Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
|
|
- Merryl Allen
- 5 years ago
- Views:
Transcription
1 Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen, Pei Han, Jin Yang, Kryn Stankunas, Bingruo Wu, Minggui Pan, Bin Zhou, Michael T. Longaker, and Ching-Pin Chang Inventory of Supplemental Information Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene deletion only in the bulge and bulge-derived cells but not in the epidermis. It also shows that Nfatc1Cre;Brg1 f/f mice had no defects in hair morphogenesis before the first hair regeneration cycle began. Furthermore, Figure S1 reveals normal epidermal differentiation in Nfatc1Cre;Brg1 f/f mice. This figure is important to show the specificity of Brg1 deletion and hair follicle phenotype. Supplemental Figure 2 (Figure S2), related to Figure 2 Figure S2 provides evidence to show the absence of skin permeability defects in the mutant mice and to show the requirement of bulge Brg1 for the early phase of wound repair. Supplemental Figure 3 (Figure S3), related to Figure 3 Figure S3 provides evidence to show the absence of bulge cell apoptosis in the mutant mice and in human bulge cells with BRG1 knocked down. It also provides a validation of
2 bulge cell marker expression in the human bulge cells and a quantitation of BRG1 protein in human bulge cells with BRG1 knocked down. Supplemental Figure 4 (Figure S4), related to Figure 4 Figure S4 shows Wnt signaling in the hair follicles of TOPGAL mice and multiple repeats of Shh RNA-in Situ images to further support Figure 4. Supplemental Figure 5 (Figure S5), related to Figure 5 Figure S5 shows the predicted binding sites of NF B on Shh promoter. Supplemental Figure 6 (Figure S6), related to Figure 7 Figure S6 shows the rescue of cell proliferation and p27 Kip1 expression by Shh driven by a heterologous CMV promoter in Brg1-deficent human bulge cells. Supplemental Experimental Procedures Complete list of the primary antibodies used for immunostaining, western blots and Co-IP. Sequences of PCR primers for ChIP and RT qpcr. Detailed protocol for in vitro BrdU labeling in bulge cells.
3
4
5
6
7
8
9 Supplemental Figure Legends Figure S1, related to Figure 1 Hair morphogenesis and epidermal differentiation are normal in mutant (A and B) X-gal staining of the skin of Nfatc1Cre;Brg1 f/+ ;R26R (A) and Nfatc1Cre;Brg1 f/f ;R26R (B) at embryonic day 17 (E17). Dashed lines indicate the developing hair follicles. (C F) Immunostaining of Brg1 (red) in the skin of Brg1 f/f (C, E) and Nfatc1Cre;Brg1 f/f (D, F) at E17 (C, D) and P7 (E, F). DAPI (DNA): blue. Dashed lines mark the epidermal and dermal junction. Arrows point to the hair follicles and epidermis. (G I) Hair coat of Brg1 f/f (G), Nfatc1Cre;Brg1 f/+ (H), and Nfatc1Cre;Brg1 f/f (I) mice at P20. (L O) Hematoxylin eosin staining of hair follicles of Brg1 f/f mice at P7 (L) and P19 (N), as well as hair follicles of Nfatc1Cre;Brg1 f/f mice at P7 (M) and P19 (O). (P