOX9-EGFP + /RUNX2 + nodules were manually picked and replated in chondrogenic differentiation medium consisting of high-glucose DMEM supplemented with 100 nm dexamethasone (Sigma), 50 µg/ml L-ascorbic acid 2-phosphate (Sigma), 40 µg/ml proline (Sigma), 100 µg/ml sodium pyuvate (Gibco), 1% penicillin/streptomycin and 50 mg/ml ITS-Premix (BD Biosciences) (Collaborative Biomedical; 6.25 ng/ml insulin, 6.25 mg transferrin, 6.25 ng/ml selenious acids, 1.25 mg/ml BSA) for 14 days before being processed for Alcian blue staining. For osteogenic differentiation, reprogrammed SOX9-EGFP + /RUNX2 + nodules were subjected to osteogenic differentiation medium containing high-glucose DMEM, 50 µg/ml L-ascorbic acid 2-phosphate, 10 mm β- glycerophosphate (Sigma), 10% FBS, and 1% penicillin/streptomycin for 14 days before being processed for Alizarin Red S staining. For adipogenic differentiation, reprogrammed SOX9-EGFP + /RUNX2 + nodules were incubated in DMEM with 10% FBS medium supplemented with 100 nm dexamethasone and 10 4 M L-ascorbic acid 2-phosphate for 14 days before being processed for Oil Red O staining. Alizarin Red S Staining Reprogrammed nodules were fixed in 10% formaldehyde in 1xPBS for 15 mins, stained with 40mM Alizarin Red S (Sigma) solution for 30 seconds to 5 minutes and washed 3 times with distilled water to remove excess staining solution. Alcian blue staining Reprogrammed nodules were fixed in 4% PFA for 10 mins at room temperature, washed with water twice followed by staining in the Alcian blue (Sigma) in 0.1N HCl solution for mins at room temperature. Stained cells were washed 3 times with water. Oil Red O staining Reprogrammed nodules were fixed in 4% PFA for 10 mins, washed with water twice followed by rinsing with 60% isopropanol before incubation with the freshly prepared Oil Red O working solution [0.3% Oil Red O (Sigma) in isopropanol] for 15 mins at room temperature. Stained cells were immediately rinsed with distilled water 4 times to remove excess Oil Red O solution.

8 Von Kossa staining Histological sections were deparaffinized, hydrated and incubated with 5% silver nitrate solution (Sigma) and placed under a 60-watt light bulb at a range of several inches for 30 mins. Sections were then washed with water 3 times, incubated with 5% sodium thiosulfate (BDH) for 2 mins to remove un-reacted silver and rinsed again in water. Nuclei were then lightly stained with Harris Haematoxylin for few seconds and excess stain was removed with water. Stained sections were dehydrated through graded ethanol, cleared in xylene (BDH) for 5 mins and mounted with Depex (BDH). Transplantation of KMS-derived Sox9-EGFP + /Runx2 + cells into the subcutaneous space of nude mice Reprogrammed Sox9-EGFP + /Runx2 + cells were suspended at cells/ml in mtesr and injected into the dorsal flanks of nude mice. After four weeks of injection, tissues were dissected, fixed in 4% PFA, dehydrated and embedded in paraffin wax. Serial histological sections were processed for immunofluorescence with SOX9 (Chemicon, AB5535), RUNX2 (Abcam, ab76956), OSTERIX (Abcam, ab94744), TYPE I COLLAGEN (Abcam, ab6308) and TYPE II COLLAGEN (Thermo, #MS-235-P0) antibodies, and hematoxylin-eosin or Von Kossa staining Transplantation of reprogrammed nodules into bone fracture Mice were given general anesthesia with 2% isoflurane inhalation and a lateral incision was made in the hind legs near the mid-length of the tibia bone. Under aseptic surgical conditions, animals received an open tibia fracture of the right hind limb by hand drill. 1 x 10 4 reprogrammed SOX9-EGFP + /RUNX2 + nodules were injected into the fracture site and the incision was closed with biological skin glue. Animals were allowed to recover spontaneously from anesthesia. Two doses of buprenorphine (0.1 mg/kg body weight) were used as analgesic, first during the procedure and then every 8-12 hours later. After surgery, mice were monitored daily by external examination and body weight was compared with control animals at the same age. After 6 days of transplantation, tibia bones were collected, fixed in 4% paraformaldehyde, decalcified with EDTA, processed and embedded in paraffin for immunofluorescence and hematoxylin-eosin staining.

