Reprogramming of Dermal Fibroblasts into Osteo-Chondrogenic Cells
|
|
- Hilary William Hubbard
- 6 years ago
- Views:
Transcription
1 Stem Cell Reports, Volume 8 Supplemental Information Reprogramming of Dermal Fibroblasts into Osteo-Chondrogenic Cells with Elevated Osteogenic Potency by Defined Transcription Factors Yinxiang Wang, Ming-Hoi Wu, May Pui Lai Cheung, Mai Har Sham, Haruhiko Akiyama, Danny Chan, Kathryn S.E. Cheah, and Martin Cheung
2
3
4
5 Supplemental Figure Legends Figure S1. Screening for the optimal culture conditions and overexpression of KMS into mouse embryonic stem cells does not lead to the formation of SOX9-EGFP+/RUNX2+ nodules. Related to Figure 1. (A) Quantification of KMS-transformed nodules formed from d9 to 14 when cultured in conventional medium on SNL feeder. (B) Quantification of KMS-transformed nodules formed from d9 to 14 when cultured in hypoxic condition (2% O2). Data are expressed as means ± SD. 3 independent experiments are represented in A and B. (C) Retroviral transduction of KMS into mouse embryonic stem cells (ESCs) derived from Sox9-EGFP KI mice generated nodules expressing SOX9-EGFP from d14 to 16 compared to control without transduction in which none of the nodules expressed GFP and RUNX2 in all time points examined. Phase images show morphology of KMStransduced ESCs and control cells. Scale bar: 100µm. Figure S2. Generation of KMS-reprogrammed SOX9-EGFP+/RUNX2+ nodules by dox-inducible lentiviral system and screening for the minimal number of transcription factors for direct conversion of MDFs into SOX9-EGFP+/RUNX2+ nodules. Related to Figure 2. (A) MDFs transduced with dox-inducible lentiviral KMS vectors did not form nodules and/or express GFP and/or RUNX2 in all time points examined following 2 or 4 days of dox treatment whereas nodules began to form on day 10, expressed GFP and RUNX2 from d11 to 13 and maintained GFP but not RUNX2 expression on day 14 following 8 or 10 days of dox treatment. Insets in top right corner show phase images of transduced MDFs or nodules after dox treatment at the indicated time points. (B) Panels showing double immunofluorescence of anti-gfp and anti-runx2 on MDFs reprogrammed with KS, MS, KLF4, c-myc or SOX9 in mtesr medium from d10 to 14 and phase images of their corresponding transduced MDFs. (C) Micrographs of reprogrammed cells on d14. The scale bar represents 50 µm in A, 100 µm in B and C. Figure S3. Molecular characterization of KMS- and KM-reprogrammed SOX9-EGFP+/RUNX2+ nodules. Related to Figures 3 and 4. Real-time RT-PCR analysis of transcript levels for Sox9 (A), Runx2 (B), Col2a1 (C), Sox5 (D), Sox6 (E), CD9 (F), CD73 (G), Col10 (H), Osteopontin (I), Osteocalcin (J), Osterix (K), Cola1 (L), Ihh (M), Ppr (N), Gremlin 1 (O), Oct4 (P), Sox2 (Q), PPAry1 (R), Mmp3 (S) and Igf2 (T) in reprogrammed nodules with KMS or KM. mrna levels from each gene was normalized to Gapdh with fold change relative to MDFs. Data are expressed as means ± SEM. 3 independent experiments are represented in A-T. *p<0.05; **p< 0.01; ***p < 0.001
