Canadian Bioinforma2cs Workshops
|
|
- Branden Colin Hamilton
- 6 years ago
- Views:
Transcription
1 Canadian Bioinforma2cs Workshops Module #: Title of Module 2 1
2 Introduction to Microarrays & R Paul Boutros Morning Overview 09:00-11:00 Microarray Background Microarray Pre- Processing Basics 11:30-12:30 Guided Analysis: Data Loading & Pre Processing 2
3 Let s start off with a ques7on What do expression microarrays actually measure? Session Overview What are microarrays? What are microarrays used for? Molecular Aspects Biological Aspects Downstream Analyses How is microarray data analyzed? Workflow overview 3
4 What is a Microarray? A DNA microarray is a mul2plex technology consis2ng of thousands of oligonucleo2de spots, each containing picomoles of a specific DNA sequence. Used to quan2tate mrna or DNA Many applica2ons: mrna or DNA levels SNP iden2fica2on ChIP- on- Chip Hypotheses Microarrays are usually hypothesis- genera2ng: They highlight specific genes or features that are par2cularly interes2ng for follow- up experiments There are many interes2ng excep2ons Biomarkers Pathway analyses This does not reduce the importance of experimental design the low sta2s2cal power of array studies make good design even more important and very challenging 4
5 Input Samples The nature of the sample is critical: * Unfrozen vs. Frozen vs. FFPE * Total RNA vs. poly-a RNA vs. other subsets Microarray Basics Imagine a one- spot microarray Target Target DNA is labeled and hybridized and washed. Finally, scan the chip. Feature Chip Probe 5
6 These Are SpoDed Arrays Robotically printed onto a series of glass slides using a robot with needle-heads. Product a characteristic gridding pattern and almost always use two samples simultaneously (two-colour). 6
7 Other Types of Arrays Inkjet Arrays Photolithographically generated arrays Bead arrays Protein/cell/lipid- arrays More niche applica2ons Not discussed here InkJet Arrays In 1999, HP spun off its life-science and measurement division into Agilent Technologies. The new company wanted to determine if printer technology could be harnessed to generate microarrays. 7
8 Inkjet Array Manufacture Involves Sequen7al Nucleo7de Addi7on Photolithographic Arrays Produced by the techniques for the produc2on of transistors. Mostly pioneered by the company Affymetrix, although other suppliers exist (e.g. Nimblegen) We will be working with Affymetrix data later, so we will walk through the pladorm in significant detail 8
9 The Glass Matrix Silination Addition of Linker molecule Photolithographic Synthesis Photolithographic mask 9
10 Deprotection Nucleotide Addition 10
11 Nucleotide Addition Nucleotide Addition 11
12 Capping Agents Final Chip Wafer Feature Chip 12
13 RNA Wash 13
14 RNA Wash An Affymetrix Microarray 14
15 We Can Change Those Mappings! Hybridized Chip Self- Assembling Bead- Arrays Produced by Illumina 3 μm silicon beads, randomly placed coated with ~10 5 iden2cal 25bp probes probes have iden2fying barcode (address) sequences Labeled cdna bead address probe 15
16 Comparing Array PlaOorms Platform Price Oligos Spotted cdna $ variable Data Quality + Bioinformatics Research +++ Affymetrix $$$ 25 bp Inkjet $$ ~70 bp Bead Arrays $$ ~25 bp ++ + I do not endorse specific platforms they all have their strengths and weaknesses Session Overview What are microarrays? What are microarrays used for? Molecular Aspects Biological Aspects Downstream Analyses How is microarray data analyzed? Workflow overview 16