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting

TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting Supplemental Material Supplemental Methods TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting In order to determine if the multi-parameter FACS approach would be successful

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

1. Paraffin section slides can be stored at room temperature for a long time.

1. Paraffin section slides can be stored at room temperature for a long time. Immunohistochemistry (IHC) Protocols Immunohistochemistry (IHC) Protocol of Paraffin Section 1. Fix dissected tissues with 10% formalin for no less than 48 hours at room temperature. Inadequately fixation

More information

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

Proteasome activity is required for the initiation of precancerous pancreatic

Proteasome activity is required for the initiation of precancerous pancreatic Proteasome activity is required for the initiation of precancerous pancreatic lesions Takaki Furuyama 1,2, Shinji Tanaka 1,2*, Shu Shimada 1, Yoshimitsu Akiyama 1, Satoshi Matsumura 2, Yusuke Mitsunori

More information

Nature Medicine doi: /nm.2548

Nature Medicine doi: /nm.2548 Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)

More information

Mice TRAMP mice were maintained in a C57BL/6J background. Syngeneic UBI-GFP/BL6 mice were used for bone marrow engraftment. 2

Mice TRAMP mice were maintained in a C57BL/6J background. Syngeneic UBI-GFP/BL6 mice were used for bone marrow engraftment. 2 Antibodies Chicken IgY polyclonal α-gfp antibodies were purchased from Abcam (Cambridge, MA) and were detected using α-chicken IgY-FITC or α-chicken-hrp (also purchased from Abcam). The CD31-PE, CD11b-PE,

More information

Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells

Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the transduction and reprogramming of one well of Oct4-GFP mouse embryonic fibroblasts (MEF) using the Dox Inducible Reprogramming Polycistronic

More information

Supporting Information

Supporting Information Supporting Information Bian et al. 10.1073/pnas.1214100110 SI Materials and Methods Mechanical Analysis. At set time points, samples were removed from the culture and the bulk mechanical properties of

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency

More information

TRIPLE (Insulin, Glucagon and EGFP) Immunofluorescence Staining Protocol in Pancreas Woogyun Choi 1, Randal J. Kaufman 2 and Sung Hoon Back 3*

TRIPLE (Insulin, Glucagon and EGFP) Immunofluorescence Staining Protocol in Pancreas Woogyun Choi 1, Randal J. Kaufman 2 and Sung Hoon Back 3* TRIPLE (Insulin, Glucagon and EGFP) Immunofluorescence Staining Protocol in Pancreas Woogyun Choi 1, Randal J. Kaufman 2 and Sung Hoon Back 3* 1 School of Biological Sciences, University of Ulsan, Ulsan,

More information

Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM

Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM STEMGENT Page 1 Reprogramming Lentivirus Set: Human OKSM OVERVIEW The following procedure describes the reprogramming of BJ Human Fibroblasts (BJ cells) to induced pluripotent stem (ips) cells using the

More information

Supplementary Figure 1 A green: cytokeratin 8

Supplementary Figure 1 A green: cytokeratin 8 Supplementary Figure 1 A green: cytokeratin 8 green: α-sma red: α-sma blue: DAPI blue: DAPI Panc-1 Panc-1 Panc-1+hPSC Panc-1+hPSC monoculture coculture B Suppl. Figure 1: A, Immunofluorescence staining

More information

Supplemental Information. Materials and methods.

Supplemental Information. Materials and methods. Supplemental Information Materials and methods. Cell culture. hmscs were isolated from bone marrow of 3 male donors, undergoing orthopedic surgery (mean age 69.7). Cells were cultured in high glucose DMEM

More information

Formation of Mesenchymal Tissues in Alvetex Scaffold Derived From Stem Cells and Established Cell Lines. Introduction

Formation of Mesenchymal Tissues in Alvetex Scaffold Derived From Stem Cells and Established Cell Lines. Introduction Formation of Mesenchymal Tissues in Derived From Stem Cells and Established Cell Lines Application Note 1 Highlights: Sustained long-term culture of un rat MSCs in Enhanced expression of osteogenic and