6 Table S1. List of primers used for real time RT-PCR amplification in this study. Related to Figures 3,4 and S3. Markers Forward primer 5-3 Reverse primer 5-3 Runx2 GGAGCTCGGCGGAGTAGTTC CTGTGGTTACCGTCATGGCC endo-sox9 AGCTCACCAGACCCTGAGAA TCCCAGCAATCGTTACCTTC ex-sox9 CTGGGAACAACCCGTCTACA CACCAGACCAACTGGTAATG Col2a1 TTCCACTTCAGCTATGGCGAT GACGTTAGCGGTGTTGGGAG Sox5 GACAGAAAGAGAATCCATTGGT TTCTTGATCAGCTCTTCCATCT Sox6 CTAAGAATGTCTTCCAAGCAAG AAGTAGTTTTTCCATGCAGGAG Ihh GGCTTCGACTGGGTGTATTA CGGTCCAGGAAAATAAGCAC Ppr ACAAAGGGTGGACGCCAGCA GCGGTCGCAGCGTCTGTAGG Col10a1 GCCAAGCAGTCATGCCTGAT GACACGGGCATACCTGTTACC Col1a1 GCAACAGTCGCTTCACCTACA CAATGTCCAAGGGAGCCACAT Osterix CGCTTTGTGCCTTTGAAAT CCGTCAACGACGTTATGC Osteocalacin CAGACACCATGAGGACCATC GGACTGAGGCTCTGTGAGGT Osteopontin CTTTCACTCCAATCGTCCCTA GCTCTCTTTGGAATGCTCAAGT Ppar-γ1 CCACCAACTTCGGAATCAGCT TTTGTGGATCCGGCAGTTAAGA Oct4 TCTTTCCACCAGGCCCCCGGCTC TGCGGGCGGACATGGGGAGATCC Sox2 TAGAGCTAGACTCCGGGCGATG TTGCCTTAAACAAGACCACGAAA A Mmp3 TGCTGTCTTTGAAGCATTTGGGT T GCACTTCCTTTCACAAAGACTCAG A Igf2 ACAACTTCGATTTGAACCACAT GAGAGCTCAAACCATGCAAACT TC Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA ex-klf4 CCCAGTGTGGTGGTACGGGAAAT GTCGTTGAACTCCTCGGTCT C ex-c-myc CCCAGTGTGGTGGTACGGGAAAT C GCTCGCTCTGCTGTTGCTGGTGATA G Gremlin1 AAGTGACAGAATGAATCGCACC GGACTGGGTCTGCTCAGAGT CD9 CTGGCATTGCAGTGCTTGCTA AACCCGAAGAACAATCCCAGC CD73 CAAATCCCACACAACCACTG TGCTCACTTGGTCACAGGAC endo: endogenous; ex: exogenous
7 Supplemental Experimental Procedures Immunofluorescence Transduced fibroblasts were cultured in 24-well plate and washed with PBS briefly before fixing in 4% paraformaldehyde (PFA) for 10 minutes. Cells were washed and permeabilized with PBS+0.1% Tween 20 (PBST) before blocking with 1% bovine serum albumin (BSA) in PBST for 30 mins at room temperature (R.T). Cells were then incubated with sheep anti-gfp (Ab-direct, ) and rabbit Anti-RUNX2 (Abcam, ab76956) diluted in blocking buffer at 4 C. After overnight incubation, cells were washed three times 20 mins each with PBST before incubating with anti-sheep-igg-fitc (Invitrogen, A11015) and anti-rabbit-igg-cy3 (Jackson Immuno Research Laboratories, Inc, ) for 2 hours at R.T. After washing three times in PBST, cells were mounted with DAPI (VECTASHIELD Hard SetTM) and photographed in an inverted fluorescence microscope (OLYMPUS BX51). Real Time RT-PCR RNA was extracted from reprogrammed nodules, MDFs, ESCs, P10 tibia growth plate, MSCs, osteoblasts, adipocytes and sorted SOX9-EGFP + cells using RNAspin Mini kit (GE Healthcare) and treated with DNase to remove any contaminating genomic DNA based on the manufacturer s protocol. 1µg of RNA was reversetranscribed with Superscript III Reverse Transcriptase (Invitrogen) and oligo(dt) 20 primer. For real-time PCR analysis, 2ul of cdna with 200nM primers was mixed with Power SYBR Green PCR Master Mix (Applied Biosystems) in a total reaction volume of 25µl. Real time PCR reaction was performed in a 96-well Optical Reaction Plate and run on the ABI StepOnePlus Real-Time PCR System with the following parameters: Holding stage: 95 C, 1 min. Cycling stage (40 cycles): 95 C, 15s; 60 C, 1 min. Melting curve stage: 95 C, 15s, 60 C, 1 min, 95 C, 15s. Each sample was run in triplicates and level of transcripts from each gene was normalized to endogenous Gapdh control. The primers used are listed in Table S1. In vitro differentiation For chondrogenic differentiation, reprogrammed SOX9-EGFP + /RUNX2 + nodules were manually picked and replated in chondrogenic differentiation medium consisting of high-glucose DMEM supplemented with 100 nm dexamethasone (Sigma), 50 µg/ml L-ascorbic acid 2-phosphate (Sigma), 40 µg/ml proline (Sigma), 100 µg/ml sodium pyuvate (Gibco), 1% penicillin/streptomycin and 50 mg/ml ITS-Premix (BD Biosciences) (Collaborative Biomedical; 6.25 ng/ml insulin, 6.25 mg transferrin, 6.25 ng/ml selenious acids, 1.25 mg/ml BSA) for 14 days before being processed for Alcian blue staining. For osteogenic differentiation, reprogrammed SOX9-EGFP + /RUNX2 + nodules were subjected to osteogenic differentiation medium containing