Bioinformatics for High Throughput Sequencing

Size: px
Start display at page:

Download "Bioinformatics for High Throughput Sequencing"

Transcription

1 Bioinformatics for High Throughput Sequencing

2

3 Naiara Rodríguez-Ezpeleta Ana M. Aransay Editors Michael Hackenberg Bioinformatics for High Throughput Sequencing

4 Editors Naiara Rodríguez-Ezpeleta Genome Analysis Platform CIC biogune Derio, Bizkaia, Spain Ana M. Aransay Genome Analysis Platform CIC biogune Derio, Bizkaia, Spain Michael Hackenberg Computational Genomics and Bioinformatics Group Genetics Department & Biomedical Research Center (CIBM) University of Granada, Spain ISBN e-isbn DOI / Springer New York Dordrecht Heidelberg London Library of Congress Control Number: Springer Science+Business Media, LLC 2012 All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. Printed on acid-free paper Springer is part of Springer Science+Business Media (

5 Preface The purpose of this book is to collect in a single volume the essentials of high throughput sequencing data analysis. These new technologies allow performing, at an unprecedented low cost and high speed, a panoply of experiments spanning the sequencing of whole genomes or transcriptomes, the profiling of DNA methylation, and the detection of protein DNA interaction sites, among others. In each experiment a massive amount of sequence information is generated, making data analysis the major challenge in high throughput sequencing-based projects. Hundreds of bioinformatics applications have been developed so far, most of them focusing on specific tasks. Indeed, numerous approaches have been proposed for each analysis step, while integrated analysis applications and protocols are generally missing. As a result, even experienced bioinformaticians struggle when they have to discern among countless possibilities to analyze their data. This, together with a lack of enough qualified personnel, reveals an urgent need to train bioinformaticians in existing approaches and to develop integrated, from start to end software applications to face present and future challenges in data analysis. Given this scenario, our motivation was to assemble a book covering the aforementioned aspects. Following three fundamental introductory chapters, the core of the book focuses on the bioinformatics aspects, presenting a comprehensive review of the methods and programs existing to analyze the raw data obtained from each experiment type. In addition, the book is meant to provide insight into challenges and opportunities faced by both, biologists and bioinformaticians, during this new era of sequencing data analysis. Given the vast range of high throughput sequencing applications, we set out to edit a book suitable for readers from different research areas, academic backgrounds and degrees of acquaintance with this new technology. At the same time, we expect the book to be equally useful to researchers involved in the different steps of a high throughput sequencing project. The newbies eager to learn the basics of high throughput sequencing technologies and data analysis will find what they yearn for specially by reading the first introductory chapters, but also by obviating the details and getting the rudiments of the v

6 vi Preface core chapters. On the other hand, biologists that are familiar with the fundamentals of the technology and analysis steps, but that have little bioinformatic training will find in the core chapters an invaluable resource where to learn about the different existing approaches, file formats, software, parameters, etc. for data analysis. The book will also be useful to those scientists performing downstream analyses on the output of high throughput sequencing data, as a perfect understanding of how their initial data was generated is crucial for an accurate interpretation of further outcomes. Additionally, we expect the book to be appealing to computer scientists or biologists with a strong bioinformatics background, who will hopefully find in the problematic issues and challenges raised in each chapter motivation and inspiration for the improvement of existing and the development of new tools for high throughput data analysis. Naiara Rodríguez-Ezpeleta Michael Hackenberg Ana M. Aransay

7 Contents 1 Introduction... 1 Naiara Rodríguez-Ezpeleta and Ana M. Aransay 2 Overview of Sequencing Technology Platforms Samuel Myllykangas, Jason Buenrostro, and Hanlee P. Ji 3 Applications of High-Throughput Sequencing Rodrigo Goya, Irmtraud M. Meyer, and Marco A. Marra 4 Computational Infrastructure and Basic Data Analysis for High-Throughput Sequencing David Sexton 5 Base-Calling for Bioinformaticians Mona A. Sheikh and Yaniv Erlich 6 De Novo Short-Read Assembly Douglas W. Bryant Jr. and Todd C. Mockler 7 Short-Read Mapping Paolo Ribeca 8 DNA Protein Interaction Analysis (ChIP-Seq) Geetu Tuteja 9 Generation and Analysis of Genome-Wide DNA Methylation Maps Martin Kerick, Axel Fischer, and Michal-Ruth Schweiger 10 Differential Expression for RNA Sequencing (RNA-Seq) Data: Mapping, Summarization, Statistical Analysis, and Experimental Design Matthew D. Young, Davis J. McCarthy, Matthew J. Wakefield, Gordon K. Smyth, Alicia Oshlack, and Mark D. Robinson vii

8 viii Contents 11 MicroRNA Expression Profiling and Discovery Michael Hackenberg 12 Dissecting Splicing Regulatory Network by Integrative Analysis of CLIP-Seq Data Michael Q. Zhang 13 Analysis of Metagenomics Data Elizabeth M. Glass and Folker Meyer 14 High-Throughput Sequencing Data Analysis Software: Current State and Future Developments Konrad Paszkiewicz and David J. Studholme Index

