The serine protease thrombin is an essential element in the
|
|
- Maria Shields
- 6 years ago
- Views:
Transcription
1 Characterization and Functional Activity of Thrombin Receptors in the Human Lens Colin James, David J. Collison, and George Duncan PURPOSE. To investigate the expression of thrombin receptors in the human lens, the activation of downstream signaling pathways, and the ability of thrombin to regulate lens cell growth. METHODS. Thrombin receptor function in the human lens was determined first by measuring changes in intracellular calcium in response to thrombin and protease-activated receptor activating peptides (PAR-APs). In the human capsular bag model, cell growth was assessed by phase microscope inspection of the cell coverage of the posterior capsular surface. In the human lens cell line FHL124, it was assessed by [ 3 H]thymidine incorporation. Changes in p42/p44 ERK phosphorylation (p- ERK) and protein kinase B (PKB/Akt) phosphorylation (p-akt) were monitored by Western blot. Reverse transcription polymerase chain reaction (RT-PCR) applied to isolated lens epithelia and ex vivo capsular bag preparations as well as FHL124 cells determined expression of mrna for the PARs. RESULTS. Brief exposures to thrombin (10 nm) and PAR1-AP (10 M) induced an increase in cytosolic calcium in both anterior and equatorial lens cells, but activating peptides for PAR2, -3, and -4 failed to produce responses. Repeated exposure to thrombin produced a significant increase in cell coverage in the capsular bag model and increased [ 3 H]thymidine incorporation into FHL124 cells. In the latter, exposure to thrombin (10 nm) and PAR1-AP (10 M) induced biphasic increases in the phosphorylation of p42/p44 (p-erk), with peak responses at 20 minutes and 12 hours. Thrombin also produced a 20-fold increase in p-akt at 12 hours compared with the control, whereas PAR1-AP (10 M) induced a much smaller response. PAR1-AP did not induce a significant increase in [ 3 H]thymidine incorporation and PAR2-AP, PAR3-AP, and PAR4-AP failed to reproduce any of the thrombin-stimulated effects. mpar1 and -3 were expressed in native lens cells, and this expression was conserved in ex vivo capsular bag preparations as well as in FHL124 cells. CONCLUSIONS. This study identifies thrombin receptors coupled to calcium, ERK, and Akt signaling that modulate growth in native lens tissue and cultured cells, and it appears that the PAR1 subtype is mainly responsible. PAR3 mrna was also detected, but the receptor itself, if present, was not coupled to the above signaling elements. (Invest Ophthalmol Vis Sci. 2005;46: ) DOI: /iovs From the School of Biological Sciences, University of East Anglia, Norwich, United Kingdom. Supported by the Biotechnology and Biological Sciences Research Council (United Kingdom), Fight for Sight, and the Humane Research Trust. Submitted for publication May 11, 2004; revised July 29, November 8, and November 22, 2004; accepted November 23, Disclosure: C. James, None; D.J. Collison, None; G. Duncan, None The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked advertisement in accordance with 18 U.S.C solely to indicate this fact. Corresponding author: George Duncan, School of Biological Sciences, University of East Anglia, Norwich NR4 7TJ, UK; g.duncan@uea.ac.uk. The serine protease thrombin is an essential element in the blood coagulation cascade. 1 However, it is now emerging that thrombin has additional functions in inflammation, wound healing and tissue remodeling, growth factor activation, embryogenesis, and both normal and aberrant growth control. 2 6 The most probable store of thrombin is the blood in the precursor form prothrombin, and introduction of the blood contents to a site of injury greatly influences the wound healing response. 7,8 Although prothrombin activation is best understood in terms of blood coagulation, it appears that the aqueous humor has coagulation properties. It has been shown that human aqueous applied to standard ear lobe punctures shortens the bleeding time. 9 This property may reside in a novel membrane-associated, prothrombin-activating protease that has been shown to be present in cells that are separated from direct contact with blood. 10 Thrombin exerts its effect through a family of G-proteincoupled receptors, known as the protease-activated receptors (PARs), which use a novel mechanism of activation. Thrombin binds to the extracellular N terminus domain of the receptor, cleaving the peptide bond between the residues arginine-41 and serine-42. This proteolytic event reveals a new N terminus with a sequence, unique for each receptor subtype, that acts as a tethered ligand. The newly exposed sequence then binds to the body of the receptor, leading to irreversible activation. Currently, there are four known PARs (PAR1 4). PAR1, -3, and -4 are activated by thrombin, whereas PAR2 is activated by trypsin and mast cell tryptase. 11 The PARs are known to couple to several downstream signaling pathways that include inhibition of adenylyl cyclase 12,13 and activation of the mitogenactivated protein kinase (MAPK) 4 and PI3K/Akt 14 pathways. However, in most cases, the preferred coupling mechanism appears to be via phospholipase-c (PLC ), generating the second-messenger inositol trisphosphate (InsP 3 ). This in turn activates InsP 3 receptors and releases calcium (Ca 2 ) from endoplasmic reticulum (ER) stores into the cytosol. Exposure to thrombin has been shown to initiate proliferation in several cell types, for example in rat astrocytes 4 and canine tracheal smooth muscle cells. 15 Furthermore, it has been shown in a mouse model that thrombin and thrombin receptor agonists can accelerate wound healing by promoting fibroblast and epithelial cell proliferation. 8 Other studies have started to identify specific PAR receptors involved in growth responses. A functional PAR1 exists in colonic cells and, when activated by thrombin, enhances proliferation and motility. 5 PAR4 has been reported to contribute to microglial proliferation, and inhibition of PAR4 could be a therapeutic target to prevent neuronal trauma. 16 Recently, Lang et al. 17 have shown that exposure of human corneal epithelial cells to thrombin induces secretion of the proinflammatory cytokines interleukin (IL)-6, IL-8, and TNF through activation of PAR1 and -2 receptors. In the porcine lens, thrombin has been found to inhibit sodium-potassium (Na,K ) transport 18 and, in an earlier study, thrombin was found to stimulate cell division in the cultured rabbit lens. 19 Also, in a human lens cell line, thrombin appears to initiate actin reorganization and increase sites of focal adhesion. 20 These studies confirm that lens cells are responsive to thrombin, but do not identify either the PAR Investigative Ophthalmology & Visual Science, March 2005, Vol. 46, No. 3 Copyright Association for Research in Vision and Ophthalmology 925
2 926 James et al. IOVS, March 2005, Vol. 46, No. 3 subtypes involved or the signaling pathways that mediate the responses. Levels of blood proteins in the aqueous humor of the eye are normally low, and passage of proteins across the blood aqueous barrier are likely to be minimal. In a diseased state, however, aqueous humor protein levels can be elevated due to disruption or weakening of the blood aqueous barrier. 21 Furthermore, the presence of thrombin has been identified in samples of subretinal fluid removed from patients with perforated retinal detachment. 22 During cataract surgery, the blood aqueous barrier can be breached, and this can introduce blood proteins, including (pro)thrombin, into the ocular environment. Thrombin entry into the interior of the eye via the iris is believed to play a critical role in lens regeneration. 