and Q) Immunostaining of Pbx1 (brown) in the hair follicle dermal papilla at P22. DP: dermal papilla. Counterstain: hematoxylin. (R and S) Immunostaining of K5 (pink) of Brg1 f/f (R) and Nfatc1Cre;Brg1 f/f (S) skin at P50. DAPI: blue. (U and V) Immunostaining of K10 (green) of Brg1 f/f (U) and Nfatc1Cre;Brg1 f/f (V) skin at P30. DAPI: blue. (W and X) Immunostaining of Loricrin (brown) of Brg1 f/f (W) and Nfatc1Cre;Brg1 f/f (X) skin at P50. Counterstain: hematoxylin. Figure S2, related to Figure 2 Mutant skin has normal barrier function but impaired wound repair
10 (A and B) Toluidine blue staining of whole embryos of Brg1 f/f and Nfatc1Cre;Brg1 f/f at E14 (A) and E18 (B). (C and D) Toluidine blue staining of the back skin of Brg1 f/f (C) and Nfatc1Cre;Brg1 f/f (D) at P60. Positive staining was seen in E12 Brg1 f/f and Nfatc1Cre;Brg1 f/f embryos (pointed by white arrows). (E and F) X-gal staining of skin incision sites of Nfatc1Cre;Brg1 f/+ ;R26R (C) and Nfatc1Cre;Brg1 f/f ;R26R (D) two days after skin incision. Figure S3, related to Figure 3 No increased cell death in Brg1-null follicles and validation of human bulge cells (A F) TUNEL staining of Brg1 f/f (A, C, E) and Nfatc1Cre;Brg1 f/f (B, D, F) follicles at P22, P32 and P50. TUNEL: Green. DAPI: blue. (G I) Immunostaining of K15 (red, G), SOX9 (pink, H) and BRG1 (green, I) in human bulge cells. Feeder: NIH-3T3 feeder cells. Arrows point out feeder and bulge cells. (J) Quantification of Brg1 protein in sictrl and sibrg1 bulge cells with or without doxycycline treatment by western blots. P values were calculated using the Student s t-test. Error bars are data + 1 standard error. Figure S4, related to Figure 4 Shh expression is absent in Nfatc1Cre;Brg1 f/f follicles (A D) X-gal staining of Brg1 f/f ; TOPGAL (A, C) and Nfatc1Cre;Brg1 f/f ; TOPGAL (B, D) follicles at P22 and P40. Counterstain: nuclear fast.
11 (E J) Shh RNA in situ hybridization of Brg1 f/f (A, C, E) and Nfatc1Cre;Brg1 f/f (B, D, F) follicles at P22 and P32. Figure S5, related to Figure 5 Predicted NFκB binding sites on the Shh promoter Schematic illustration that shows the predicted NFκB binding sites (purple bars) on the Shh promoter. S1 S8: evolutionarily conserved regions of the Shh promoter. Figure S6, related to Figure 7 Rescue of cell proliferation and p27 Kip1 expression by Shh in Brg1-deficent human bulge cells (A D) Growth of human bulge cells 48 hours after doxycycline (Dox) treatment and sictrl (A, C) or sibrg1 (B, D) infection in the presence of control lentivirus (A, B) or SHH-expressing lentivirus (C, D). SHH expression is driven by CMV promoter in the lentiviral construct. (E and F) Quantitation of BRG1 and p27 Kip1 expression in human bulge cells 48 hours after doxycycline treatment and sictrl or sibrg1 infection in the presence of control lentivirus (E) or SHH-expressing lentivirus (F). P values were calculated using the Student s t-test. Error bars are data + 1 standard error.