9 Contributors Ana M. Aransay Genome Analysis Platform, CIC biogune, Parque Tecnológico de Bizkaia, Derio, Spain Douglas W. Bryant, Jr. Department of Botany and Plant Pathology, Center for Genome Research and Biocomputing, Oregon State University, Corvallis, OR, USA Department of Electrical Engineering and Computer Science, Oregon State University, Corvallis, OR, USA Jason Buenrostro Division of Oncology, Department of Medicine, Stanford Genome Technology Center, Stanford University School of Medicine, Stanford, CA, USA Yaniv Erlich Whitehead Institute for Biomedical Research, Cambridge, MA, USA Axel Fischer Cancer Genomics Group, Department of Vertebrate Genomics, Max Planck Institute for Molecular Genetics, Berlin, Germany Elizabeth M. Glass Mathematics and Computer Science Division, Argonne National Laboratory, Argonne, IL, USA Computation Institute, The University of Chicago, Chicago, IL, USA Rodrigo Goya Canada s Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, BC, Canada Centre for High-Throughput Biology, University of British Columbia, Vancouver, BC, Canada Department of Computer Science, University of British Columbia, Vancouver, BC, Canada Michael Hackenberg Computational Genomics and Bioinformatics Group, Genetics Department, University of Granada, Granada, Spain ix

10 x Contributors Hanlee P. Ji Division of Oncology, Department of Medicine, Stanford Genome Technology Center,, Stanford University School of Medicine, Stanford, CA, USA Martin Kerick Cancer Genomics Group, Department of Vertebrate Genomics, Max Planck Institute for Molecular Genetics, Berlin, Germany Marco A. Marra Canada s Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, BC, Canada Department of Medical Genetics, University of British Columbia, Vancouver, BC, Canada Davis J. McCarthy Bioinformatics Division, Walter and Eliza Hall Institute, Folker Meyer Mathematics and Computer Science Division, Argonne National Laboratory, Argonne, IL, USA Computation Institute, The University of Chicago, Chicago, IL, USA Institute for Genomics and Systems Biology, The University of Chicago, Chicago, IL, USA Irmtraud M. Meyer Centre for High-Throughput Biology, University of British Columbia, Vancouver, BC, Canada Department of Computer Science, University of British Columbia, Vancouver, BC, Canada Department of Medical Genetics, University of British Columbia, Vancouver, BC, Canada Todd C. Mockler Department of Botany and Plant Pathology, Center for Genome Research and Biocomputing, Oregon State University, Corvallis, OR, USA Samuel Myllykangas Division of Oncology, Department of Medicine, Stanford Genome Technology Center, Stanford University School of Medicine, Stanford, CA, USA Alicia Oshlack Bioinformatics Division, Walter and Eliza Hall Institute, School of Physics, University of Melbourne, Murdoch Childrens Research Institute, Parkville, Australia Konrad Paszkiewicz School of Biosciences, University of Exeter, Exeter, UK Paolo Ribeca Centro Nacional de Análisis Genómico, Baldiri Reixac 4, Barcelona, Spain

11 Contributors xi Mark D. Robinson Bioinformatics Division, Walter and Eliza Hall Institute, Department of Medical Biology, University of Melbourne, Epigenetics Laboratory, Cancer Research Program, Garvan Institute of Medical Research, Darlinghurst, NSW, Australia Naiara Rodríguez-Ezpeleta Genome Analysis Platform, CIC biogune, Parque Tecnológico de Bizkaia, Derio, Spain Michal-Ruth Schweiger Cancer Genomics Group, Department of Vertebrate Genomics, Max Planck Institute for Molecular Genetics, Berlin, Germany David Sexton Center for Human Genetics Research, Vanderbilt University, Nashville, TN, USA Mona A. Sheikh Whitehead Institute for Biomedical Research, Cambridge, MA, USA Gordon K. Smyth Bioinformatics Division, Walter and Eliza Hall Institute, Department of Mathematics and Statistics, University of Melbourne, David J. Studholme School of Biosciences, University of Exeter, Exeter, UK Geetu Tuteja Department of Developmental Biology, Stanford University, Stanford, CA, USA Matthew J. Wakefield Bioinformatics Division, Walter and Eliza Hall Institute, Department of Zoology, University of Melbourne, Matthew D. Young Bioinformatics Division, Walter and Eliza Hall Institute, Michael Q. Zhang Department of Molecular and Cell Biology, Center for Systems Biology, The University of Texas at Dallas, Richardson, TX, USA Bioinformatics Division, TNLIST, Tsinghua University, Beijing, China

12 wwwwwwwwwww

Bioinformatics for High Throughput Sequencing

Bioinformatics for High Throughput Sequencing Bioinformatics for High Throughput Sequencing Naiara Rodríguez-Ezpeleta Ana M. Aransay Editors Michael Hackenberg Bioinformatics for High Throughput Sequencing Editors Naiara Rodríguez-Ezpeleta Genome