23 The current work was undertaken to investigate the expression of thrombin receptors in human lens cells, the activation of downstream signaling pathways, and the ability of thrombin to regulate lens cell proliferation. Functional thrombin receptors were identified in the intact human lens, and activation of these receptors resulted in an increase in intracellular calcium ([Ca 2 ] i ) and an increase in cell growth across the posterior capsule. An upregulation of phosphorylated ERK and Akt proteins and an increase in lens cell proliferation were also observed in FHL124 cells. Furthermore, the data provide evidence that mrna for PAR1 and -3 was expressed in native lens cells, and this expression was conserved in ex vivo capsular bag preparations, as well as in the human lens cell line. METHODS Thrombin, PAR1 (TFLLRN) and -2 (SLIGRL) activating peptides were obtained from Tocris Cookson, Ltd. (Avonmouth, UK). PAR3 (TFRGAP) and -4 (AYPGKF) activating peptides were obtained from CN Biosciences, Ltd. (Nottingham, UK). Unless otherwise indicated, all other chemicals were supplied by Sigma-Aldrich, Ltd. (Poole, UK). After removal of corneoscleral discs for transplant purposes, human donor eyes were obtained from the East Anglian or Bristol Eye Banks. In this study donors were aged between 18 and 86 years. The use of human tissue was in accordance with the provisions of the Declaration of Helsinki. Native Human Lens Preparations For whole-lens studies, the lens was removed from the globe by dissecting it from the surrounding tissue and was placed anterior surface down on a plastic Ca 2 -imaging chamber (described by Collison and Duncan 24 ). It was then perifused at 35 C, the optimum temperature for the lens, 25,26 with artificial aqueous humor (AAH) of the following composition (in mm): KCl, 5; NaHCO 3, 5; glucose, 5; HEPES, 20; NaCl, 130; MgCl 2, 0.5; and CaCl 2, 1. The ph was adjusted to 7.25 by the addition of 4 M NaOH. In some cases, isolated anterior epithelial preparations were generated. The lens capsule, with its adherent epithelium was dissected from the fiber mass as described by Collison et al. 27 and pinned to the base of the Ca 2 -imaging chamber. The capsular bag model has been described in detail elsewhere. 28 Briefly, a sham cataract operation was performed, and the resultant capsular bag was dissected from the zonules and secured on a sterile 35-mm polymethylmethacrylate Petri dish. Entomology pins (D1; Watkins and Doncaster, Ltd., Kent, UK) were inserted through the edge of the capsule to retain its circular shape. Experiments were performed on matched pairs of capsular bags that were maintained in Eagle s modified essential medium (EMEM) or EMEM supplemented with 10 nm thrombin. The media were replaced every 48 hours, and ongoing observations of cell coverage across the posterior capsule were performed by phase contrast microscopy (TE-200 Eclipse microscope fitted with a Coolpix 950 digital camera and MDC lens; Nikon Industries, Tokyo, Japan). Examples of cell coverage maps generated in this way are given in Liu et al. 28 For ex vivo specimens, donor eyes contained capsular bags containing intraocular lenses (IOLs) that had been generated by cataract surgery. The capsular bag was dissected from the zonules and snap frozen before RNA extraction. All specimens showed signs of cell growth and of posterior capsule opacification (PCO). 29 Cell Line FHL124 cells (see Wormstone et al. 30 for details) were suspended in EMEM supplemented with 5% fetal calf serum (FCS) and gentamicin (50 g/ml), and 10 4 cells (in 400 L EMEM) were seeded onto the center of round, glass coverslips (diameter 16 mm, No. 0; BDH, Poole, UK). The coverslips were placed in 35-mm Petri-dishes and incubated for 4 hours at 35 C in a 5% CO 2 atmosphere to allow the cells to adhere before adding 1 ml of the same medium. After the cells were cultured for 48 hours, the medium was exchanged for serum-free EMEM for a further 24 hours of culture at 35 C in 5% CO 2. The glass coverslip eventually formed the base of a modified Ca 2 -imaging chamber. Measurement of [Ca 2 ] i The technique for measuring [Ca 2 ] i has been described in detail. 24 All cell and tissue preparations were loaded with 3 M Fura-2 AM (the acetoxymethylester form) for 40 minutes at room temperature. The preparations were then washed in AAH for 20 minutes to allow complete de-esterification of the dye and to remove any extraneous dye before measuring [Ca 2 ] i levels. An epifluorescence microscope (Eclipse TE-200; Nikon) fitted with a 20 objective was used for real-time ratiometric imaging of [Ca 2 ] i. Cultured cells were large enough to be imaged individually, but native cells were imaged as regions of interest containing approximately 15 to 20 cells. Lens preparations were bathed in warmed (35 C) AAH in which the various agonists were dissolved when required. Cells were alternately excited at 340- and 380-nm wavelengths, with the resultant fluorescent emissions collected at 510 nm. For technical reasons (see Ref. 24 ) the Ca 2 data are presented in ratio, rather than calibrated, form. Reverse Transcription Polymerase Chain Reaction FHL124 cells were grown on 35-mm tissue culture dishes to 85% to 90% confluence in EMEM supplemented with 5% FCS and gentamicin (50 g/ml) and then cultured in serum-free EMEM for 24 hours. Human lens epithelial cell RNA was collected (RNeasy Mini Kit; Qiagen Ltd., Crawley, UK). RNA (1 g) was reverse transcribed in a 20- L reaction mixture (Superscript II RT; Invitrogen Ltd., Paisley, UK). A 0.2- L portion of the cdna was amplified by PCR in a 100- L reaction buffer in the following conditions: 0.2 M each primer (Invitrogen Ltd., Paisley, UK), 0.2 mm deoxy-nucleoside trisphosphate mixture (Bioline Ltd., London, UK), 10 mm Tris-HCl, 1.5 mm MgCl 2,50mM KCl, and 2.5 U Taq DNA polymerase (Roche, Lewes, UK). The PCR was performed by using the following program with a thermal controller (MJ Research Inc., Reno, NV): initial denaturation 94 C for 4 minutes, denaturation at 94 C for 1 minute, annealing at 55 C for 1 minute, and extension at 72 C for 1 minute. Steps 2 through 4 were cycled 30 times for PAR1, -2, and -4; 33 times for PAR3; and 27 times for GAPDH, with a final extension at 72 C for 10 minutes. The oligonucleotide primer (5 3 ) sequences specific for PAR types 1 to 4 31 and GAPDH 30 are listed in Table 1. PCR products, together with DNA base pair markers (Invitrogen-Life Technologies, Gaithersburg, MD), were run on a 0.8% agarose gel, and images were captured and analyzed (1D, ver. 3.5 software; Kodak Scientific Imaging Systems, Rochester, NY). Western Blot Detection of Phosphorylated ERK and Akt Proteins Cells were grown on 35-mm tissue culture dishes to 85% to 90% confluence in EMEM supplemented with 5% FCS and gentamicin (50 g/ml), incubated in serum-free EMEM for 24 hours, and treated with EMEM supplemented with thrombin (10 nm), activating peptides for
3 IOVS, March 2005, Vol. 46, No. 3 Thrombin Receptors in the Human Lens 927 TABLE 1. Gene-Specific Primer Sequences Used in RT-PCR Amplification Gene Primer Sequence* (5 3 ) PCR Product Size (bp) PAR1 Sense 2422 TGTGAACTGATCATGTTTATG Antisense 3129 TTCGTAAGATAAGAGATATGT 3109 PAR2 Sense 44 GCAGGTGAGAGGCTGACTTT Antisense 377 CAGTCGGTTCCGTCTAACCGG 356 PAR3 Sense 147 GAAAGCCCTCATCTTTGCAG Antisense 745 AGGTGAAAGGATGGACGATG 726 PAR4 Sense 1121 GGCAACCTCTATGGTGCCTA Antisense 1364 TTCGACCCAGTACAGCCTTC 1345 GAPDH Sense ACCACAGTCCATGCCATCAC Antisense TCCACCACCCTGTTGCTGTA * Numbers refer to base positions on the known human gene sequence. 31 PAR types 1 to 4 (10 M) or serum-free EMEM alone for 20 minutes. Cells were then lysed on ice in buffer (50 mm HEPES [ph 7.5], 150 mm NaCl, 1% Triton X-100, 1 mm EDTA, 10% glycerol, 10 mm sodium pyrophosphate, 2 mm sodium orthovanadate, 10 mm sodium fluoride, 1 mm phenylmethylsulfonyl fluoride and 10 g/ml aprotinin). 