17 What Are Microarrays Used For? Molecular DNA RNA Other DNA sequence (SNPs) DNA copy- number DNA capture (exome, ChIP) Tag quan2ta2on (gene2c screening) mrna abundances Splicing (quan2tate different isoforms) mrna degrada2on rates (half- life) mrna transla2on rates RNA capture (RIP) Protein arrays Cell based arrays Lipid arrays What Are Microarrays Used For? Biological RNA mrna abundances Splicing (quan2tate different isoforms) mrna degrada2on rates (half- life) mrna transla2on rates RNA capture (RIP) * Candidate Gene Identification * Pathway Analysis * Model Characterization * Classifiers/Predictive Models * Drug-Analysis (Dose/Time/Class) * Integration Analysis 17
18 What are microarrays? Session Overview What are microarrays used for? Molecular Aspects Biological Aspects Downstream Analyses (upcoming sessions: pathways & clinical integra2on) How is microarray data analyzed? Workflow overview Each Spot is a Probe Quantitation Spot Cy3 Cy5 Background A) Remove Noise Spot Quality Inter-array Intra-Array Spot List Significance Testing? Clustering Integration B) Extract Data 18
19 Step #1: Image Quan7ta7on Why? How? Difficulty? Research? Module 1 Quan2ta2ve vs. Qualita2ve Image Segmenta2on Image Segmenta7on 101: Find Grids 1. Find Grids 2. Find Spots 3. Spot Outline Module 1 19
20 Image Segmenta7on 101: Find Spots Key Step: Integrate Signal Across Array Image Segmenta7on 101: Challenges Problems: Stray Signal Missing Spots Gross Deformities Manual Validation 20
21 Research? Surprisingly, not much inves2ga2on This is probably a source of error in all studies Manual checking of spot- detec2on remains the norm Problema2c as studies & arrays get larger Quantitation Spot Cy3 Cy5 Background Spot Quality Inter-array Intra-Array Significance Testing Spot List Clustering Integration? 21
22 Step #2: Background Correc7on Why? Remove Stray Signal How? Model- based Difficulty? ++++ Research? ++ Spot Segmenta7on Signal??? Background 22
23 So what do we get? Background Intensity: BG Foreground Intensity: FG Isn t it simple? Signal = FG - BG NO! If BG > FG Then -ve Signal 0.1-2% of spots Why Might This happen? In 2001 two papers showed that empty spots have less signal than background Unbound spots correspond to low-expression genes Background Intensity: BG Foreground Intensity: FG Thus unbound spots are particularly prone to problems 23
24 So What to Do? Heavy- duty mathema2cal tools employed Three major models developed: Edwards log- linear Smyth normexp Kooperberg Bayesian The math is extremely advanced, so we ll skip that for now. Let s summarize the methods instead. Comparison Method Speed Accuracy Edwards NormExp Kooperberg Fast Slow Very Slow Good Better Best No strong criteria for selecting between these algorithms. 24
25 Quantitation Spot Cy3 Cy5 Background Spot Quality Inter-array Intra-Array Significance Testing Spot List Clustering Integration? Step 3: Spot Quality Why? How? Difficulty? Research? + Iden2fy artefacts Unknown 25
26 Spot- Weigh7ng A perfect spot is used normally in analysis Weight = 1 A poor spot is given less considera2on 0 < Weight < 1 Problem: How the heck do we calculate weights? A Few Approaches Mean- Median Correla2on Composite q- metrics è improve homotypic signal:noise But both fail some2mes, seemingly randomly. Do we really need this? 26
27 All from one good-quality array! But I use Affymetrix! (Or Agilent) (Or Nimblegen) (Or Other Commercial Supplier) 27
28 Okay, Let s See Some Affy Data 28
29 29
30 Those Three Were From A Spike- In Experiment Done by Affymetrix Themselves! 30
31 Module 1 Module 1 31
32 Spot Quality is An Issue, Regardless of PlaOorm Manual Flagging? Two studies show error rates of 5-20% Spot-Quality is a huge, unsolved problem. Most investigators ignore it. More bioinformaticians struggle with it. Then we ignore it too. 32
33 Quantitation Spot Cy3 Cy5 Background Spot Quality Inter-array Intra-Array Significance Testing Spot List Clustering Integration? Step 4: Intra- Array Normaliza7on Why? Balance channels Remove spa2al ar2facts How? Mul2ple robust algorithms Difficulty? ++ Research?