More information

Microarrays in Diagnostics and Biomarker Development

Microarrays in Diagnostics and Biomarker Development Microarrays in Diagnostics and Biomarker Development . Editor Microarrays in Diagnostics and Biomarker Development Current and Future Applications Editor CoReBio PACA Luminy Science Park 13288 Marseille

More information

The Genetics of Obesity

The Genetics of Obesity The Genetics of Obesity Struan F.A. Grant Editor The Genetics of Obesity Editor Struan F.A. Grant Children s Hospital of Philadelphia Research Institute Philadelphia, PA, USA ISBN 978-1-4614-8641-1 ISBN

More information

Marine Bioactive Compounds

Marine Bioactive Compounds Marine Bioactive Compounds Maria Hayes Editor Marine Bioactive Compounds Sources, Characterization and Applications Editor Maria Hayes Food BioSciences Department Teagasc Food Research Centre Ashtown,

More information

E E. International Series in Operations Research & Management Science. Series Editor: Fredrick S. Hillier Stanford University

E E. International Series in Operations Research & Management Science. Series Editor: Fredrick S. Hillier Stanford University E E International Series in Operations Research & Management Science Series Editor: Fredrick S. Hillier Stanford University Special Editorial Consultant: Camille C. Price Stephen F. Austin State University

More information

Operations Research/Computer Science Interfaces Series

Operations Research/Computer Science Interfaces Series Operations Research/Computer Science Interfaces Series Volume 50 Series Editors: Ramesh Sharda Oklahoma State University, Stillwater, Oklahoma, USA Stefan Voß University of Hamburg, Hamburg, Germany For

More information

Infectious Disease. Vassil St. Georgiev. For further volumes:

Infectious Disease. Vassil St. Georgiev. For further volumes: Infectious Disease Vassil St. Georgiev For further volumes: http://www.springer.com/series/7646 John B. Cliff Helen W. Kreuzer Christopher J. Ehrhardt David S. Wunschel Editors Chemical and Physical Signatures

More information

ADVANCED MEDIA PLANNING

ADVANCED MEDIA PLANNING ADVANCED MEDIA PLANNING ADVANCED MEDIA PLANNING by JOHN R. ROSSITER Australian Graduate School of Management and PETER J. DANAHER University of Auckland, New Zealand " ~ SPRINGER SCIENCE+BUSINESS MEDIA,

More information

Exercises in Environmental Physics

Exercises in Environmental Physics Exercises in Environmental Physics Valerio Faraoni Exercises in Environmental Physics Valerio Faraoni Physics Department Bishop s University Lennoxville, Quebec J1M 1Z7 Canada vfaraoni@cs-linux.ubishops.ca

More information

Lecture Notes in Energy 5

Lecture Notes in Energy 5 Lecture Notes in Energy 5 For further volumes: http://www.springer.com/series/8874 . Hortensia Amaris Monica Alonso Carlos Alvarez Ortega Reactive Power Management of Power Networks with Wind Generation

More information

A Computer Scientist s Guide to Cell Biology

A Computer Scientist s Guide to Cell Biology A Computer Scientist s Guide to Cell Biology A Computer Scientist s Guide to Cell Biology A Travelogue from a Stranger in a Strange Land William W. Cohen Machine Learning Department Carnegie Mellon University

More information

Genetic and Molecular Epidemiology of Multiple Myeloma

Genetic and Molecular Epidemiology of Multiple Myeloma Genetic and Molecular Epidemiology of Multiple Myeloma Suzanne Lentzsch Editor Genetic and Molecular Epidemiology of Multiple Myeloma Editor Suzanne Lentzsch College of Physicians and Surgeons Multiple

More information

International Series in Operations Research & Management Science

International Series in Operations Research & Management Science International Series in Operations Research & Management Science Volume 143 Series Editor: Frederick S. Hillier Stanford University For further volumes: http://www.springer.com/series/6161 T.C. Edwin

More information

From reads to results: differential. Alicia Oshlack Head of Bioinformatics

From reads to results: differential. Alicia Oshlack Head of Bioinformatics From reads to results: differential expression analysis with ihrna seq Alicia Oshlack Head of Bioinformatics Murdoch Childrens Research Institute Benefits and opportunities ii of RNA seq All transcripts

More information

Simulation Strategies to Reduce Recidivism

Simulation Strategies to Reduce Recidivism Simulation Strategies to Reduce Recidivism Faye S. Taxman April Pattavina Editors Simulation Strategies to Reduce Recidivism Risk Need Responsivity (RNR) Modeling for the Criminal Justice System Editors

More information

Principles of Food Sanitation. Fifth Edition

Principles of Food Sanitation. Fifth Edition Principles of Food Sanitation Fifth Edition Principles of Food Sanitation Fifth Edition Norman G. Marriott, PhD Extension Food Scientist and Professor Emeritus Department of Food Science and Technology