12 Supplemental Experimental Procedures Primary antibodies for immunostaining, western blots and ChIP The following primary antibodies were used for immunostaining: J1 anti-brg1 antibody (Hang et al., 2010), G7 anti-brg1 (sc-17796, Santa Cruz Biotechnology), Ki67 (M7249, Dako), cytokeratin 15 (K15) (ab80522, Abcam), Nfatc1 (7A6) (sc-7294, Santa Cruz biotechnology), Sox9 (H-90) (sc-20095, Santa Cruz biotechnology), BrdU (ab6326, Abcam), β-tubulin (Clone E7, Hybridoma Bank), p27 kip1 (ab7961, Abcam), β-catenin (ab16051, Abcam), psmad2/3 (sc , Santa Cruz Biotechnology), Gli1 (ab49314, Abcam), NFkB p65 (ab7970, Abcam), Patched1 (ab39266, Abcam), cytokeratin 5 (K5) (ab24647, Abcam), cytokeratin 10 (K10) (ab9025, Abcam), Loricrin (ab85679, Abcam) and Gli2 (ab26056, Abcam). PCR primers for ChIP experiment PCR primers for the conserved regions of Shh promoter: S1 (+81 to 105); S2 ( 651 to 821); S3 ( 753 to 990); S4 ( 1,007 to 1,243); S5 ( 1,694 to 1,803); S6 ( 2,960 to 3,148); S7 ( 3,421 to 3,520); S8 ( 3,730 to 3,813). Control primers (SC1-4) for the non-conserved regions of the Shh promoter: SC1 ( 5,471 to 5,657), SC2 ( 6,562 to 6,759), SC3 ( 6,911 to 7,142), SC4 ( 7,548 to 7,726). Control primers for conserved regions of α-mhc, ß-MHC, and Bmp10 promoters (P1-P4): α-mhc ( 357 to 463), ß-MHC ( 64 to 205), P1 ( 264 to 411), P2 ( 1,430 to 1,579), P3 ( 1,724 to 1,868), and P4 ( 4,420 to 4,529). B1-B4 primer sets were designed to target the proximal promoter (B1) or predicted Gli binding sites (B2 B4) on the mouse or human BRG1 promoter: B1 ( 403 to 604); B2 ( 647 to 793); B3 ( 2566 to
13 2760); B4 ( 3793 to 3904). The DNA positions are denoted relative to the transcriptional start site (+1). Reverse transcription quantitative PCR (RT qpcr) The RT-qPCR reactions were performed using SYBR green master mix (BioRad, Hercules, CA). The primer sets used were tested to be quantitative: Human p27 Kip1, 5 primer CGTAAACAGCTCGAATTAAGAA, 3 primer CATTCCATGAAGTCAGCGATA. Human Cdk4, 5 primer ACAGCTACCAGATGGCACTTACA, 3 primer AAAGATACAGCCAACACTCCACA. Human Cdk6, 5 primer ACGTGGTCAGGTTGTTTGATGT, 3 primer TATCCTTTATGGTTTCAGTGGG, Human Cyclin D1, 5 primer AAAATGCCAGAGGCGGAGGAGA, 3 primer GGAGGGCGGATTGGAAATGAAC, Human Cyclin D2, 5 primer CTTCAAGTGCGTGCAGAAGGA, 3 primer CCAAGAAACGGTCCAGGTAAT, Human p16 INK4a, 5 primer TAAGTGCTCGGAGTTAATAGC, 3 primer CCTGTCCCTCAAATCCTCTG, Human H3F3A, 5 primer AAAACAGATCTGCGCTTCCA, 3 primer TTGTTACACGTTTGGCATGG. Human Brg1, 5 primer AGTGCTGCTGTTCTGCCAAAT, 3 primer GGCTCGTTGAAGGTTTTCAG. BrdU labeling Before harvesting, cells are incubated with 50 µm bromodexoyuridine (BrdU; B5002, Sigma- Aldrich) for 20 min at 37 C. The NIH-3T3 feeder cells were removed by Versene solution ( , Invitrogen) and the bulge cells were fixed, washed, permeabilized by 0.1% Triton X-
14 100 (T8532, Sigma-Aldrich) and then blocked in 3% bovine serum albumin (BSA, A2058, Sigma-Aldrich). The primary antibodies used were described above.
Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair
Article Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, 1 Wei Li, 1 Ching Shang, 1 Richard M. Chen, 1 Pei Han, 1 Jin Yang, 1 Kryn Stankunas,
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationSupplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)
Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) in the cortex (area 1 as defined in Fig. 2a), and corpus
More informationSupplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into
More informationbronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not
Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is
More informationPositive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
More informationSupplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like
Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
More informationA population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity
A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico
More informationGM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
More informationJung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
More informationSupplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with
Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with blunted cusp formation, and presence of an ectopic molar
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin
More informationSupplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. qrt-pcr analysis of the expression of candidate factors including SOX2, MITF, PAX3, DLX5, FOXD3, LEF1, MSX1, PAX6, SOX2 and SOX9
More informationPeter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre
Developmental Cell, Volume 22 Supplemental Information Sox9 Directs Hypertrophic Maturation and Blocks Osteoblast Differentiation of Growth Plate Chondrocytes Peter Dy, Weihuan Wang, Pallavi Bhattaram,
More informationFour different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and
SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer
More information0.9 5 H M L E R -C tr l in T w is t1 C M
a. b. c. d. e. f. g. h. 2.5 C elltiter-g lo A ssay 1.1 5 M T S a s s a y Lum inescence (A.U.) 2.0 1.5 1.0 0.5 n s H M L E R -C tr l in C tr l C M H M L E R -C tr l in S n a il1 C M A bsorbance (@ 490nm
More informationMethods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis
Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding
More informationSupplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3575 In the format provided by the authors and unedited. Supplementary Figure 1 Validation of key reagents and assays a, top, IHC with antibody recognizing specifically
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationGene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG
Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationSUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationJournal: Nature Neuroscience
Journal: Nature Neuroscience Article Title: Corresponding Author: Yy1 as molecular link between neuregulin and transcriptional modulation of peripheral myelination. Patrizia Casaccia Supplementary Item
More informationSupplemental Methods Cell lines and culture
Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,
More informationRespiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Gillespie et al., http://www.jcb.org/cgi/content/full/jcb.200907037/dc1 repressor complex induced by p38- Gillespie et al. Figure S1. Reduced fiber size
More informationUSP19 modulates autophagy and antiviral immune responses by. deubiquitinating Beclin-1
USP19 modulates autophagy and antiviral immune responses by deubiquitinating Beclin-1 Shouheng Jin 1,2,, Shuo Tian 1,, Yamei Chen 1,, Chuanxia Zhang 1,2, Weihong Xie, 1 Xiaojun Xia 3,4, Jun Cui 1,3* &
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationIn general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days
Animal injections and tissue processing In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days before they received any injections. Mice were injected with sesame seed oil
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationSupplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.
Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)
More informationTRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
More informationSupplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
More informationSTAT3 signaling controls satellite cell expansion and skeletal muscle repair
SUPPLEMENTARY INFORMATION STAT3 signaling controls satellite cell expansion and skeletal muscle repair Matthew Timothy Tierney 1 *, Tufan Aydogdu 2,3 *, David Sala 2, Barbora Malecova 2, Sole Gatto 2,
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationProteasome activity is required for the initiation of precancerous pancreatic
Proteasome activity is required for the initiation of precancerous pancreatic lesions Takaki Furuyama 1,2, Shinji Tanaka 1,2*, Shu Shimada 1, Yoshimitsu Akiyama 1, Satoshi Matsumura 2, Yusuke Mitsunori
More informationSupplementary Fig. 1
a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationSupplementary Information. Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis
Supplementary Information Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis Authors Thomas C. Roberts 1,2, Usue Etxaniz 1, Alessandra Dall Agnese 1, Shwu-Yuan Wu
More informationSupplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
More informationElectrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-
SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning
More informationSupplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox
Supplementary Figure S1: (A) Schematic representation of the Flox/Flox locus and the strategy used to visualize the wt and the Flox/Flox mrna by PCR from cdna. An example of the genotyping strategy is
More informationFIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and
Supplementary Figures FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and mutant (mut) cells. Higher magnification is shown in Figure 1A. Arrows indicate cisplatin-induced
More informationInventory of Supplemental Information for Melkman-Zehavi et al.