high-glucose DMEM, 50 µg/ml L-ascorbic acid 2-phosphate, 10 mm β- glycerophosphate (Sigma), 10% FBS, and 1% penicillin/streptomycin for 14 days before being processed for Alizarin Red S staining. For adipogenic differentiation, reprogrammed SOX9-EGFP + /RUNX2 + nodules were incubated in DMEM with 10% FBS medium supplemented with 100 nm dexamethasone and 10 4 M L-ascorbic acid 2-phosphate for 14 days before being processed for Oil Red O staining. Alizarin Red S Staining Reprogrammed nodules were fixed in 10% formaldehyde in 1xPBS for 15 mins, stained with 40mM Alizarin Red S (Sigma) solution for 30 seconds to 5 minutes and washed 3 times with distilled water to remove excess staining solution. Alcian blue staining Reprogrammed nodules were fixed in 4% PFA for 10 mins at room temperature, washed with water twice followed by staining in the Alcian blue (Sigma) in 0.1N HCl solution for mins at room temperature. Stained cells were washed 3 times with water. Oil Red O staining Reprogrammed nodules were fixed in 4% PFA for 10 mins, washed with water twice followed by rinsing with 60% isopropanol before incubation with the freshly prepared Oil Red O working solution [0.3% Oil Red O (Sigma) in isopropanol] for 15 mins at room temperature. Stained cells were immediately rinsed with distilled water 4 times to remove excess Oil Red O solution.
8 Von Kossa staining Histological sections were deparaffinized, hydrated and incubated with 5% silver nitrate solution (Sigma) and placed under a 60-watt light bulb at a range of several inches for 30 mins. Sections were then washed with water 3 times, incubated with 5% sodium thiosulfate (BDH) for 2 mins to remove un-reacted silver and rinsed again in water. Nuclei were then lightly stained with Harris Haematoxylin for few seconds and excess stain was removed with water. Stained sections were dehydrated through graded ethanol, cleared in xylene (BDH) for 5 mins and mounted with Depex (BDH). Transplantation of KMS-derived Sox9-EGFP + /Runx2 + cells into the subcutaneous space of nude mice Reprogrammed Sox9-EGFP + /Runx2 + cells were suspended at cells/ml in mtesr and injected into the dorsal flanks of nude mice. After four weeks of injection, tissues were dissected, fixed in 4% PFA, dehydrated and embedded in paraffin wax. Serial histological sections were processed for immunofluorescence with SOX9 (Chemicon, AB5535), RUNX2 (Abcam, ab76956), OSTERIX (Abcam, ab94744), TYPE I COLLAGEN (Abcam, ab6308) and TYPE II COLLAGEN (Thermo, #MS-235-P0) antibodies, and hematoxylin-eosin or Von Kossa staining Transplantation of reprogrammed nodules into bone fracture Mice were given general anesthesia with 2% isoflurane inhalation and a lateral incision was made in the hind legs near the mid-length of the tibia bone. Under aseptic surgical conditions, animals received an open tibia fracture of the right hind limb by hand drill. 1 x 10 4 reprogrammed SOX9-EGFP + /RUNX2 + nodules were injected into the fracture site and the incision was closed with biological skin glue. Animals were allowed to recover spontaneously from anesthesia. Two doses of buprenorphine (0.1 mg/kg body weight) were used as analgesic, first during the procedure and then every 8-12 hours later. After surgery, mice were monitored daily by external examination and body weight was compared with control animals at the same age. After 6 days of transplantation, tibia bones were collected, fixed in 4% paraformaldehyde, decalcified with EDTA, processed and embedded in paraffin for immunofluorescence and hematoxylin-eosin staining.
Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
More informationFlow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
More informationTF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting
Supplemental Material Supplemental Methods TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting In order to determine if the multi-parameter FACS approach would be successful
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationTable S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number
Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationCell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
More informationProtocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction
More informationSupplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More information1. Paraffin section slides can be stored at room temperature for a long time.
Immunohistochemistry (IHC) Protocols Immunohistochemistry (IHC) Protocol of Paraffin Section 1. Fix dissected tissues with 10% formalin for no less than 48 hours at room temperature. Inadequately fixation
More informationProtocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction
More informationProteasome activity is required for the initiation of precancerous pancreatic
Proteasome activity is required for the initiation of precancerous pancreatic lesions Takaki Furuyama 1,2, Shinji Tanaka 1,2*, Shu Shimada 1, Yoshimitsu Akiyama 1, Satoshi Matsumura 2, Yusuke Mitsunori
More informationNature Medicine doi: /nm.2548
Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)
More informationMice TRAMP mice were maintained in a C57BL/6J background. Syngeneic UBI-GFP/BL6 mice were used for bone marrow engraftment. 2
Antibodies Chicken IgY polyclonal α-gfp antibodies were purchased from Abcam (Cambridge, MA) and were detected using α-chicken IgY-FITC or α-chicken-hrp (also purchased from Abcam). The CD31-PE, CD11b-PE,
More informationProtocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells
STEMGENT Page 1 OVERVIEW The following protocol describes the transduction and reprogramming of one well of Oct4-GFP mouse embryonic fibroblasts (MEF) using the Dox Inducible Reprogramming Polycistronic
More informationSupporting Information
Supporting Information Bian et al. 10.1073/pnas.1214100110 SI Materials and Methods Mechanical Analysis. At set time points, samples were removed from the culture and the bulk mechanical properties of
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationProtocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency
More informationTRIPLE (Insulin, Glucagon and EGFP) Immunofluorescence Staining Protocol in Pancreas Woogyun Choi 1, Randal J. Kaufman 2 and Sung Hoon Back 3*
TRIPLE (Insulin, Glucagon and EGFP) Immunofluorescence Staining Protocol in Pancreas Woogyun Choi 1, Randal J. Kaufman 2 and Sung Hoon Back 3* 1 School of Biological Sciences, University of Ulsan, Ulsan,
More informationProtocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM
STEMGENT Page 1 Reprogramming Lentivirus Set: Human OKSM OVERVIEW The following procedure describes the reprogramming of BJ Human Fibroblasts (BJ cells) to induced pluripotent stem (ips) cells using the
More informationSupplementary Figure 1 A green: cytokeratin 8
Supplementary Figure 1 A green: cytokeratin 8 green: α-sma red: α-sma blue: DAPI blue: DAPI Panc-1 Panc-1 Panc-1+hPSC Panc-1+hPSC monoculture coculture B Suppl. Figure 1: A, Immunofluorescence staining
More informationSupplemental Information. Materials and methods.
Supplemental Information Materials and methods. Cell culture. hmscs were isolated from bone marrow of 3 male donors, undergoing orthopedic surgery (mean age 69.7). Cells were cultured in high glucose DMEM
More informationFormation of Mesenchymal Tissues in Alvetex Scaffold Derived From Stem Cells and Established Cell Lines. Introduction
Formation of Mesenchymal Tissues in Derived From Stem Cells and Established Cell Lines Application Note 1 Highlights: Sustained long-term culture of un rat MSCs in Enhanced expression of osteogenic and
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationHypoxyprobe -1 Plus Kit
November 29, 2007 1 PRODUCT INSERT Natural Pharmacia International, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA Hypoxyprobe -1 Plus Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) FITC
More informationPositive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
More informationNeural Stem Cell Characterization Kit
Neural Stem Cell Characterization Kit Catalog No. SCR019 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0) 23 8026 2233
More informationCartilage Staining Kit (Chondrocyte and Cartilage Tissue Staining Kit)
Cat. # MK310 For Research Use Cartilage Staining Kit (Chondrocyte and Cartilage Tissue Staining Kit) Product Manual v201009 Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials
More informationFigure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4
Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr
More informationMarilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-
Supplementary Information Glucocorticoid receptor and Histone Deacetylase 6 mediate the differential effect of dexamethasone during osteogenesis of Mesenchymal stromal cells (MSCs) Marilyn G. Rimando,
More informationPromoting Osseointegration of Ti Implants through Micro/Nano-Scaled Hierarchical Ti Phosphate / Ti Oxide Hybrid Coating
Promoting Osseointegration of Ti Implants through Micro/Nano-Scaled Hierarchical Ti Phosphate / Ti Oxide Hybrid Coating Nan Jiang 1, Zhijun Guo 2,3, Dan Sun 3, Yubao Li 2, Yutao Yang 1, Chen Chen 2, Li