More information

Field Guidelines for Genetic Experimental Designs in High-Throughput Sequencing

Field Guidelines for Genetic Experimental Designs in High-Throughput Sequencing Field Guidelines for Genetic Experimental Designs in High-Throughput Sequencing Ana M. Aransay José Luis Lavín Trueba Editors Field Guidelines for Genetic Experimental Designs in High-Throughput Sequencing

More information

Genomic Elements in Health, Disease and Evolution

Genomic Elements in Health, Disease and Evolution Genomic Elements in Health, Disease and Evolution Kyriacos Felekkis Konstantinos Voskarides Editors Genomic Elements in Health, Disease and Evolution Junk DNA Editors Kyriacos Felekkis Department of Life

More information

Research & Management Science

Research & Management Science EInternational E Series in Operations Research & Management Science Series Editor: Frederick S. Hillier Stanford University, CA, USA Special Editorial Consultant: Camille C. Price Stephen F. Austin State

More information

Shabbir A. Shahid Mahmoud A. Abdelfattah Michael A. Wilson John A. Kelley Joseph V. Chiaretti. United Arab Emirates Keys to Soil Taxonomy

Shabbir A. Shahid Mahmoud A. Abdelfattah Michael A. Wilson John A. Kelley Joseph V. Chiaretti. United Arab Emirates Keys to Soil Taxonomy Shabbir A. Shahid Mahmoud A. Abdelfattah Michael A. Wilson John A. Kelley Joseph V. Chiaretti United Arab Emirates Keys to Soil Taxonomy United Arab Emirates Keys to Soil Taxonomy Shabbir A. Shahid Mahmoud

More information

Environmental Radiation Effects on Mammals

Environmental Radiation Effects on Mammals Environmental Radiation Effects on Mammals Olga A. Smirnova Environmental Radiation Effects on Mammals A Dynamical Modeling Approach 123 Dr.OlgaA.Smirnova Research and Technical Center of Radiation-Chemical

More information

Biomaterials. Third Edition

Biomaterials. Third Edition Biomaterials Third Edition Joon Park R.S. Lakes Biomaterials An Introduction Third Edition Joon Park Biomedical and Mechanical Engineering University of Iowa Iowa City, IA 52242-1414 USA joon-park@uiowa.edu

More information

Ethics for Biomedical Engineers

Ethics for Biomedical Engineers Ethics for Biomedical Engineers Jong Yong Abdiel Foo Stephen J. Wilson Andrew P. Bradley Winston Gwee Dennis Kwok-Wing Tam Ethics for Biomedical Engineers Jong Yong Abdiel Foo Electronic and Computer

More information

Machining of Polymer Composites

Machining of Polymer Composites Machining of Polymer Composites Jamal Y. Sheikh-Ahmad Machining of Polymer Composites 123 Jamal Y. Sheikh-Ahmad The Petroleum Institute Department of Mechanical Engineering Abu Dhabi United Arab Emirates

More information

Reliability of Microtechnology

Reliability of Microtechnology Reliability of Microtechnology Johan Liu Olli Salmela Jussi Särkkä l l James E. Morris Per-Erik Tegehall l Cristina Andersson Reliability of Microtechnology Interconnects, Devices and Systems Johan Liu

More information

Chapter 3: Assessing and Measuring Wetland Hydrology

Chapter 3: Assessing and Measuring Wetland Hydrology Chapter 3: Assessing and Measuring Wetland Hydrology Donald O. Rosenberry and Masaki Hayashi This sample file is posted on the web site for preliminary viewing of contents. If you would like to have a

More information

Philip Simpson. FPGA Design. Best Practices for Team-based Design

Philip Simpson. FPGA Design. Best Practices for Team-based Design FPGA Design 5 Philip Simpson FPGA Design Best Practices for Team-based Design Philip Simpson Altera Corporation San Jose, CA 95134 USA Feilmidh@sbcglobal.net ISBN 978-1-4419-6338-3 e-isbn 978-1-4419-6339-0

More information

SpringerBriefs in Food, Health, and Nutrition Series

SpringerBriefs in Food, Health, and Nutrition Series SpringerBriefs in Food, Health, and Nutrition Series Springer Briefs in Food, Health, and Nutrition present concise summaries of cutting edge research and practical applications across a wide range of

More information

Lecture Notes in Earth System Sciences 144

Lecture Notes in Earth System Sciences 144 Lecture Notes in Earth System Sciences 144 Editors: P. Blondel, Bath J. Reitner, G ottingen K. St uwe, Graz M.H. Trauth, Potsdam D. Yuen, Minneapolis Founding Editors: G. M. Friedman, Brooklyn and Troy

More information

Biomphalaria Snails and Larval Trematodes

Biomphalaria Snails and Larval Trematodes Biomphalaria Snails and Larval Trematodes w Rafael Toledo Bernard Fried Editors Biomphalaria Snails and Larval Trematodes Editors Rafael Toledo Departamento de Biología Celular y Parasitología Facultad