34 Within- Array Normaliza7on 1. Spa2al gradients 2. Channel- balancing 3. Intensity bias Are red and green equal in our starting sample? We Can Handle This! Spa2al Effects: Gaussian Spa2al Smoothing Intensity Effects: Loess Smoothing Combina2on Effects: Robust Splines All methods well-established 34
35 Quantitation Spot Cy3 Cy5 Background Spot Quality Inter-array Intra-Array Significance Testing Spot List Clustering Integration? Step 5: Inter- Array Normaliza7on Why? How? Difficulty? + Research? Balance arrays Mul2ple robust algorithms 35
36 Balancing Arrays Problem: Pipene error can lead to differen2al loading of sample between arrays Solu2on: Scale arrays Extremely easy to handle Scaling Has a Major Effect Intensity Before After p(i) 36
37 Quantitation Spot Cy3 Cy5 Background Spot Quality Inter-array Intra-Array Significance Testing Spot List Clustering Integration? We are on a Coffee Break & Networking Session 37
38 What Is BioConductor? Bioconductor is an open source, open development so4ware project to provide tools for the analysis and comprehension of high- throughput genomic data. - BioConductor website The vast majority of our analyses will use BioConductor code, but there are clearly non-bioconductor approaches. I ve outlined the general workflow. Each technology and applica7on has its own unique characteris7cs to consider. 38
39 Let s Define an Affymetrix- Specific Workflow Quantitation is done Spot Cy3 Cy5 according to Affymetrix Quantitation Background defaults with minimal user intervention. One-Channel array Spot Quality Significance Testing Inter-array Single-Channel array, so one simultaneous Intra-Array normalization procedure Typically ignored Spot List Clustering Integration? 39
40 Let s Collapse This a Bit And Re- Phrase Things.CEL Files Background Normalization ProbeSet Annotation Clustering Spot List Statistics Integration? 40
41 Arrays Can Become Outdated Gene defini2ons change The reference genome sequence gets finished Novel splice variants are found Errors are made in the ini2al design and remain present in all arrays made The Mask Produc7on Makes Affymetrix Designs Expensive To Change Photolithographic mask 41
42 Let s go Back to Pre- Processing What exactly is pre-processing (aka normalization)? Why do we do it? Sources of Technical Noise Where does technical noise come from? 42
43 More Sources of Technical Noise Any step in the experimental pipeline can introduce ar7factual noise Array design Array manufacturing Sample quality Sample iden2ty à sequence effects? Sample processing Hybridiza2on condi2ons à ozone? Scanner seongs Pre-Processing tries to remove these systematic effects 43
44 Always try to balance experimental groups. Important Note Pre-processing is never a substitute for good experimental design. This is not a course on statistical design, but a few basic principles should be mentioned. Biological replicates are preferable to technical replicates. If processing samples identically is not possible, include controls for processing-effects. Introducing Two Major Affymetrix Pre- Processing Methods The two most commonly used methods are: RMA = Robust Mul2- array MAS5 = Microarray Analysis Suite version 5 MAS5 has strengths & weaknesses Sacrifices precision for accuracy Can easily be used in clinical seongs RMA has strengths & weaknesses Sacrifices accuracy for precision Challenging to integrate mul2ple studies Reduces variance (cri2cal for small- n studies) RMA is bener accepted by journals and reviewers 44
45 We ll talk about the maths behind each method this agernoon, but first let s actually apply them to some real data! We are on a Coffee Break & Networking Session 45
Introduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationMeasuring gene expression (Microarrays) Ulf Leser
Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationBackground Correction and Normalization. Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy
Background Correction and Normalization Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Feature Level Data Outline Affymetrix GeneChip arrays Two
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationMicroarrays The technology
Microarrays The technology Goal Goal: To measure the amount of a specific (known) DNA molecule in parallel. In parallel : do this for thousands or millions of molecules simultaneously. Main components
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationMicroarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation
Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More informationGene Expression Data Analysis
Gene Expression Data Analysis Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu BMIF 310, Fall 2009 Gene expression technologies (summary) Hybridization-based