32 Lysates were precleared by centrifuging at 13,000 rpm at 4 C for 10 minutes and the protein content assayed by the bicinchoninic acid (BCA) assay (Perbio Science Ltd, Chester, UK) so that equal amounts of protein per sample were loaded into 10% SDS-PAGE gels for electrophoresis and transferred onto nitrocellulose membrane with a transfer cell (Trans-Blot Semidry Transfer Cell; Bio-Rad, Hercules, CA). Proteins were detected with a blot analysis system (ECL; Amersham Pharmacia Biotech, Little Chalfont, UK) with total and phosphorylated MAPK (ERK 1/2) antibodies (Upstate Biotechnology, La Jolla, CA). The corresponding antibodies for Akt were obtained from Cell Signaling Technology (Beverly, MA). Growth Assays for FHL124 Cells The Cell division rate was monitored by [ 3 H]thymidine incorporation. A 1-mL portion of a cell/ml suspension in 5% FCS-EMEM was added to each well of a 24-well tissue culture plate (BD Labware, Bedford, MA) and cultured for 24 hours. The medium was then removed and replaced with serum-free EMEM and cultured for a further 48 hours. After replenishing this medium, the cells were placed in experimental conditions for a further 24 hours. During the final 4 hours of the culture period the cells were exposed to final concentrations of 1 Ci/mL [ 3 H]thymidine (Amersham International, Amersham, UK), with 1 M cold thymidine. Each well was then washed twice with 1 ml EMEM to remove residual radioactive [ 3 H]thymidine. One milliliter of 5% trichloroacetic acid (TCA) was added to each well. After 30 minutes at room temperature, the TCA was removed and 1 ml 250 mm sodium hydroxide (NaOH) was added to each well and left overnight at 4 C, before 0.5 ml of this NaOH was sampled. Scintillation fluid (10 ml; HiSafe Supermix; PerkinElmer, Wellesley, MA) was added to each sample and appropriate controls. Measurements were obtained using a scintillation counter (EG&G Wallac, Cambridge, UK). Data Analysis Unless otherwise specified, in all cases n 4; data are expressed as the mean SEM. Statistical analyses of the results were evaluated by ANOVA with the Dunnett test, with the exception of determination of capsular bag cell coverage, for which the t-test was used. P 0.05 was considered to be statistically significant. RESULTS Figure 1A shows that thrombin (10 nm) induced a significant increase in cytosolic Ca 2 in anterior lens epithelial cells of the intact lens. The response was clearly biphasic, with a characteristic initial increase in [Ca 2 ] i, followed by a smaller second phase. A second, similar response to 10 nm thrombin was obtainable, but only after the lens had been perifused for at least 45 minutes in control medium alone. Identical responses to thrombin were also observed in the isolated lens epithelium (data not shown). Similarly, in the equatorial region of the intact lens, the Ca 2 response was biphasic but with a more prolonged second phase (Fig. 1B) and again approximately 45 minutes had to elapse before a second response of similar magnitude was obtained. It is interesting that thrombin produced large Ca 2 responses in both anterior and equatorial cells, because acetylcholine (ACh), for example, produces a response only in anterior epithelial cells. 24 It appears that thrombin signals through the ER store, as the specific ER Ca 2 -ATPase inhibitor thapsigargin totally abolished the response to thrombin (Fig. 1C, Tg). Application of 10 M lanthanum chloride 33 (LaCl 3 ), a Ca 2 -channel blocker, returned [Ca 2 ] i to basal levels, indicating that the sustained thapsigargin response was due to Ca 2 influx through store-operated channels and was not simply a toxic effect. To identify further whether the second phase produced by thrombin was the result of Ca 2 influx, we applied thrombin (10 nm) to isolated lens epithelia in the presence of Ca 2 -free medium (Fig. 1D). Thrombin produced a transient increase in [Ca 2 ] i, which rapidly returned to unstimulated levels, and there was no evidence of a second phase in the response (cf. Figs. 1A, 1B). Return to control medium containing 1 mm CaCl 2 produced a significant increase in internal Ca 2, which returned to basal levels when Ca 2 -free medium was reapplied (Fig. 1D). In control medium and in the absence of thrombin, there was no large change in internal Ca 2, either on switching from control to Ca 2 -free medium (Fig. 1D) or on readmission of Ca 2 to the medium (our unpublished data, 2003). To determine which PAR receptor subtype(s) were responsible for initiating the Ca 2 -signaling events, the lens was exposed to specific activating peptides (PAR-APs) for each receptor subtype. Activating peptides for PAR2, -3, and -4 failed to induce any change in Ca 2 levels either in the anterior or equatorial regions of the lens, whereas PAR1-AP induced a Ca 2 response in both regions (Fig. 2). Note that the PAR1 responses in both regions are larger and have a more rapid time course than the corresponding thrombin-induced responses. FHL124 cells loaded with Fura2 responded to thrombin and PAR1, but not PAR2, -3, and -4, in a manner similar to that described for native cells (our unpublished data, 2003). Native lens epithelia possessed mrna for PAR1 and -3 as assessed by bands at the appropriate molecular size (Fig. 3A). However, mrna for PAR2 and -4 was not detected. This expression profile was conserved in capsular bags removed from donor eyes that had undergone cataract surgery (Fig. 3B) and the human lens cell line FHL124 (Fig. 3C).
4 928 James et al. IOVS, March 2005, Vol. 46, No. 3 FIGURE 1. Increase in [Ca 2 ] i in human lens cells on exposure to thrombin. (A) Anterior epithelial cells in the intact human lens: A 2-minute exposure to 10 nm thrombin induced an increase in fluorescence ratio, indicating a transient increase in [Ca 2 ] i. The larger initial increase was followed by a smaller second phase. Subsequent exposure to thrombin elicited a similar Ca 2 response only after 45 minutes of perifusion with bathing medium alone, as indicated by the space between responses. (B) Equatorial cells in the intact human lens: The responses and the recovery time between them were similar to responses in (A), except that the second phase was more pronounced. (C) Anterior epithelial cells in the intact lens: exposure to Ca 2 -ATPase inhibitor thapsigargin (1 M; Tg) produced a characteristic increase in internal Ca 2 and abolished any subsequent response to thrombin. LaCl 3 restored cytosolic Ca 2 to the resting level by abolishing the capacitative entry pathway. 33 (D) Anterior epithelial cells in the isolated epithelium: Thrombin induced a transient increase in [Ca 2 ] i when the lens epithelium was bathed in Ca 2 -free medium. When Ca 2 was reintroduced in control medium, a pronounced influx was observed that was reduced when the medium was returned to Ca 2 -free. Note that the data are presented in ratio form, as it was not possible to obtain fully calibrated values for the equatorial cells. 24 For the anterior cell response illustrated in (A) a full calibration was performed, and the internal Ca 2 increased from a starting level of 100 nm to a maximum of 255 nm. Cell coverage on the central posterior capsule was observed in both EMEM controls and in capsular bags cultured in medium supplemented with thrombin (10 nm). In both cases the cells continued to grow across the previously cell-free posterior capsule in a progressive manner, but the rate of coverage in thrombin-treated preparations was significantly faster than the rate in the control serum-free EMEM (Fig. 4). Native donor eye tissue is in limited supply, and therefore FHL124 cells were used for more detailed studies. The presence of mrna for PAR1 and -3 indicated that the FHL124 cell line is a good model for such studies. Addition of thrombin (10 nm) and PAR1-AP (10 M) induced an increase in phosphorylation of p42/p44 ERK (p-erk) proteins in FHL124 cells. Activating peptides for PAR2, -3, and -4 failed to stimulate p-erk (Figs. 5A, 5B). Significantly, both thrombin and PAR1-AP induced multiphasic responses in p-erk. p-erk levels began to increase significantly within 5 minutes, reached a plateau at 10 to 30 minutes, then returned to near baseline levels by 60 minutes (Figs. 5B, 5C). When the exposure time was increased, both thrombin and PAR1-AP induced further significant increases in p-erk after 8 hours (Fig. 5C). Because both agonists ultimately induced significant increases in p-erk, we expected both to stimulate growth of FHL124 cells in a similar manner. However, when [ 3 H]thymidine incorporation into DNA was assayed (Fig. 6), incorporation was significantly increased only in cells cultured in EMEM supplemented with thrombin (10 nm). Supplementing the medium with PAR1-AP failed to induce a statistically significant