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Hypoxyprobe -1 Plus Kit

Hypoxyprobe -1 Plus Kit November 29, 2007 1 PRODUCT INSERT Natural Pharmacia International, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA Hypoxyprobe -1 Plus Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) FITC

More information

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For

More information

Neural Stem Cell Characterization Kit

Neural Stem Cell Characterization Kit Neural Stem Cell Characterization Kit Catalog No. SCR019 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0) 23 8026 2233

More information

Cartilage Staining Kit (Chondrocyte and Cartilage Tissue Staining Kit)

Cartilage Staining Kit (Chondrocyte and Cartilage Tissue Staining Kit) Cat. # MK310 For Research Use Cartilage Staining Kit (Chondrocyte and Cartilage Tissue Staining Kit) Product Manual v201009 Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials

More information

Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4

Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr

More information

Marilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-

Marilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin- Supplementary Information Glucocorticoid receptor and Histone Deacetylase 6 mediate the differential effect of dexamethasone during osteogenesis of Mesenchymal stromal cells (MSCs) Marilyn G. Rimando,

More information

Promoting Osseointegration of Ti Implants through Micro/Nano-Scaled Hierarchical Ti Phosphate / Ti Oxide Hybrid Coating

Promoting Osseointegration of Ti Implants through Micro/Nano-Scaled Hierarchical Ti Phosphate / Ti Oxide Hybrid Coating Promoting Osseointegration of Ti Implants through Micro/Nano-Scaled Hierarchical Ti Phosphate / Ti Oxide Hybrid Coating Nan Jiang 1, Zhijun Guo 2,3, Dan Sun 3, Yubao Li 2, Yutao Yang 1, Chen Chen 2, Li

More information

ab BrdU Immunohistochemistry Kit

ab BrdU Immunohistochemistry Kit ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product

More information

Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections)

Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections) Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections) A. Digoxigenin-UTP labeling of crna antisense probe Refer to laboratory protocol and

More information

Supplementary Methods. Li J.-Y. et al. Lewy bodies in grafted neurons in Parkinson s patients suggest host to. graft disease propagation

Supplementary Methods. Li J.-Y. et al. Lewy bodies in grafted neurons in Parkinson s patients suggest host to. graft disease propagation 1 Supplementary Methods Li J.-Y. et al. Lewy bodies in grafted neurons in Parkinson s patients suggest host to graft disease propagation Neural transplantation and clinical assessment Detailed information

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled

More information

Hypoxyprobe -1 Omni Kit

Hypoxyprobe -1 Omni Kit November 29, 2007 1 PRODUCT INSERT Natural Pharmacia International, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA Hypoxyprobe -1 Omni Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) Rabbit

More information

Whole Mount IHC Protocol

Whole Mount IHC Protocol Whole Mount IHC Protocol Authors: Ruth Sullivan, Ryan Trevena and Kyle Wegner Creation Date: 03/17/2016 All steps should be conducted with gentle agitation on an orbital shaker, unless otherwise instructed.

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Induction of Neurogenesis in Rat Bone Marrow Mesenchymal Stem Cells Using Purine Structure- Based Compounds

Induction of Neurogenesis in Rat Bone Marrow Mesenchymal Stem Cells Using Purine Structure- Based Compounds Electronic supplementary information (ESI) Induction of Neurogenesis in Rat Bone Marrow Mesenchymal Stem Cells Using Purine Structure- Based Compounds Mi Hee Cho, Jung Hwa Lee, Hyun Hee Ahn, Ju Young Lee,

More information

Hypoxyprobe -1 Green Kit Kit contents:

Hypoxyprobe -1 Green Kit Kit contents: Updated 2015 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe -1 Green Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) FITC conjugated

More information

hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm

hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm Supplementary information, Data S1 Materials and Methods Culture and differentiation of hpscs hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm cells as described

More information

Supporting Information. A Fluorogenic Resveratrol-Confined Graphene Oxide For Economic and Rapid. Detection Of Alzheimer's Disease

Supporting Information. A Fluorogenic Resveratrol-Confined Graphene Oxide For Economic and Rapid. Detection Of Alzheimer's Disease Supporting Information A Fluorogenic Resveratrol-Confined Graphene Oxide For Economic and Rapid Detection Of Alzheimer's Disease Xiao-Peng He, 1 Qiong Deng, 1 Liang Cai, 1 Chang-Zheng Wang, 1,2 Yi Zang,*,2