More informationab BrdU Immunohistochemistry Kit
ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product
More informationCombined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections)
Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections) A. Digoxigenin-UTP labeling of crna antisense probe Refer to laboratory protocol and
More informationSupplementary Methods. Li J.-Y. et al. Lewy bodies in grafted neurons in Parkinson s patients suggest host to. graft disease propagation
1 Supplementary Methods Li J.-Y. et al. Lewy bodies in grafted neurons in Parkinson s patients suggest host to graft disease propagation Neural transplantation and clinical assessment Detailed information
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More informationHypoxyprobe -1 Omni Kit
November 29, 2007 1 PRODUCT INSERT Natural Pharmacia International, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA Hypoxyprobe -1 Omni Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) Rabbit
More informationWhole Mount IHC Protocol
Whole Mount IHC Protocol Authors: Ruth Sullivan, Ryan Trevena and Kyle Wegner Creation Date: 03/17/2016 All steps should be conducted with gentle agitation on an orbital shaker, unless otherwise instructed.
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationInduction of Neurogenesis in Rat Bone Marrow Mesenchymal Stem Cells Using Purine Structure- Based Compounds
Electronic supplementary information (ESI) Induction of Neurogenesis in Rat Bone Marrow Mesenchymal Stem Cells Using Purine Structure- Based Compounds Mi Hee Cho, Jung Hwa Lee, Hyun Hee Ahn, Ju Young Lee,
More informationHypoxyprobe -1 Green Kit Kit contents:
Updated 2015 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe -1 Green Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) FITC conjugated
More informationhescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm
Supplementary information, Data S1 Materials and Methods Culture and differentiation of hpscs hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm cells as described
More informationSupporting Information. A Fluorogenic Resveratrol-Confined Graphene Oxide For Economic and Rapid. Detection Of Alzheimer's Disease
Supporting Information A Fluorogenic Resveratrol-Confined Graphene Oxide For Economic and Rapid Detection Of Alzheimer's Disease Xiao-Peng He, 1 Qiong Deng, 1 Liang Cai, 1 Chang-Zheng Wang, 1,2 Yi Zang,*,2
More informationQuantum Dot Labeling of Stem Cells during Proliferation and Differentiation
Copyright 2006 Tech Science Press MCB, vol.3, no.4, pp.153-155, 2006 Quantum Dot Labeling of Stem Cells during Proliferation and Differentiation E. K. Moioli 1, B. Shah 1, P. A. Clark 1, M. Stroscio 1
More informationHypoxyprobe Plus Kit
Updated 2017 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Plus Kit (HPI Part # HP2-XXX) Kit contents: Solid pimonidazole HCl (Hypoxyprobe
More informationMammosphere formation assay. Mammosphere culture was performed as previously described (13,
Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts
More informationSupplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell
Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification
More informationTrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by
Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was
More informationReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)
Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming
More informationCell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).
Supplementary Materials Supplementary materials and methods Cell culture. Primary human dermal fibroblasts (DFs) were isolated from full-thickness skin samples. Tissue samples were dissected into small
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationSupplementary Information
Supplementary Information Mutual reinforcement of inflammation and carcinogenesis by the Helicobacter pylori CagA oncoprotein Nobumi Suzuki, Naoko Murata-Kamiya, Kohei Yanagiya, Wataru Suda, Masahira Hattori,
More informationAll mice were housed in a pathogen-free animal facility at Washington University in accordance
Supplemental Material Supplemental Methods: Animal carcinogenesis studies All mice were housed in a pathogen-free animal facility at Washington University in accordance with animal care regulations. In
More informationSupplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells
Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri
More informationHypoxyprobe -1 Pacific Blue Kit (HPI Catalog # HP15-XXX)
Updated 2019 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Product Data Sheet for HP Pacific Blue M Picture: Pacific Blue anti pimonidazole mab on
More informationHypoxyprobe -1 Pacific Blue Kit (HPI Catalog # HP15-XXX)
Updated 2018 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Product Data Sheet for HP Pacific Blue M Picture: Pacific Blue anti pimonidazole mab on
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer
ipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer Wenli Yang 1, Jason A. Mills 2, Spencer Sullivan 3, Ying Liu 1, Deborah L. French 2 and Paul Gadue 2, 1 Institute
More informationA Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)
More informationPROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY. I. Removal and Fixation of Plantar Skin (see video)
PROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY I. Removal and Fixation of Plantar Skin (see video) 1. Sacrifice the animal a. Anaesthetize the animal by placing in a closed chamber with isoflurane.