5 IOVS, March 2005, Vol. 46, No. 3 Thrombin Receptors in the Human Lens 929 FIGURE 3. RT-PCR data for PAR1 (708 bp), PAR2 (334 bp), PAR3 (599 bp), and PAR4 (244 bp). (A) Isolated lens epithelium; (B) ex vivo capsular bag; and (C) FHL124 cells. For PAR1 and -3, but not for PAR2 and -4, products of the appropriate size were detected in all samples. M, DNA marker; G, GAPDH. FIGURE 2. Effect of PAR-APs on the calcium response of the intact human lens. (A) In anterior epithelial cells, PAR1-AP (10 M) induced a repeatable, transient increase in Ca 2, whereas PAR2-, PAR3-, and PAR4-AP (10 M) failed to evoke a response. (B) Similar responses were produced in cells in the equatorial region. Note that ACh and ATP were used to give standard G-protein responses in the anterior and equatorial cells, respectively. 24 lens epithelium and the human lens cell line FHL124 exhibit the same receptor pattern, as some other G-protein receptors (e.g., muscarinic) have been found to change in culture from their native lens counterparts. 27 Analysis of signaling pathways showed that thrombin actively stimulated Ca 2 release and phosphorylation of ERK and Akt. Furthermore, application of specific peptide agonists to the PARs demonstrated active signal transduction only with PAR1-AP. These data, therefore, suggest that PAR1 is the only thrombin receptor subtype coupled to calcium signaling in human lens cells. The expression of PAR3 is unusual without joint expression of PAR4 as, at present, the only known role of PAR3 is as a cofactor for PAR4 activation. 38 The role for PAR3, however, remains as poorly defined in the lens as it is in other tissues. 39 There is a possibility that PAR3 mrna is not translated into protein or, alternatively, that it mediates its effects via other signaling mechanisms not investigated in the present study. In contrast, PAR1 is clearly present and is activated by thrombin. increase in incorporation under these conditions. Furthermore, cells cultured in the presence of activating peptides for PAR2, -3, and -4 also showed no significant increase over the control (James C, Duncan G, unpublished data, 2004). There is some evidence from other cell systems to indicate that both p-erk and p-akt stimulation are required for thrombin-stimulated proliferation. 34,35 The data in Figure 7 show that thrombin induced a 20-fold increase in p-akt relative to control at 12 hours, whereas the increase produced by exposure to PAR1-AP, though still significant, was much lower. DISCUSSION Thrombin receptors have been identified in a variety of cell and tissue types. However, the expression pattern in the lens is unknown. The present study was therefore undertaken and showed that message for PAR1 and -3, but not for PAR2 and -4, was expressed in isolated lens epithelia, capsular bags removed from donors who had undergone cataract surgery and the human lens cell line FHL124. The expression profiles in other cell types reveal that several receptor subtype combinations exist. PAR1 and -4 are expressed in human astrocytoma cells, 36 for example, whereas PAR1 and -2 are found in stromal fibroblasts. 37 An important finding in this study is that the native FIGURE 4. Effect of thrombin on cell coverage of the posterior capsule in cultured lens capsular bags. Repeated exposure to thrombin (10 nm in serum-free EMEM, replaced every 48 hours for 12 days) significantly increased cell coverage compared with that of capsular bags cultured in serum-free EMEM alone (control). Note that 100% represents total cell coverage. The data were derived from four match-paired capsular bags, and each point represents the mean SEM.
6 930 James et al. IOVS, March 2005, Vol. 46, No. 3 FIGURE 6. Effect of thrombin and PAR1-AP on thymidine incorporation in FHL124 cells. Cells cultured for 24 hours in EMEM supplemented with thrombin (10 nm) had a significantly increased level of [ 3 H]thymidine (33%, P 0.05) compared with cells cultured in EMEM alone, whereas the apparent slight increase observed with PAR1-AP (10 M) supplementation ( 10%) was not statistically significant. Data were analyzed by ANOVA with the Dunnett test; n 4. FIGURE 5. Immunoblot analysis of p-erk response to thrombin and PAR-APs in FHL124 cells. (A) Representative Western blots for p42/p44 total and phosphorylated ERK protein after exposure to thrombin (10 nm) and PAR1 to -4-AP (10 M) for 20 minutes. (B) Time course of the early phase of upregulation of p-erk proteins in response to thrombin and PAR1 to -4-AP. Only thrombin and PAR1-AP gave responses that were significantly different from the control (**P 0.05; ANOVA with the Dunnett test; n 4). (C) Late phase of p-erk stimulation in response to thrombin and PAR1-AP exposure. The early phase of the response declined to a minimum within 2 hours and then increased again to give a more sustained stimulation. **Significant difference from the control, as in (B). In the anterior region of the lens, thrombin induced an initial increase in [Ca 2 ] i, followed by a short second phase, whereas in equatorial cells the initial increase was followed by a more prolonged second phase. These biphasic profiles are characteristic of Ca 2 signaling in several cell types. 40 The prolonged raised level elicited from equatorial cells was similar to the response obtained from growth-factor tyrosine kinase receptor mediated Ca 2 influx. 24,41 In contrast, PAR1-AP elicited a larger but more transient increase in Ca 2, and these kinetics are more characteristic of other G-protein-coupled receptor agonists (e.g., ACh and adenosine triphosphate [ATP]). The second phase of the thrombin response was identified as an influx from the extracellular medium, as it was abolished by removing external Ca 2. Covic et al. 42 proposed that in platelets, the majority of the overall Ca 2 response to thrombin was due to influx through plasma membrane Ca 2 channels, which may also be true for cells of the equatorial region. In the porcine lens, thrombin has been shown to stimulate the release of endothelin 1 (ET-1) 43 which in turn inhibits Na,K,ATPase activity through the release of Ca 2 from internal stores. 44 However, ET-1 (100 nm) and ET-2 (10 M) were applied to the whole human lens, and no change in [Ca 2 ] i was detected (our unpublished data, 2003). Differences in cell type, species, or thrombin receptor subtype expression may account for these conflicting results. Thrombin receptor activation has been implicated in growth promotion (for a review, see MacFarlane et al. 3 ), and has been largely associated with inflammation, 11 the repair of injured tissues, 45 and neovascularization. 46 Growth results obtained during the present study both with capsular bag cultures and FHL124 cells are in agreement with previous studies that have reported the induction of mitosis and proliferation by thrombin. 4,15,19 Both thrombin and PAR1-AP stimulated p-erk production in FHL124 cells, results similar to those obtained by Molloy et al., 47 who found that in normally quiescent rat aortic smooth muscle cells, both thrombin and PAR1-AP induce pronounced increases in tyrosine phosphorylation of MAPK proteins. However, PAR1-AP did not appear to induce an increase in thymidine incorporation in lens cells, although an increase has been observed in rat smooth muscle cells. It is interesting that the kinetics of calcium increase induced by thrombin in human lens cells are different from those induced by PAR1-AP. The influx phase of the Ca 2 response is more pronounced in the presence of thrombin compared with PAR1, and this is especially significant in view of the fact that it has recently been shown that capacitative Ca 2 entry (CCE) mediates the mitogenic response to EGF. 48 It is interesting that, in the FIGURE 7. Immunoblot analysis of the time-course of the p-akt response to thrombin (10 nm) and PAR1-AP (10 M) in FHL124 cells. The very large increase induced by thrombin was apparent after 12 hours of culture and was present for at least another 12 hours. **Significant difference from the corresponding control level (P 0.05; ANOVA with the Dunnett test, n 4).