More information

Quantum Dot Labeling of Stem Cells during Proliferation and Differentiation

Quantum Dot Labeling of Stem Cells during Proliferation and Differentiation Copyright 2006 Tech Science Press MCB, vol.3, no.4, pp.153-155, 2006 Quantum Dot Labeling of Stem Cells during Proliferation and Differentiation E. K. Moioli 1, B. Shah 1, P. A. Clark 1, M. Stroscio 1

More information

Hypoxyprobe Plus Kit

Hypoxyprobe Plus Kit Updated 2017 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Plus Kit (HPI Part # HP2-XXX) Kit contents: Solid pimonidazole HCl (Hypoxyprobe

More information

Mammosphere formation assay. Mammosphere culture was performed as previously described (13,

Mammosphere formation assay. Mammosphere culture was performed as previously described (13, Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts

More information

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification

More information

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich). Supplementary Materials Supplementary materials and methods Cell culture. Primary human dermal fibroblasts (DFs) were isolated from full-thickness skin samples. Tissue samples were dissected into small

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

Supplementary Information

Supplementary Information Supplementary Information Mutual reinforcement of inflammation and carcinogenesis by the Helicobacter pylori CagA oncoprotein Nobumi Suzuki, Naoko Murata-Kamiya, Kohei Yanagiya, Wataru Suda, Masahira Hattori,

More information

All mice were housed in a pathogen-free animal facility at Washington University in accordance

All mice were housed in a pathogen-free animal facility at Washington University in accordance Supplemental Material Supplemental Methods: Animal carcinogenesis studies All mice were housed in a pathogen-free animal facility at Washington University in accordance with animal care regulations. In

More information

Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells

Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri

More information

Hypoxyprobe -1 Pacific Blue Kit (HPI Catalog # HP15-XXX)

Hypoxyprobe -1 Pacific Blue Kit (HPI Catalog # HP15-XXX) Updated 2019 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Product Data Sheet for HP Pacific Blue M Picture: Pacific Blue anti pimonidazole mab on

More information

Hypoxyprobe -1 Pacific Blue Kit (HPI Catalog # HP15-XXX)

Hypoxyprobe -1 Pacific Blue Kit (HPI Catalog # HP15-XXX) Updated 2018 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Product Data Sheet for HP Pacific Blue M Picture: Pacific Blue anti pimonidazole mab on

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

ipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer

ipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer ipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer Wenli Yang 1, Jason A. Mills 2, Spencer Sullivan 3, Ying Liu 1, Deborah L. French 2 and Paul Gadue 2, 1 Institute

More information

A Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells

A Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)

More information

PROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY. I. Removal and Fixation of Plantar Skin (see video)

PROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY. I. Removal and Fixation of Plantar Skin (see video) PROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY I. Removal and Fixation of Plantar Skin (see video) 1. Sacrifice the animal a. Anaesthetize the animal by placing in a closed chamber with isoflurane.

More information

Mouse Mesenchymal Stem Cell Functional Identification Kit

Mouse Mesenchymal Stem Cell Functional Identification Kit Mouse Mesenchymal Stem Cell Functional Identification Kit Catalog Number SC010 Reagents for the identification of mouse bone marrow-derived stem cells (BMSC)/mesenchymal stem cells (MSC) by in vitro functional

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

Nature Medicine doi: /nm.2558

Nature Medicine doi: /nm.2558 Supplementary. Fig. 1. (a) Sirt1 and mutant HTT (detected by HTT 81-90 antibody) protein levels were detected by Western blotting in cerebral cortex of N171-82Q mice. (b) Sirt1 and mutant HTT (detected

More information

Electronic Supplementary Information (ESI)

Electronic Supplementary Information (ESI) Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) Gold(III) complexes inhibit growth of cisplatin-resistant

More information

For in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic

For in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic Supplemental Information Cell Host & Microbe, Volume 8 Statins Enhance Formation of Phagocyte Extracellular Traps Ohn A. Chow, Maren von Köckritz-Blickwede, A. Taylor Bright, Mary E. Hensler, Annelies

More information

Materials and Methods Materials Required for Fixing, Embedding and Sectioning. OCT embedding matrix (Thermo Scientific, LAMB/OCT)