More informationMouse Mesenchymal Stem Cell Functional Identification Kit
Mouse Mesenchymal Stem Cell Functional Identification Kit Catalog Number SC010 Reagents for the identification of mouse bone marrow-derived stem cells (BMSC)/mesenchymal stem cells (MSC) by in vitro functional
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationNature Medicine doi: /nm.2558
Supplementary. Fig. 1. (a) Sirt1 and mutant HTT (detected by HTT 81-90 antibody) protein levels were detected by Western blotting in cerebral cortex of N171-82Q mice. (b) Sirt1 and mutant HTT (detected
More informationElectronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) Gold(III) complexes inhibit growth of cisplatin-resistant
More informationFor in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic
Supplemental Information Cell Host & Microbe, Volume 8 Statins Enhance Formation of Phagocyte Extracellular Traps Ohn A. Chow, Maren von Köckritz-Blickwede, A. Taylor Bright, Mary E. Hensler, Annelies
More informationMaterials and Methods Materials Required for Fixing, Embedding and Sectioning. OCT embedding matrix (Thermo Scientific, LAMB/OCT)
Page 1 Introduction Tissue freezing and sectioning is a rapid method of generating tissue samples (cryosections) for histological analysis, and obviates the need for wax embedding. The method is popular
More informationPreparation of thin slices for light microscopy
Preparation of thin slices for light microscopy Optical light microscopy course 23.10.2012 Kirsi Rilla Shortly: Histological sample preparation for microscopy 1. Fixation: To fix the tissue components
More informationSupplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
More informationSupplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein
Supplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein expression was analyzed by performing immunofluorescence staining
More informationUser Manual. OriCell TM Mesenchymal Stem Cell Osteogenic Differentiation Medium. Cat. No. GUXMX-90021
User Manual OriCell TM Mesenchymal Stem Cell Osteogenic Differentiation Cat. No. GUXMX-90021 PRODUCT DESCRIPTION: OriCell TM Mesenchymal Stem Cell Osteogenic Differentiation consists of optimized Mesenchymal
More informationApplication Protocol: CD45 CK Immunostaining for patient blood
REPRODUCTION AND USE This document is protected by copyright and it cannot be used or shared without permission from Vortex Biosciences, Inc. Such permission is given on condition that Vortex Biosciences
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationCytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
More informationIn Situ Hybridization
In Situ Hybridization Modified from C. Henry, M. Halpern and Thisse labs April 17, 2013 Table of Contents Reagents... 2 AP Buffer... 2 Developing Solution... 2 Hybridization buffer... 2 PBT... 2 PI Buffer
More informationSupporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
More informationMeasurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer
SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min
More informationAPPLICATION NOTE Page 1
APPLICATION NOTE Page 1 Generation of ips Cells from Oct4-Neo Reporter Embryonic Fibroblasts Dongmei Wu, Yan Gao, Charles Martin, Xun Cheng, Wen Xiong, Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle St.,
More informationBrdU Immunohistochemistry Kit Instruction Manual
BrdU Immunohistochemistry Kit Instruction Manual Features Easy to use system Reagents titered for success Proven protocol Ordering Information Catalog Number X1545K Size 50 Slides Format Immunohistochemistry
More informationTable of Contents. I. Kit Components...2. Storage...2. Principle...2. IV. Precautions for operation...3. V. Protocol : reverse transcription...
Table of Contents I. Kit Components...2 II. III. Storage...2 Principle...2 IV. Precautions for operation...3 V. Protocol : reverse transcription...3 VI. Protocol : Real-time PCR...5 VII. Appendix...7 VIII.