7 IOVS, March 2005, Vol. 46, No. 3 Thrombin Receptors in the Human Lens 931 present study, the major downstream signaling differences between PAR1-AP and thrombin do not lie at the level of p-erk stimulation, but rather at the level of p-akt induction, which occurs at a later stage. Akt signaling has recently been a focus of attention in lens research, largely in terms of stimulating cell survival rather than cell growth. 49,50 However, there is evidence from other cell systems that sustained Akt phosphorylation is required for G1 phase progression when cell division is activated by thrombin. 14 It appears in lens cells that although PAR1-AP did indeed stimulate p-erk and p-akt, the level attained in the latter was insufficient to drive detectable growth. There are other systems in which the effects produced on exposure to thrombin and PAR1-AP are not identical. For example, in human brain microvascular endothelial cells, whereas both stimulated calcium release, only thrombin decreased transendothelial resistance. 51 The cleaved peptide from PAR1 is a more potent stimulant of platelet-endothelial adhesion than is thrombin. 52 Hence, although the activating peptides are useful in elucidating which thrombin receptor subtypes are functionally active, there is now a considerable body of data (the present study included) to indicate that their application has only a limited use in unraveling the intricacies of the downstream signaling events. In summary, the current study shows that lens epithelial cells express mrnas for PAR1 and -3, and these are conserved in FHL124 cells and in the capsular bag in vivo. Of the two receptors expressed, only PAR1 appears to be functionally active in terms of Ca 2 signaling and downstream phosphorylation events. These data raise the possibility that thrombin has a role in wound healing after cataract surgery, and disruption of this signaling system may provide a means of reducing PCO. Acknowledgments The authors thank John Reddan (Eye Research Institute, Oakland University, Rochester, MI) for providing the FHL124 cells, and I. Michael Wormstone, Lixin Wang, Julie Eldred, and Diane Alden for help and technical assistance. References 1. Goldsack NR, Chambers RC, Dabbagh K, Laurent GJ. Molecules in focus: thrombin. Int J Biochem Cell Biol. 1998;30: Kataoka H, Hamilton JR, McKemy DD, et al. Protease-activated receptors 1 and 4 mediate thrombin signaling in endothelial cells. Blood. 2003;102: Macfarlane SR, Seatter MJ, Kanke T, Hunter GD, Plevin R. Proteinase-activated receptors. Pharmacol Rev. 2001;53: Wang H, Ubl JJ, Stricker R, Reiser G. Thrombin (PAR-1)-induced proliferation in astrocytes via MAPK involves multiple signalling pathways. Am J Physiol. 2002;283:C1351 C Darmoul D, Gratio V, Devaud H, Lehy T, Laburthe M. Aberrant expression and activation of the thrombin receptor protease-activated receptor-1 induces cell proliferation and motility in human colon cancer cells. Am J Pathol. 2003;162: Tellez C, Bar-Eli M. Role and regulation of the thrombin receptor (PAR-1) in human melanoma. Oncogene. 2003;22: Huang Y, Yang Z, Carney D. Effects of thrombin peptides on wound healing and proliferation and migration of normal human epidermal keratinocyte (NHEK). Zhonghua Shao Shang Za Zhi. 2000;16: Strukova SM. Thrombin as a regulator of inflammation and reparative processes in tissues. Biochemistry (Mosc). 2001;66: Khodadoust AA, Stark WJ, Bell WR. Coagulation properties of intraocular humors and cerebrospinal fluid. Invest Ophthalmol Vis Sci. 1983;24: Sekiya F, Usui H, Inoue K, Fukudome K, Morita T. Activation of prothrombin by a novel membrane-associated protease: an alternative pathway for thrombin generation independent of the coagulation cascade. J Biol Chem. 1994;269: Cocks TM, Moffatt JD. Protease-activated receptors: sentries for inflammation? Trends Pharmacol Sci. 2000;21: Brass LF, Manning DR, Williams AG, Woolkalis MJ, Poncz M. Receptor and G protein-mediated responses to thrombin in HEL cells. J Biol Chem. 1991;266: Hung DT, Vu TH, Nelken NA, Coughlin SR. Thrombin-induced events in non-platelet cells are mediated by the unique proteolytic mechanism established for the cloned platelet thrombin receptor. J Cell Biol. 1992;116: Goel R, Phillips-Mason PJ, Raben DM, Baldassare JJ. Alpha-thrombin induces rapid and sustained Akt phosphorylation by betaarrestin1-dependent and -independent mechanisms, and only the sustained Akt phosphorylation is essential for G1 phase progression. J Biol Chem. 2002;277: Lin CC, Shyr MH, Chien CS, et al. Thrombin-stimulated cell proliferation mediated through activation of Ras/Raf/MEK/MAPK pathway in canine cultured tracheal smooth muscle cells. Cell Signal. 2002;14: Suo Z, Wu M, Ameenuddin S, et al. Participation of proteaseactivated receptor-1 in thrombin-induced microglial activation. J Neurochem. 2002;80: Lang R, Song PI, Legat FJ, et al. Human corneal epithelial cells express functional PAR-1 and PAR-2. Invest Ophthalmol Vis Sci. 2003;44: Okafor MC, Dean WL, Delamere NA. Thrombin inhibits active sodium-potassium transport in porcine lens. Invest Ophthalmol Vis Sci. 1999;40: Reddan JR, Dziedzic DC, McGee SJ. Thrombin induces cell division in rabbit lenses cultured in a completely defined serum-free medium. Invest Ophthalmol Vis Sci. 1982;22: Maddala R, Reddy VN, Epstein DL, Rao V. Growth factor induced activation of Rho and Rac GTPases and actin cytoskeletal reorganization in human lens epithelial cells. Mol Vis. 2003;9: Yoshida A, Elner SG, Bian ZM, Kunkel SL, Lukacs NW, Elner VM. Thrombin regulates chemokine induction during human retinal pigment epithelial cell/monocyte interaction. Am J Pathol. 2001; 159: Malukiewicz-Wisniewska G, Kotschy M. Thrombin-antithrombin III complexes in plasma and subretinal fluid in patients with perforated retinal detachment. Klin Oczna. 2000;102: Imokawa Y, Brockes JP. Selective activation of thrombin is a critical determinant for vertebrate lens regeneration. Curr Biol. 2003;13: Collison DJ, Duncan G. Regional differences in functional receptor distribution and calcium mobilization in the intact human lens. Invest Ophthalmol Vis Sci. 2001;42: Duncan G, Juett JR, Croghan PC. A simple chamber for measuring lens asymmetry potentials. Exp Eye Res. 1977;25: Young, R. Age-Related Cataract. New York: Oxford University Press; Collison DJ, Coleman RA, James RS, Carey J, Duncan G. Characterization of muscarinic receptors in human lens cells by pharmacologic and molecular techniques. Invest Ophthalmol Vis Sci. 2000;41: Liu CS, Wormstone IM, Duncan G, Marcantonio JM, Webb SF, Davies PD. A study of human lens cell growth in vitro: a model for posterior capsule opacification. Invest Ophthalmol Vis Sci. 1996; 37: Marcantonio JM, Rakic JM, Vrensen GF, Duncan G. Lens cell populations studied in human donor capsular bags with implanted intraocular lenses. Invest Ophthalmol Vis Sci. 2000;41: Wormstone IM, Tamiya S, Eldred JA, et al. Characterisation of TGF-beta2 signalling and function in a human lens cell line. Exp Eye Res. 2004;78: Hamilton JR, Frauman AG, Cocks TM. Increased expression of protease-activated receptor-2 (PAR2) and PAR4 in human coronary artery by inflammatory stimuli unveils endothelium-dependent relaxations to PAR2 and PAR4 agonists. Circ Res. 2001;89:92 98.