Inventory of Supplemental Information for Melkman-Zehavi et al. Supplementary methods for Melkman et al. Supplementary Figures Figure S1, related to Figure 2 Islet size and total beta cell mass of mutant
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationAccelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,
More informationSupplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably
Supplementary Information Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably expressing shrna sequences against TRF2 were examined by western blotting. shcon, shrna
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationRacine et al, Histone H2B ubiquitylation promotes activity of the intact Set1 histone methyltransferase complex in fission yeast
Supplemental Materials Racine et al, Histone H2B ubiquitylation promotes activity of the intact Set histone methyltransferase complex in fission yeast Supplemental Experimental Procedures Table S Figures
More informationSupporting Information
Supporting Information Ho et al. 10.1073/pnas.0808899106 SI Materials and Methods In immunostaining, antibodies from Developmental Studies Hybridoma ank were -FasII (mouse, 1:200), - (mouse, 1:100), and
More informationIntestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan
More informationCytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
More informationSupplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationSupplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4
SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase
More informationChemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
More informationSupplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
More informationSupplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
More informationSupplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
More informationSupplementary Figure 1. Nur77 and leptin-controlled obesity. (A) (B) (C)
Supplementary Figure 1. Nur77 and leptin-controlled obesity. (A) Effect of leptin on body weight and food intake between WT and KO mice at the age of 12 weeks (n=7). Mice were i.c.v. injected with saline
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationSUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be
More informationAlpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive
More informationSupplemental Table/Figure Legends
MiR-26a is required for skeletal muscle differentiation and regeneration in mice Bijan K. Dey, Jeffrey Gagan, Zhen Yan #, Anindya Dutta Supplemental Table/Figure Legends Suppl. Table 1: Effect of overexpression
More informationPei et al. Supplementary Figure S1
Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationgacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg
Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4
More informationSupplementary Figure 1
Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with
More informationA novel mechanism of post-translational modulation of HMGA functions by the histone chaperone nucleophosmin.
A novel mechanism of post-translational modulation of HMGA functions by the histone chaperone nucleophosmin. Laura Arnoldo 1,#, Riccardo Sgarra 1,#, Eusebio Chiefari 2, Stefania Iiritano 2, Biagio Arcidiacono
More informationSupplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/353/353ra113/dc1 Supplementary Materials for Thymidine phosphorylase exerts complex effects on bone resorption and formation in myeloma Huan Liu,
More informationGeneration of ips-derived model cells for analyses of hair shaft differentiation
Supplementary Material Generation of ips-derived model cells for analyses of hair shaft differentiation Takumi Kido, Tomoatsu Horigome, Minori Uda, Naoki Adachi, Yohei Hirai Department of Biomedical Chemistry,
More informationSupplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationSox9 and NFIA Coordinate a Transcriptional Regulatory
Neuron, Volume 74 Supplemental Information Sox9 and NFIA Coordinate a Transcriptional Regulatory Cascade during the Initiation of Gliogenesis Peng Kang, Hyun Kyoung Lee, Stacey Glasgow, Meggie Finley,
More informationA RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1
A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More information- Supplementary Information -
TRIM32 dependent transcription in adult neural progenitor cells regulates neuronal differentiation. - Supplementary Information - Anna-Lena Hillje 1, 2#, Maria Angeliki S. Pavlou 1, 2#, Elisabeth Beckmann
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
More informationSupplemental Figure Legends:
Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against
More informationSupplementary Figure 1.
Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate
More informationSupplementary Figure 1. Mouse genetic models used for identification of Axin2-
Supplementary Figure 1. Mouse genetic models used for identification of Axin2- expressing cells and their derivatives. Schematic representations illustrate genetic cell labeling strategies to identify
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3164 Supplementary Figure 1 Validation of effective Gnas deletion and epithelial thickness. a, Representative genotyping in mice treated or not with tamoxifen to show Gnas deletion. To
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Effect of timing of DE dissociation and RA concentration on lung field specification in hpscs. (a) Effect of duration of endoderm induction on expression of
More informationProtocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction
More informationSupplemental Tables Supplemental Table 1. Phenotypic profile of different HSC lines. Marker d0 mhsc d7 mhsc 8B LX2 CD11b 3.61% 2.21% 2.16% 3.77% F4/80 4.54% 2.05% 0.127% 1.44% Elastin 3.90% 2.95% 4.23%
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More information