More information

M ETHODS IN MOLECULAR BIOLOGY

M ETHODS IN MOLECULAR BIOLOGY M ETHODS IN MOLECULAR BIOLOGY Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK For further volumes: http://www.springer.com/series/7651

More information

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

More information

Jinsong Zhou Zhongyang Luo Yanqun Zhu Mengxiang Fang. Mercury Emission and its Control in Chinese Coal-Fired Power Plants

Jinsong Zhou Zhongyang Luo Yanqun Zhu Mengxiang Fang. Mercury Emission and its Control in Chinese Coal-Fired Power Plants Jinsong Zhou Zhongyang Luo Yanqun Zhu Mengxiang Fang Mercury Emission and its Control in Chinese Coal-Fired Power Plants Jinsong Zhou Zhongyang Luo Yanqun Zhu Mengxiang Fang Mercury Emission and its Control

More information

Information and Organization Design Series

Information and Organization Design Series ORGANIZATION DESIGN Information and Organization Design Series series editors Richard M. Burton B0rge Obel ORGANIZATIONAL LEARNING: Creating, Retaining and Transferring Knowledge, by Linda Argote STRATEGIC

More information

Structure and Chemistry of Crystalline Solids

Structure and Chemistry of Crystalline Solids Structure and Chemistry of Crystalline Solids Bodie E. Douglas Shih-Ming Ho Structure and Chemistry of Crystalline Solids Bodie E. Douglas Shih-Ming Ho University of Pittsburgh Pittsburgh, PA USA Library

More information

Recombinant Enzymes From Basic Science to Commercialization

Recombinant Enzymes From Basic Science to Commercialization Recombinant Enzymes From Basic Science to Commercialization Azura Amid Editor Recombinant Enzymes From Basic Science to Commercialization 1 3 Editor Azura Amid Department of Biotechnology Engineering Kulliyyah

More information

Materials Research and Engineering Edited by B. Ilschner and N.J. Grant

Materials Research and Engineering Edited by B. Ilschner and N.J. Grant Materials Research and Engineering Edited by B. Ilschner and N.J. Grant Julian Szekely Goran Carlsson Lars Helle Ladle Metallurgy With 137 Figures and 24 Tables Springer-Verlag New York Berlin Heidelberg

More information

Microsystems for Pharmatechnology

Microsystems for Pharmatechnology Microsystems for Pharmatechnology Andreas Dietzel Editor Microsystems for Pharmatechnology Manipulation of Fluids, Particles, Droplets, and Cells Editor Andreas Dietzel Institute of Microtechnology Technische

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

ESSENTIAL BIOINFORMATICS

ESSENTIAL BIOINFORMATICS ESSENTIAL BIOINFORMATICS Essential Bioinformatics is a concise yet comprehensive textbook of bioinformatics that provides a broad introduction to the entire field. Written specifically for a life science

More information

MANAGING IN THE INFORMATION ECONOMY. Current Research Issues

MANAGING IN THE INFORMATION ECONOMY. Current Research Issues MANAGING IN THE INFORMATION ECONOMY Current Research Issues MANAGING IN THE INFORMATION ECONOMY Current Research Issues Edited by Uday Apte And Uday Karmarkar Uday Apte Naval Postgraduate School Monterey,

More information

Agile Project Management: Managing for Success

Agile Project Management: Managing for Success Agile Project Management: Managing for Success James A. Crowder Shelli Friess Agile Project Management: Managing for Success James A. Crowder Raytheon Denver, CO, USA Shelli Friess Englewood, CO, USA

More information

OPTIMIZATION IN PUBLIC TRANSPORTATION. Stop Location, Delay Management and Tariff Zone Design in a Public Transportation Network

OPTIMIZATION IN PUBLIC TRANSPORTATION. Stop Location, Delay Management and Tariff Zone Design in a Public Transportation Network OPTIMIZATION IN PUBLIC TRANSPORTATION Stop Location, Delay Management and Tariff Zone Design in a Public Transportation Network Optimization and Its Applications VOLUME 3 Managing Editor Panos M. Pardalos

More information

Stem Cell Biology and Regenerative Medicine

Stem Cell Biology and Regenerative Medicine Stem Cell Biology and Regenerative Medicine Series Editor Kursad Turksen, Ph.D. kturksen@ohri.ca For other titles published in this series, go to http://www.springer.com/series/7896 Donald G. Phinney Editor

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases

More information

Managing e-business Projects

Managing e-business Projects Managing e-business Projects Springer-Verlag Berlin Heidelberg GmbH Thomas Stoehr Managing e-business Projects 99 Key Success Factors With 37 Figures and 12 Tables Springer Thomas Stoehr Overbeckstr. 7

More information

Quickstart Molecular Biology

Quickstart Molecular Biology Quickstart Molecular Biology An Introduction for Mathematicians, Physicists, and Computational Scientists ALSO FROM COLD SPRING HARBOR LABORATORY PRESS A Genetic Switch, Third Edition, Phage Lambda Revisited

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Lecture Notes in Management and Industrial Engineering