8 932 James et al. IOVS, March 2005, Vol. 46, No Daub H, Wallasch C, Lankenau A, Herrlich A, Ullrich A. Signal characteristics of G protein-transactivated EGF receptor. EMBO J. 1997;16: Williams MR, Riach RA, Collison DJ, Duncan G. Role of the endoplasmic reticulum in shaping calcium dynamics in human lens cells. Invest Ophthalmol Vis Sci. 2001;42: Phillips-Mason PJ, Raben DM, Baldassare JJ. Phosphatidylinositol 3-kinase activity regulates alpha-thrombin-stimulated G1 progression by its effect on cyclin D1 expression and cyclin-dependent kinase 4 activity. J Biol Chem. 2000;275: Reusch HP, Zimmermann S, Schaeffer M, Paul M, Moelling K. Regulation of Raf by Akt controls growth and differentiation in vascular smooth muscle cells. J Biol Chem. 2001;276: Kaufmann R, Patt S, Zieger M, Kraft R, Tausch S, Henklein P. The two-receptor system PAR-1/PAR-4 mediates alpha-thrombin-induced [Ca(2 )](i) mobilization in human astrocytoma cells. J Cancer Res Clin Oncol. 2000;126: D Andrea MR, Derian CK, Leturcq D, et al. Characterization of protease-activated receptor-2 immunoreactivity in normal human tissues. J Histochem Cytochem. 1998;46: Nakanishi-Matsui M, Zheng YW, Sulciner DJ, Weiss EJ, Ludeman MJ, Coughlin SR. PAR3 is a cofactor for PAR4 activation by thrombin. Nature. 2000;404: Schmidt VA, Nierman WC, Maglott DR, et al. The human proteinase-activated receptor-3 (PAR-3) gene: identification within a Par gene cluster and characterization in vascular endothelial cells and platelets. J Biol Chem. 1998;273: Berridge MJ, Bootman MD, Roderick HL. Calcium signalling: dynamics, homeostasis and remodelling. Nat Rev Mol Cell Biol. 2003;4: Birnbaumer L, Zhu X, Jiang M, et al. On the molecular basis and regulation of cellular capacitative calcium entry: roles for Trp proteins. Proc Natl Acad Sci USA. 1996;93: Covic L, Gresser AL, Kuliopulos A. Biphasic kinetics of activation and signaling for PAR1 and PAR4 thrombin receptors in platelets. Biochemistry. 2000;39: Okafor MC, Delamere NA. The inhibitory influence of endothelin on active sodium-potassium transport in porcine lens. Invest Ophthalmol Vis Sci. 2001;42: Okafor MC, Mukhopadhyay P, Delamere NA. Studies on endothelin release and Na,K transport in porcine lens. Invest Ophthalmol Vis Sci. 2002;43: Cirino G, Napoli C, Bucci M, Cicala C. Inflammation-coagulation network: are serine protease receptors the knot? Trends Pharmacol Sci. 2000;21: Carney DH, Mann R, Redin WR, et al. Enhancement of incisional wound healing and neovascularization in normal rats by thrombin and synthetic thrombin receptor-activating peptides. J Clin Invest. 1992;89: Molloy CJ, Pawlowski JE, Taylor DS, Turner CE, Weber H, Peluso M. Thrombin receptor activation elicits rapid protein tyrosine phosphorylation and stimulation of the raf-1/map kinase pathway preceding delayed mitogenesis in cultured rat aortic smooth muscle cells: evidence for an obligate autocrine mechanism promoting cell proliferation induced by G-protein-coupled receptor agonist. J Clin Invest. 1996;97: Yang H, Sun X, Wang Z, et al. EGF stimulates growth by enhancing capacitative calcium entry in corneal epithelial cells. J Membr Biol. 2003;194: Chandrasekher G, Sailaja D. Phosphatidylinositol 3-kinase (PI-3K)/ Akt but not PI-3K/p70 S6 kinase signaling mediates IGF-1-promoted lens epithelial cell survival. Invest Ophthalmol Vis Sci. 2004;45: Liu JP, Schlosser R, Ma WV, et al. Human alphaa- and alphabcrystallins prevent UVA-induced apoptosis through regulation of PKCalpha, RAF/MEK/ERK and AKT signaling pathways. Exp Eye Res. 2004;79: Kim YV, Di Cello F, Hillaire CS, Kim KS. Differential Ca2 signaling by thrombin and protease-activated receptor-1-activating peptide in human brain microvascular endothelial cells. Am J Physiol. 2004;286:C31 C Claytor RB, Michelson AD, Li JM, et al. The cleaved peptide of PAR1 is a more potent stimulant of platelet-endothelial cell adhesion than is thrombin. J Vasc Surg. 2003;37:
Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells
Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.
More informationGα 13 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product
More informationCdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
More informationThe Wnt-5a-derived hexapeptide Foxy-5 inhibits breast cancer. metastasis in vivo by targeting cell motility
SUPPLEMENTARY MATERIAL: The Wnt-5a-derived hexapeptide Foxy-5 inhibits breast cancer metastasis in vivo by targeting cell motility Annette Säfholm, Johanna Tuomela, Jeanette Rosenkvist, Janna Dejmek, Pirkko
More informationCell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD
Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented
More informationSystem. Dynamic Monitoring of Receptor Tyrosine Kinase Activation in Living Cells. Application Note No. 4 / March
System Application Note No. 4 / March 2008 Dynamic Monitoring of Receptor Tyrosine Kinase Activation in Living Cells www.roche-applied-science.com Dynamic Monitoring of Receptor Tyrosine Kinase Activation
More informationSupplementary material and methods
Inhibitory effect of caffeic acid on ADP-induced thrombus formation and platelet activation involves mitogen-activated protein kinases Yu Lu 1,2,3,#, Quan Li 3,4,#, Yu-Ying Liu 3,4, Kai Sun 3,4, Jing-Yu
More informationGα i Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationData Sheet. MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406
Data Sheet MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406 Description The MAPK/ERK signaling pathway is a major participant in the regulation of cell growth and differentiation.