Materials and Methods Materials Required for Fixing, Embedding and Sectioning. OCT embedding matrix (Thermo Scientific, LAMB/OCT) Page 1 Introduction Tissue freezing and sectioning is a rapid method of generating tissue samples (cryosections) for histological analysis, and obviates the need for wax embedding. The method is popular

More information

Preparation of thin slices for light microscopy

Preparation of thin slices for light microscopy Preparation of thin slices for light microscopy Optical light microscopy course 23.10.2012 Kirsi Rilla Shortly: Histological sample preparation for microscopy 1. Fixation: To fix the tissue components

More information

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

Supplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein

Supplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein Supplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein expression was analyzed by performing immunofluorescence staining

More information

User Manual. OriCell TM Mesenchymal Stem Cell Osteogenic Differentiation Medium. Cat. No. GUXMX-90021

User Manual. OriCell TM Mesenchymal Stem Cell Osteogenic Differentiation Medium. Cat. No. GUXMX-90021 User Manual OriCell TM Mesenchymal Stem Cell Osteogenic Differentiation Cat. No. GUXMX-90021 PRODUCT DESCRIPTION: OriCell TM Mesenchymal Stem Cell Osteogenic Differentiation consists of optimized Mesenchymal

More information

Application Protocol: CD45 CK Immunostaining for patient blood

Application Protocol: CD45 CK Immunostaining for patient blood REPRODUCTION AND USE This document is protected by copyright and it cannot be used or shared without permission from Vortex Biosciences, Inc. Such permission is given on condition that Vortex Biosciences

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,

More information

In Situ Hybridization

In Situ Hybridization In Situ Hybridization Modified from C. Henry, M. Halpern and Thisse labs April 17, 2013 Table of Contents Reagents... 2 AP Buffer... 2 Developing Solution... 2 Hybridization buffer... 2 PBT... 2 PI Buffer

More information

Supporting Information

Supporting Information Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3

More information

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min

More information

APPLICATION NOTE Page 1

APPLICATION NOTE Page 1 APPLICATION NOTE Page 1 Generation of ips Cells from Oct4-Neo Reporter Embryonic Fibroblasts Dongmei Wu, Yan Gao, Charles Martin, Xun Cheng, Wen Xiong, Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle St.,

More information

BrdU Immunohistochemistry Kit Instruction Manual

BrdU Immunohistochemistry Kit Instruction Manual BrdU Immunohistochemistry Kit Instruction Manual Features Easy to use system Reagents titered for success Proven protocol Ordering Information Catalog Number X1545K Size 50 Slides Format Immunohistochemistry

More information

Table of Contents. I. Kit Components...2. Storage...2. Principle...2. IV. Precautions for operation...3. V. Protocol : reverse transcription...

Table of Contents. I. Kit Components...2. Storage...2. Principle...2. IV. Precautions for operation...3. V. Protocol : reverse transcription... Table of Contents I. Kit Components...2 II. III. Storage...2 Principle...2 IV. Precautions for operation...3 V. Protocol : reverse transcription...3 VI. Protocol : Real-time PCR...5 VII. Appendix...7 VIII.

More information

Technical Manual No Version

Technical Manual No Version TUNEL Apoptosis Detection Kit Cat. No. L00301 (For Cryopreserved Tissue Sections, FITC-labled POD) Technical Manual No. 0269 Version 01132011 I Description. 1 II Key Features.... 1 III Kit Contents.. 1

More information

Hypoxyprobe -1 Kit. Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) Mouse IgG 1 monoclonal antibody (MAb1)

Hypoxyprobe -1 Kit. Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) Mouse IgG 1 monoclonal antibody (MAb1) 1 PRODUCT INSERT Natural Pharmacia International, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA Hypoxyprobe -1 Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) Mouse IgG 1 monoclonal antibody

More information

BrdU IHC Kit. For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells

BrdU IHC Kit. For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells K-ASSAY BrdU IHC Kit For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells Cat. No. KT-077 For Research Use Only. Not for Use in

More information

Antibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing

Antibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing Antibody used for FC The following antibodies were used following manufacturer s instructions: anti-human CD4 (clone HI3, IgG1, k - Becton Dickinson), anti-human CD33 (clone WM3, IgG1, k- Becton Dickinson),