Lecture Notes in Management and Industrial Engineering Lecture Notes in Management and Industrial Engineering Volume 1 Series Editor: Adolfo López-Paredes Valladolid, Spain This bookseries provides a means for the dissemination of current theoretical and applied

More information

Nanotechnology Enabled In situ Sensors for Monitoring Health

Nanotechnology Enabled In situ Sensors for Monitoring Health Nanotechnology Enabled In situ Sensors for Monitoring Health Thomas J. Webster Editor Nanotechnology Enabled In situ Sensors for Monitoring Health Editor Thomas J. Webster School of Engineering Brown

More information

M e t h o d s in Molecular Biology

M e t h o d s in Molecular Biology M e t h o d s in Molecular Biology Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK For further volumes: http://www.springer.com/series/7651

More information

DIRECT -CONTACT HEAT TRANSFER

DIRECT -CONTACT HEAT TRANSFER DIRECT -CONTACT HEAT TRANSFER DIRECT -CONTACT HEAT TRANSFER Edited by Frank Kreith Solar Energy Research Institute Golden, Colorado and University of Colorado, Boulder R. F. Boehm University of Utah Salt

More information

Energy-Efficient HVAC Design

Energy-Efficient HVAC Design Energy-Efficient HVAC Design Javad Khazaii Energy-Efficient HVAC Design An Essential Guide for Sustainable Building Javad Khazaii Engineering Department Southern Polytechnic State University Marietta,

More information

Advances in Soil Science

Advances in Soil Science Advances in Soil Science Advances in Soil Science B.A. Stewart, Editor Editorial Board R. Lal C.W. Rose U. Schwertmann B.A. Stewart P.B. Tinker R.J. Wagenet B.Yaron Advances in Soil Science Volume 19 Limitations

More information

The Search for Human Chromosomes

The Search for Human Chromosomes The Search for Human Chromosomes ThiS is a FM Blank Page Wilson John Wall The Search for Human Chromosomes A History of Discovery Wilson John Wall Bewdley United Kingdom ISBN 978-3-319-26334-2 ISBN 978-3-319-26336-6

More information

Advances in Soil Science

Advances in Soil Science Advances in Soil Science Advances in Soil Science B.A. Stewart, Editor Editorial Board R. Lal CW. Rose U. Schwertmann B.A. Stewart P.B. Tinker R.J. Wagenet B. Yaron Advances in Soil Science Volume 10 Edited

More information

Management of Network Organizations

Management of Network Organizations Management of Network Organizations ThiS is a FM Blank Page Włodzimierz Sroka Štefan Hittmár Editors Management of Network Organizations Theoretical Problems and the Dilemmas in Practice Editors Włodzimierz

More information

A. McDermott R. H. Burdon A. E. Smith C. Jones P. Cohen R. Denton, C. I. Pogson D. M. Moore L. M. Cook H. H. Rees

A. McDermott R. H. Burdon A. E. Smith C. Jones P. Cohen R. Denton, C. I. Pogson D. M. Moore L. M. Cook H. H. Rees LIST OF TITLES Already published Cell Differentiation Functions of Biological Membranes Cellular Development Brain Biochemistry Immunochemistry The Selectivity of Drugs Biomechanics Molecular Virology

More information

AAPS Advances in the Pharmaceutical Sciences Series

AAPS Advances in the Pharmaceutical Sciences Series AAPS Advances in the Pharmaceutical Sciences Series Volume 20 Series Editors Daan J. A. Crommelin Utrecht University, Utrecht, The Netherlands Robert A. Lipper Back Cove Pharma, LLC, Waldoboro, Maine,

More information

Management for Professionals

Management for Professionals Management for Professionals For further volumes: http://www.springer.com/series/10101 ThiS is a FM Blank Page Erik Jannesson Fredrik Nilsson Birger Rapp Editors Strategy, Control and Competitive Advantage

More information

TREE CODE PRODUCT BROCHURE

TREE CODE PRODUCT BROCHURE TREE CODE PRODUCT BROCHURE Single Molecule, Real-Time (SMRT) Sequencing technology offers: Long read sequencing ~10 Gb with 20 kb average read lengths for WGS ~20 Gb with 40 kb average read length for

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Integrated Pest Management

Integrated Pest Management Integrated Pest Management Integrated Pest Management Edited by J. Lawrence Apple North Carolina State University at Raleigh and Ray F. Smith University of California at Berkeley PLENUM PRESS. NEW YORK

More information

Leading Pharmaceutical Operational Excellence

Leading Pharmaceutical Operational Excellence Leading Pharmaceutical Operational Excellence ThiS is a FM Blank Page Thomas Friedli Prabir Basu Daniel Bellm Jürgen Werani Editors Leading Pharmaceutical Operational Excellence Outstanding Practices and

More information

Management for Professionals

Management for Professionals Management for Professionals For further volumes: http://www.springer.com/series/10101 ThiS is a FM Blank Page Akram Al Ariss Editor Global Talent Management Challenges, Strategies, and Opportunities Editor