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationNon-Radioactive EMSA Kits with Biotin-Probes User s Manual
Non-Radioactive EMSA Kits with Biotin-Probes User s Manual VER. 5.11 02/2016 This manual is used for Viagene s complete EMSA kits with catalog number beginning with BITF. Viagene EMSA kits are intended
More informationNegatively charged microspheres provide an additional surface for cell attachment leading to proliferation, tissue regeneration and wound healing
Negatively charged microspheres provide an additional surface for cell attachment leading to proliferation, tissue regeneration and wound healing Authors: Correa LG, Peter R, Clerici G, Ritter V. 2017
More information1. QUANTITY OF LYSATE 2. LYSIS BUFFER
SAMPLE PREPARATION 1. QUANTITY OF LYSATE The amount of protein requested for the Kinex KAM-880 Antibody Microarray service is 100 µg per sample at an approximate concentration of 2 mg/ml. If your samples
More informationRNA Blue REAGENT FOR RAPID ISOLATION OF PURE AND INTACT RNA (Cat. No. R011, R012, R013)
RNA Blue REAGENT FOR RAPID ISOLATION OF PURE AND INTACT RNA (Cat. No. R011, R012, R013) WARNING: RNA Blue contains phenol and some other toxic components. After contact with skin, wash immediately with
More informationNotch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652
Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. Notch signaling
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationNotes on experimental technique: 1. Enzyme activity was measured by noting the increase in absorbance at 341 nm, as NADPH +
Case 2 Glucose-6-phosphate dehydrogenase activity and cell growth Focus concept The activity of the pentose phosphate pathway enzyme glucose-6-phosphate dehydrogenase has been found to be important in
More informationTime allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-18 CELL BIOLOGY BIO-5005B Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section
More informationRheB Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table
More informationCoolShift-BTd, a General EMSA Kit Using Biotin-DNA-Probes
CoolShift-BTd, a General EMSA Kit Using Biotin-DNA-Probes User s Manual VER. 36.16 08/2016 Catalog No: SIDET101 Viagene EMSA kits are intended for research purpose only! Viagene Biotech Inc. 3802 Spectrum
More informationLab Module 7: Cell Adhesion
Lab Module 7: Cell Adhesion Tissues are made of cells and materials secreted by cells that occupy the spaces between the individual cells. This material outside of cells is called the Extracellular Matrix
More informationRab5 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product
More informationArf6 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationcells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to
Supplemental Materials and Methods TGF bioassay. To quantify the levels of active and total TGF, we used mink lung epithelial cells (MLEC) that produce luciferase under the control of the PAI-1 promoter
More informationRNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu *
RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu * School of Biomedical Sciences, Thomas Jefferson University, Philadelphia, USA *For correspondence:
More informationRhoC Activation Assay Kit
Product Manual RhoC Activation Assay Kit Catalog Number STA-403-C 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationSupplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
More informationCataract is a consequence of the aging of the lens and is the. A Fully Human In Vitro Capsular Bag Model to Permit Intraocular Lens Evaluation.
Lens A Fully Human In Vitro Capsular Bag Model to Permit Intraocular Lens Evaluation Lucy J. Dawes, 1,2 Christopher D. Illingworth, 3 and I. Michael Wormstone 1 PURPOSE. To establish a fully human in vitro
More informationSupplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
More informationData Sheet. camp/pka Signaling Pathway CRE/CREB Reporter (Luc) HEK293 Cell Line Catalog #: 60515
Data Sheet camp/pka Signaling Pathway CRE/CREB Reporter (Luc) HEK293 Cell Line Catalog #: 60515 Background The camp/pka Signaling Pathway CRE/CREB Reporter (Luc) HEK293 Cell Line is designed for monitoring
More information10:10-10:22. YIA-1 A study of newly established human peripheral blood monocyte-derived ips cell line used in allergy research 10:22-10:32
10:10-10:22 YIA-1 A study of newly established human peripheral blood monocyte-derived ips cell line used in allergy research 10:22-10:32 EPA-1 Integration of conventional cell viability assays- recruiting
More informationData Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409
Data Sheet Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Product Description The Gli Reporter NIH3T3 Cell Line is designed for monitoring the activity of the hedgehog signaling
More informationData Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618
Data Sheet Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 6618 Background The Hippo pathway regulates cell proliferation and cell death. It is activated by high cell density and cell stress to stop
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationCulture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).
Methods Materials Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Bovine fibroblast growth factor (BFGF), thrombin, forskolin, IBMX, H-89, BAPTA-AM and
More informationSolid Phase cdna Synthesis Kit
#6123 v.02.09 Table of Contents I. Description... 2 II. Kit components... 2 III. Storage... 2 IV. Principle... 3 V. Protocol V-1. Preparation of immobilized mrna... 4 Protocol A: Starting from Tissue or
More informationElectrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-
SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning
More informationSite directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha
Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations
More informationThe role of erna in chromatin looping
The role of erna in chromatin looping Introduction Enhancers are cis-acting DNA regulatory elements that activate transcription of target genes 1,2. It is estimated that 400 000 to >1 million alleged enhancers
More informationCHAPTER 5 PTP-1B CLONING AND RECOMBINANT PROTEIN EXPRESSION. Recombinant DNA technology has revolutionized molecular biology and
204 CHAPTER 5 PTP-1B CLONING AND RECOMBINANT PROTEIN EXPRESSION SUMMARY Recombinant DNA technology has revolutionized molecular biology and genetics. Today, virtually any segment of DNA, the genetic material
More informationMAP Kinase (ERK1/2) Activity Assay Kit
MAP Kinase (ERK/2) Activity Assay Kit For 96 tests Cat. No. SGT45 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +(800) 437-7500 Fax: + (909) 676-9209 Europe +44 (0) 23
More informationTable of contents. I. Description...2. Kit Components...2. Storage...2. Required reagents and equipment...2. V. Protocol...3. Example Experiment...
PCR FLT3/ITD Mutation Detection Set Cat.# 6632 Table of contents I. Description...2 II. III. IV. Kit Components...2 Storage...2 Required reagents and equipment...2 V. Protocol...3 VI. XII. Example Experiment...4
More informationAnalysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng
Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng Department of Molecular Genetics, Biochemistry and Microbiology,
More informationData Sheet. Glucocorticoid Receptor Pathway GR-GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: 60655
Data Sheet Glucocorticoid Receptor Pathway GR-GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: 60655 Background The glucocorticoid signaling pathway plays an important role in development, fluid homeostasis,
More informationof the Triphosphate of ATP
A Small Aptamer with Strong and Specific Recognition of the Triphosphate of Peter L. Sazani, Rosa Larralde and Jack W. Szostak Howard Hughes Medical Institute, and Department of Molecular Biology, Massachusetts
More informationQuantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;
Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq
More informationHeparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2
Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2 Department of Anatomy, Yong Loo Lin School of Medicine, National University of Singapore MD10, 4 Medical Drive, Singapore 117597 ABSTRACT
More informationFisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).
175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further
More informationApplication Note. BD PureCoat ECM Mimetic Cultureware Collagen I Peptide: Novel Synthetic, Animal-free Surface for Culture of Human Keratinocytes
Page 1 BD PureCoat ECM Mimetic Cultureware Collagen I Peptide: Novel Synthetic, Animal-free Surface for Culture of Human Keratinocytes Kerry Thompson, Jeff Partridge, Elizabeth Abraham, Paula Flaherty,
More informationApplication Note 493
Corning PureCoat ECM Mimetic Cultureware Collagen I Peptide: Novel Synthetic, Animal-free Surface for Culture of Human Keratinocytes Kerry Thompson, Jeff Partridge, Elizabeth Abraham, Paula Flaherty, Susan
More informationSupplementary Materials and Methods
Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK
More informationModeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis
icell Cardiomyocytes Application Protocol Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis Introduction Cardiac hypertrophy is characterized by several different cellular changes,
More informationData Sheet. Glucocorticoid Receptor Pathway GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: w70666
Data Sheet Glucocorticoid Receptor Pathway GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: w70666 Background The glucocorticoid signaling pathway plays an important role in development, fluid homeostasis,
More informationTECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C
MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a
More informationJournal of Chemical and Pharmaceutical Research, 2015, 7(3): Research Article
Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 2015, 7(3):760-764 Research Article ISSN : 0975-7384 CODEN(USA) : JCPRC5 The effect of Rho/ROCK signal pathway on the migration
More informationIn vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay. Josephine MY Ko and Maria Li Lung *
In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay Josephine MY Ko and Maria Li Lung * Clinical Oncology Department, The Univerisity of Hong Kong, Hong Kong, Hong Kong SAR *For
More informationMEK1/2 (MAPK Kinase) Activity Assay Kit
MEK1/2 (MAPK Kinase) Activity Assay Kit For 96 tests Cat. No. SGT440 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0)
More informationSupplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
More information-RT RT RT -RT XBMPRII
Base pairs 2000 1650 1000 850 600 500 400 Marker Primer set 1 Primer set 2 -RT RT RT -RT XBMPRII kda 100 75 50 37 25 20 XAC p-xac A 300 B Supplemental figure 1. PCR analysis of BMPRII expression and western
More informationDetection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer. Application
Detection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer Application Gerd Luedke and Tobias Preckel Abstract This Application Note describes how the
More informationCardiomyocyte Differentiation Of Cord Lining Membrane Stem Cells. Phan T.H., Masilamani J. and Ng Y.H.