More informationTechnical Manual No Version
TUNEL Apoptosis Detection Kit Cat. No. L00301 (For Cryopreserved Tissue Sections, FITC-labled POD) Technical Manual No. 0269 Version 01132011 I Description. 1 II Key Features.... 1 III Kit Contents.. 1
More informationHypoxyprobe -1 Kit. Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) Mouse IgG 1 monoclonal antibody (MAb1)
1 PRODUCT INSERT Natural Pharmacia International, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA Hypoxyprobe -1 Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) Mouse IgG 1 monoclonal antibody
More informationBrdU IHC Kit. For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells
K-ASSAY BrdU IHC Kit For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells Cat. No. KT-077 For Research Use Only. Not for Use in
More informationAntibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing
Antibody used for FC The following antibodies were used following manufacturer s instructions: anti-human CD4 (clone HI3, IgG1, k - Becton Dickinson), anti-human CD33 (clone WM3, IgG1, k- Becton Dickinson),
More informationGene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100
Supplementary Methods: Materials. BRL37344, insulin, 3-isobutyl-1-methylxanthine, dibutyryl camp (Bt2-cAMP) and 8-Bromoadenosine 3,5 -cyclic monophosphate sodium (8-br-cAMP), cilostamide, adenosine deaminase,
More informationSmooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
More informationMethodology for Immunohistochemistry. Learning Objectives:
Proteomics Methodology for Immunohistochemistry Methodology for Immunohistochemistry A staining process for identifying the proteins location in cells, tissues by using antigen-antibody property. Immuno
More informationab BrdU Immunohistochemistry Kit
ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product
More informationUser Manual. OriCell TM Rabbit Mesenchymal Stem Cells (MSCs) Cat. No. RBXMX-01001
User Manual OriCell TM Rabbit Mesenchymal Stem Cells (MSCs) Cat. No. RBXMX-01001 Table of Contents Contents and Storage 3 Product Introduction 3 Cell Characteristics and Identity 3 Product Application
More informationImpact of source tissue and ex vivo expansion on the characterization of goat mesenchymal stem cells
JOURNAL OF ANIMAL SCIENCE AND BIOTECHNOLOGY Impact of source tissue and ex vivo expansion on the characterization of goat mesenchymal stem cells Mohamad-Fauzi et al. Mohamad-Fauzi et al. Journal of Animal
More informationHypoxyprobe -1 CY 7 Kit (HPI Catalog # HP14-XXX)
Updated 2017 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Picture: Cy7 Near Infrared dye linked anti pimonidazole mab on hypoxic mouse lung tissue
More informationMethods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis
Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding
More informationSupplemental data. Supplemental Materials and Methods
Supplemental data Supplemental Materials and Methods Transfection of plasmid. Transfection of plasmids into FRTL5 cells was performed using Lipofectamine LTX with Plus reagent (Invitrogen) according to
More informationNodal expression was directly inhibited using antisense Morpholino oligonucleotides
Supplementary Note Rationale for Morpholino based inhibition of Nodal expression Nodal expression was directly inhibited using antisense Morpholino oligonucleotides (MO Nodal ) fluorescently labeled with
More informationTumor tissues or cells were homogenized and proteins were extracted using
SUPPLEMENTAL MATERIALS AND METHODS Western Blotting Tumor tissues or cells were homogenized and proteins were extracted using T-PER tissue protein extraction buffer. Protein concentrations were determined
More informationPeter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre
Developmental Cell, Volume 22 Supplemental Information Sox9 Directs Hypertrophic Maturation and Blocks Osteoblast Differentiation of Growth Plate Chondrocytes Peter Dy, Weihuan Wang, Pallavi Bhattaram,
More informationSupplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
More informationMaterials and Methods Materials Required for Fixing, Embedding and Sectioning
Page 1 Introduction Immunofluorescence uses the recognition of cellular targets by fluorescent dyes or antigenspecific antibodies coupled to fluorophores. Depending on the antibody or dye used, proteins,
More informationUpdated April 27, PRODUCT INSERT
Updated April 27, 2009 1 PRODUCT INSERT Hypoxyprobe, Inc. 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Gemini Kit Kit Contents: Solid pimonidazole HCl (Hypoxyprobe -1)
More informationOnline Data Supplement Airway specific inducible transgene expression using aerosolized doxycycline
Online Data Supplement Airway specific inducible transgene expression using aerosolized doxycycline Purushothama Rao Tata, Ana Pardo-Saganta, Mythili Prabhu, Vladimir Vinarsky, Brandon M. Law, Benjamin
More information