More information

Structural Design Guide to the

Structural Design Guide to the Structural Design Guide to the Building Code Structural Design Guide to the Building: Code Edward S. Hoffman President Edward S. Hoffman, Ltd., Chicago, IL David P. Gustafson Vice President of Engineering

More information

Nested Partitions Method, Theory and Applications

Nested Partitions Method, Theory and Applications Nested Partitions Method, Theory and Applications Recent titles in the INTERNATIONAL SERIES IN OPERATIONS RESEARCH & MANAGEMENT SCIENCE Frederick S. Hillier, Series Editor, Stanford University Gass & Assad/

More information

Tree and Forest Measurement

Tree and Forest Measurement Tree and Forest Measurement P.W. West Tree and Forest Measurement 2 nd Edition With 33 Figures and 11 Tables P.W. West School of Environmental Science and Management Southern Cross University Lismore,

More information

Lee-Jun C. Wong Editor. Next Generation Sequencing. Translation to Clinical Diagnostics

Lee-Jun C. Wong Editor. Next Generation Sequencing. Translation to Clinical Diagnostics Lee-Jun C. Wong Editor Next Generation Sequencing Translation to Clinical Diagnostics Next Generation Sequencing Lee-Jun C. Wong Editor Next Generation Sequencing Translation to Clinical Diagnostics Editor

More information

DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.

DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction. Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal

More information

RESEARCH AREA NEUROSCIENCE

RESEARCH AREA NEUROSCIENCE RESEARCH AREA NEUROSCIENCE coordinator MATHEW E. DIAMOND area committee Alessandro Treves Raffaella Rumiati Giuseppe Legname Andrea Nistri Dario Olivieri A variety of research groups are active in Neuroscience.

More information

Handbook of Media Branding

Handbook of Media Branding Handbook of Media Branding ThiS is a FM Blank Page Gabriele Siegert Kati F orster Sylvia M. Chan-Olmsted Mart Ots Editors Handbook of Media Branding Editors Gabriele Siegert University of Zurich IPMZ Institute

More information

Design and Management of Energy-Efficient Hybrid Electrical Energy Storage Systems

Design and Management of Energy-Efficient Hybrid Electrical Energy Storage Systems Design and Management of Energy-Efficient Hybrid Electrical Energy Storage Systems Younghyun Kim Naehyuck Chang Design and Management of Energy-Efficient Hybrid Electrical Energy Storage Systems 123 Younghyun

More information

Next-generation sequencing technologies

Next-generation sequencing technologies Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html

More information

SpringerBriefs in Microbiology

SpringerBriefs in Microbiology SpringerBriefs in Microbiology For further volumes: http://www.springer.com/series/8911 Naowarat Cheeptham Editor Cave Microbiomes: A Novel Resource for Drug Discovery Editor Naowarat Cheeptham Thompson

More information

Environmental Sustainability Issues in the South Texas Mexico Border Region

Environmental Sustainability Issues in the South Texas Mexico Border Region Environmental Sustainability Issues in the South Texas Mexico Border Region David Ramirez Jianhong Ren Kim D. Jones Harriet Lamm Editors Environmental Sustainability Issues in the South Texas Mexico Border

More information

ADAMAS UNIVERSITY FACULTY OF SCIENCE - DEPARTMENT OF BIOTECHNOLOGY BACHELOR OF SCIENCE (Honours) SEMESTER - I

ADAMAS UNIVERSITY FACULTY OF SCIENCE - DEPARTMENT OF BIOTECHNOLOGY BACHELOR OF SCIENCE (Honours) SEMESTER - I NEW CHOICE BASED CREDIT SYSTEM (TOTAL CREDIT = 22+22+28+28+26+26 = 152) Type of the Paper Paper Code ADAMAS UNIVERSITY FACULTY OF SCIENCE - DEPARTMENT OF BIOTECHNOLOGY SEMESTER - I / Brief Contents I BT1201

More information

DNA Microarray Technology and Data Analysis in Cancer Research Downloaded from

DNA Microarray Technology and Data Analysis in Cancer Research Downloaded from This page intentionally left blank Shaoguang Li University of Massachusetts Medical School, USA Dongguang Li Edith Cowan University, Australia World Scientific N E W J E R S E Y L O N D O N S I N G A P

More information

Energy Systems. Series Editor: Panos M. Pardalos, University of Florida, USA. For further volumes:

Energy Systems. Series Editor: Panos M. Pardalos, University of Florida, USA. For further volumes: Energy Systems Series Editor: Panos M. Pardalos, University of Florida, USA For further volumes: http://www.springer.com/series/8368 . Alexey Sorokin l Steffen Rebennack l Panos M. Pardalos l Niko A. Iliadis

More information

Advances in Soil Science

Advances in Soil Science Advances in Soil Science Advances in Soil Science B.A. Stewart, Editor Editorial Board R. Lal C.W. Rose U. Schwertmann B.A. Stewart P.B. Tinker R.J. Wagenet B.Yaron Advances in Soil Science Volume 17 Soil