Cardiomyocyte Differentiation Of Cord Lining Membrane Stem Cells Phan T.H., Masilamani J. and Ng Y.H. Department of Bioengineering, National University of Singapore 21 Lower Kent Ridge Road, Singapore
More informationData Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289
Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289 Background Human CD137 (4-1BB; TNFRS9) is an inducible co-stimulatory molecule that activates T cells. CD137:CD137L-mediated
More informationProtein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo *
Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * INSERM U1009, Gustave Roussy, Villejuif, France *For correspondence: isabelle.plo@gustaveroussy.fr [Abstract]
More informationCytoSelect 48-Well Cell Adhesion Assay (ECM Array, Fluorometric Format)
Product Manual CytoSelect 48-Well Cell Adhesion Assay (ECM Array, Fluorometric Format) Catalog Number CBA-071 CBA-071-5 48 assays 5 x 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures
More informationEPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
More informationENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system
ENDEXT Technology Instruction manual for protein synthesis with wheat germ cell-free system 1 Protocol Overview Plasmid DNA construction (see Section 3.1) Preparation of plasmid DNA for transcription (see
More informationApoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium
Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended
More informationCataract is a consequence of the ageing of the lens and is the
Lens An In Vitro Evaluation of the Anew Zephyr Open-Bag IOL in the Prevention of Posterior Capsule Opacification Using a Human Capsular Bag Model Julie A. Eldred, 1 David J. Spalton, 1,2 and I. Michael
More informationCataract is a consequence of the ageing of the lens and is the
Lens An In Vitro Evaluation of the Anew Zephyr Open-Bag IOL in the Prevention of Posterior Capsule Opacification Using a Human Capsular Bag Model Julie A. Eldred, 1 David J. Spalton, 1,2 and I. Michael
More informationKnockdown of Arhgef-1 expression in VSMCs To knockdown rat VSMCs Arhgef-1 expression, three sets of sirna against rat
Supplemental Material Chemicals and Reagents PGE2 and sulprostone were respectively purchased from Cayman Chemical (Ann Arbor, MI) and BioMol Research Laboratories (Plymouth Meeting, PA). M&B28767 was
More informationIn Vitro Angiogenesis Assay Kit
In Vitro Angiogenesis Assay Kit Catalog Number KA1323 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationab Ran Activation Assay Kit
ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last
More informationProduct Quantity* Product No.
Page 1 of 6 Lit.# ML015 Rev.7/04 TransIT-TKO Transfection Reagent Product Quantity* Product No. TransIT-TKO Transfection Reagent 0.4 ml MIR 2154 1 ml MIR 2150 5 ml (5 x 1 ml) MIR 2155 10 ml (10 x 1 ml)
More informationEfficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John
More informationAdvanced phospho-erk1/2 (Thr202/Tyr204) 500 tests
Headquarters & Europe Office Cisbio Bioassays Phone: +33 (0)4 66 79 67 05 Fax: +33 (0)4 66 79 19 20 bioassays@cisbio.com cisbio_dd_pi_64aerpeg USA Office Cisbio US, Inc. Phone: +1 888 963 4567 Fax: +1
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationHigh Pure RNA Isolation Kit for isolation of total RNA from 50 samples Cat. No
for isolation of total RNA from 50 samples Cat. No. 1 88 665 Principle A single reagent lyses the sample lysis and inactivates RNase. In the presence of a chaotropic salt (guanidine HCl), the released
More informationAlphaScreen SureFire EGF Receptor (p-tyr1068) Assay Kits. Manual
AlphaScreen SureFire EGF Receptor (p-tyr1068) Assay Kits Manual Assay Points Catalog # 500 TGRERS500 10 000 TGRERS10K 50 000 TGRERS50K For Research Use Only Research Reagents for Research Purposes Only
More informationAn In Vitro Human Lens Capsular Bag Model Adopting a Graded Culture Regime to Assess Putative Impact of IOLs on PCO Formation
Lens An In Vitro Human Lens Capsular Bag Model Adopting a Graded Culture Regime to Assess Putative Impact of IOLs on PCO Formation Julie A. Eldred, 1 Jiyun Zheng, 2 Sulin Chen, 2 and I. Michael Wormstone
More informationAn In Vitro Human Lens Capsular Bag Model Adopting a Graded Culture Regime to Assess Putative Impact of IOLs on PCO Formation
Lens An In Vitro Human Lens Capsular Bag Model Adopting a Graded Culture Regime to Assess Putative Impact of IOLs on PCO Formation Julie A. Eldred, 1 Jiyun Zheng, 2 Sulin Chen, 2 and I. Michael Wormstone
More informationHLA-DR TYPING OF GENOMIC DNA
HLA-DR TYPING OF GENOMIC DNA Zofia SZCZERKOWSKA, Joanna WYSOCKA Institute of Forensic Medicine, Medical University, Gdañsk, Poland ABSTRACT: Advances in molecular biology techniques allowed for introduction
More informationAlphaScreen SureFire IKK β (p-ser177/181) Assay Kits. Quick Guide
AlphaScreen SureFire IKK β (p-ser177/181) Assay Kits Quick Guide Assay Points Catalog # 500 TGRKBS500 10 000 TGRKBS10K 50 000 TGRKBS50K For Research Use Only Research Reagents for Research Purposes Only
More informationAntibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg
Supplementary information Supplementary methods PCNA antibody and immunodepletion Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg extracts, one volume of protein
More informationData Sheet. TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536
Data Sheet TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536 Product Description Recombinant CHO-K1 cells constitutively expressing human PD-L1 (Programmed Cell Death 1 Ligand 1, CD274, B7
More informationReagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo
Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine
More information7.06 Cell Biology EXAM #2 March 20, 2003
7.06 Cell Biology EXAM #2 March 20, 2003 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write
More informationIntroduction and Background
Introduction and Background Caspase cleaved Keratin 18 (cck18) Epithelial Apoptosis Biomarker entities. Consequently, M30 CytoDEATH mab represents a unique tool for easy and For in vitro Tumor and Organ
More informationIntracellular receptors specify complex patterns of gene expression that are cell and gene
SUPPLEMENTAL RESULTS AND DISCUSSION Some HPr-1AR ARE-containing Genes Are Unresponsive to Androgen Intracellular receptors specify complex patterns of gene expression that are cell and gene specific. For
More informationAlphaScreen SureFire STAT3 Total Assay Kits. Manual
AlphaScreen SureFire STAT3 Total Assay Kits Manual Assay Points Catalog # 500 TGRTS3S500 10 000 TGRTS3S10K 50 000 TGRTS3S50K For Research Use Only Research Reagents for Research Purposes Only TGRKVS73.5
More informationData Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409
Data Sheet Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Product Description The Gli Reporter NIH3T3 Cell Line is designed for monitoring the activity of the hedgehog signaling
More informationHCV Genotype Primer Kit
Instruction Manual for HCV Genotype Primer Kit HCV Genotype Determination Kit for Research Purpose Thoroughly read this instruction manual before use of this kit Background Study of nucleotide sequence
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationScienCell. Human Epidermal Keratinocytes-adult (HEK-a) Catalog Number: Research Laboratories
ScienCell TM Research Laboratories Human Epidermal Keratinocytes-adult (HEK-a) Catalog Number: 2110 Cell Specification The epithelial layer of the skin provides an essential function as a protective barrier
More informationSmooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
More information