More information

Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100

Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100 Supplementary Methods: Materials. BRL37344, insulin, 3-isobutyl-1-methylxanthine, dibutyryl camp (Bt2-cAMP) and 8-Bromoadenosine 3,5 -cyclic monophosphate sodium (8-br-cAMP), cilostamide, adenosine deaminase,

More information

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang

More information

Methodology for Immunohistochemistry. Learning Objectives:

Methodology for Immunohistochemistry. Learning Objectives: Proteomics Methodology for Immunohistochemistry Methodology for Immunohistochemistry A staining process for identifying the proteins location in cells, tissues by using antigen-antibody property. Immuno

More information

ab BrdU Immunohistochemistry Kit

ab BrdU Immunohistochemistry Kit ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product

More information

User Manual. OriCell TM Rabbit Mesenchymal Stem Cells (MSCs) Cat. No. RBXMX-01001

User Manual. OriCell TM Rabbit Mesenchymal Stem Cells (MSCs) Cat. No. RBXMX-01001 User Manual OriCell TM Rabbit Mesenchymal Stem Cells (MSCs) Cat. No. RBXMX-01001 Table of Contents Contents and Storage 3 Product Introduction 3 Cell Characteristics and Identity 3 Product Application

More information

Impact of source tissue and ex vivo expansion on the characterization of goat mesenchymal stem cells

Impact of source tissue and ex vivo expansion on the characterization of goat mesenchymal stem cells JOURNAL OF ANIMAL SCIENCE AND BIOTECHNOLOGY Impact of source tissue and ex vivo expansion on the characterization of goat mesenchymal stem cells Mohamad-Fauzi et al. Mohamad-Fauzi et al. Journal of Animal

More information

Hypoxyprobe -1 CY 7 Kit (HPI Catalog # HP14-XXX)

Hypoxyprobe -1 CY 7 Kit (HPI Catalog # HP14-XXX) Updated 2017 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Picture: Cy7 Near Infrared dye linked anti pimonidazole mab on hypoxic mouse lung tissue

More information

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

More information

Supplemental data. Supplemental Materials and Methods

Supplemental data. Supplemental Materials and Methods Supplemental data Supplemental Materials and Methods Transfection of plasmid. Transfection of plasmids into FRTL5 cells was performed using Lipofectamine LTX with Plus reagent (Invitrogen) according to

More information

Nodal expression was directly inhibited using antisense Morpholino oligonucleotides

Nodal expression was directly inhibited using antisense Morpholino oligonucleotides Supplementary Note Rationale for Morpholino based inhibition of Nodal expression Nodal expression was directly inhibited using antisense Morpholino oligonucleotides (MO Nodal ) fluorescently labeled with

More information

Tumor tissues or cells were homogenized and proteins were extracted using

Tumor tissues or cells were homogenized and proteins were extracted using SUPPLEMENTAL MATERIALS AND METHODS Western Blotting Tumor tissues or cells were homogenized and proteins were extracted using T-PER tissue protein extraction buffer. Protein concentrations were determined

More information

Peter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre

Peter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre Developmental Cell, Volume 22 Supplemental Information Sox9 Directs Hypertrophic Maturation and Blocks Osteoblast Differentiation of Growth Plate Chondrocytes Peter Dy, Weihuan Wang, Pallavi Bhattaram,

More information

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence

More information

Materials and Methods Materials Required for Fixing, Embedding and Sectioning

Materials and Methods Materials Required for Fixing, Embedding and Sectioning Page 1 Introduction Immunofluorescence uses the recognition of cellular targets by fluorescent dyes or antigenspecific antibodies coupled to fluorophores. Depending on the antibody or dye used, proteins,

More information

Updated April 27, PRODUCT INSERT

Updated April 27, PRODUCT INSERT Updated April 27, 2009 1 PRODUCT INSERT Hypoxyprobe, Inc. 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Gemini Kit Kit Contents: Solid pimonidazole HCl (Hypoxyprobe -1)

More information

Online Data Supplement Airway specific inducible transgene expression using aerosolized doxycycline

Online Data Supplement Airway specific inducible transgene expression using aerosolized doxycycline Online Data Supplement Airway specific inducible transgene expression using aerosolized doxycycline Purushothama Rao Tata, Ana Pardo-Saganta, Mythili Prabhu, Vladimir Vinarsky, Brandon M. Law, Benjamin

More information