More information

Management of Permanent Change

Management of Permanent Change Management of Permanent Change Horst Albach Heribert Meffert Andreas Pinkwart Ralf Reichwald Editors Management of Permanent Change Editors Horst Albach Center for Advanced Studies in Management HHL Leipzig

More information

Public Administration, Governance and Globalization

Public Administration, Governance and Globalization Public Administration, Governance and Globalization Volume 16 Series Editor Ali Farazmand Florida Atlantic University Fort Lauderdale Florida USA Public Administration, Governance and Globalization Ali

More information

bioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5

bioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5 Bioinformatica 1 / 5 2 / 5 3 / 5 Bioinformatica Bioinformatics is the name given to these mathematical and computing approaches used to glean understanding of biological processes. Common activities in

More information

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility 2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,

More information

Pharmaceutical Prices in the 21st Century

Pharmaceutical Prices in the 21st Century Pharmaceutical Prices in the 21st Century ThiS is a FM Blank Page Zaheer-Ud-Din Babar Editor Pharmaceutical Prices in the 21st Century Editor Zaheer-Ud-Din Babar Faculty of Medical and Health Sciences

More information

Entrepreneurial Marketing for SMEs

Entrepreneurial Marketing for SMEs Entrepreneurial Marketing for SMEs This page intentionally left blank Entrepreneurial Marketing for SMEs Luca Cacciolatti University of Westminster, UK and Soo Hee Lee University of Kent, UK Luca Cacciolatti

More information

What is Bioinformatics?

What is Bioinformatics? What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is

More information

The GMO Handbook. Genetically Modified Animals, Microbes, and Plants in Biotechnology. Edited by. Sarad R. Parekh, PhD

The GMO Handbook. Genetically Modified Animals, Microbes, and Plants in Biotechnology. Edited by. Sarad R. Parekh, PhD The GMO Handbook The GMO Handbook Genetically Modified Animals, Microbes, and Plants in Biotechnology Edited by Sarad R. Parekh, PhD Dow AgroSciences, Indianapolis, IN * Springer Science+Business Media,

More information

Springer New York Berlin Heidelberg Barcelona Budapest Hong Kong London Milan Paris Santa Clara Singapore Tokyo

Springer New York Berlin Heidelberg Barcelona Budapest Hong Kong London Milan Paris Santa Clara Singapore Tokyo Developmental Biology Springer New York Berlin Heidelberg Barcelona Budapest Hong Kong London Milan Paris Santa Clara Singapore Tokyo Werner A. Miiller Developmental Biology With 123 Figure Springer Werner

More information

Computational Challenges of Medical Genomics

Computational Challenges of Medical Genomics Talk at the VSC User Workshop Neusiedl am See, 27 February 2012 [cbock@cemm.oeaw.ac.at] http://medical-epigenomics.org (lab) http://www.cemm.oeaw.ac.at (institute) Introducing myself to Vienna s scientific

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

SOCIAL DIMENSIONS OF INFORMATION AND COMMUNICATION TECHNOLOGY POLICY

SOCIAL DIMENSIONS OF INFORMATION AND COMMUNICATION TECHNOLOGY POLICY SOCIAL DIMENSIONS OF INFORMATION AND COMMUNICATION TECHNOLOGY POLICY IFIP The International Federation for Information Processing IFIP was founded in 1960 under the auspices of UNESCO, following the First

More information

Biotechnology Fifth edition

Biotechnology Fifth edition Biotechnology Fifth edition Biotechnology is the major technology of the twenty-first century yet few people realise how much it impacts on many aspects of human society. The defining aim of this new fifth

More information

Nucleic Acids and Molecular Biology

Nucleic Acids and Molecular Biology Nucleic Acids and Molecular Biology 20 Series Editor H. J. Gross H. Ulrich Göringer (Ed.) RNA Editing Professor Dr. H. Ulrich Göringer Institute of Microbiology and Genetics Technical University Darmstadt

More information

METHODS OF MICROARRAY DATA ANALYSIS III

METHODS OF MICROARRAY DATA ANALYSIS III METHODS OF MICROARRAY DATA ANALYSIS III METHODS OF MICROARRAY DATA ANALYSIS III Papers from CAMDA 02 edited by Kimberly F. Johnson Cancer Center Information Systems Duke University Medical Center Durham,

More information

Microbial Metabolism Systems Microbiology

Microbial Metabolism Systems Microbiology 1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological

More information

Engineering Materials

Engineering Materials Engineering Materials More information about this series at http://www.springer.com/series/4288 Emilio I. Alarcon May Griffith Klas I. Udekwu Editors Silver Nanoparticle Applications In the Fabrication

More information

Sustainable Water Resources Planning and Management Under Climate Change

Sustainable Water Resources Planning and Management Under Climate Change Sustainable Water Resources Planning and Management Under Climate Change Elpida Kolokytha Satoru Oishi Editors Sustainable Water Resources Planning and Management Under Climate Change 123 Editors Elpida

More information