More informationGene expression analysis: Introduction to microarrays
Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is
More informationNormalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612
Normalization Getting the numbers comparable The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression
More informationIntroduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics
Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized
More information10.1 The Central Dogma of Biology and gene expression
126 Grundlagen der Bioinformatik, SS 09, D. Huson (this part by K. Nieselt) July 6, 2009 10 Microarrays (script by K. Nieselt) There are many articles and books on this topic. These lectures are based
More informationMoc/Bio and Nano/Micro Lee and Stowell
Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx
More informationIntroduction to Bioinformatics! Giri Narasimhan. ECS 254; Phone: x3748
Introduction to Bioinformatics! Giri Narasimhan ECS 254; Phone: x3748 giri@cs.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs11.html Reading! The following slides come from a series of talks by Rafael Irizzary
More informationThe essentials of microarray data analysis
The essentials of microarray data analysis (from a complete novice) Thanks to Rafael Irizarry for the slides! Outline Experimental design Take logs! Pre-processing: affy chips and 2-color arrays Clustering
More informationClones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization.
Terminologies Reporter: the nucleotide sequence present in a particular location on the array (a.k.a. probe) Feature: the location of a reporter on the array Composite sequence: a set of reporters used
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationIntegrative Genomics 1a. Introduction
2016 Course Outline Integrative Genomics 1a. Introduction ggibson.gt@gmail.com http://www.cig.gatech.edu 1a. Experimental Design and Hypothesis Testing (GG) 1b. Normalization (GG) 2a. RNASeq (MI) 2b. Clustering
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationFrom reads to results: differen1al expression analysis with RNA seq. Alicia Oshlack Bioinforma1cs Division Walter and Eliza Hall Ins1tute
From reads to results: differen1al expression analysis with RNA seq Alicia Oshlack Bioinforma1cs Division Walter and Eliza Hall Ins1tute Purported benefits and opportuni1es of RNA seq All transcripts are
More informationCanadian Bioinforma3cs Workshops
Canadian Bioinforma3cs Workshops www.bioinforma3cs.ca Module #: Title of Module 2 1 Module 3 Expression and Differen3al Expression (lecture) Obi Griffith & Malachi Griffith www.obigriffith.org ogriffit@genome.wustl.edu
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationDNA Microarray Technology
2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from
More informationCOS 597c: Topics in Computational Molecular Biology. DNA arrays. Background
COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step
More informationIntroduction to biology and measurement of gene expression
Introduction to biology and measurement of gene expression Statistical analysis of gene expression data with R and Bioconductor University of Copenhagen, 17-21 August, 2009 Margaret Taub University of
More informationPre processing and quality control of microarray data
Pre processing and quality control of microarray data Christine Stansberg, 20.04.10 Workflow microarray experiment 1 Problem driven experimental design Wet lab experiments RNA labelling 2 Data pre processing
More informationIntroduction to microarray technology and data analysis
Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationAFFYMETRIX c Technology and Preprocessing Methods
Analysis of Genomic and Proteomic Data AFFYMETRIX c Technology and Preprocessing Methods bhaibeka@ulb.ac.be Université Libre de Bruxelles Institut Jules Bordet Table of Contents AFFYMETRIX c Technology
More informationRNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
More informationDNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
More informationINTRODUCTION. The Technology of Microarrays January Hanne Jarmer
INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron
More informationExploration and Analysis of DNA Microarray Data
Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationBioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis PART II: Genome Analysis Chapter 7. DNA Microarrays 7.1 Motivation 7.2 DNA Microarray History and current states 7.3 DNA Microarray Techniques
More informationImage Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology
Image Analysis Lecture 3 Pre-Processing of Affymetrix Arrays Stat 697K, CS 691K, Microbio 690K 2 Affymetrix Terminology Probe: an oligonucleotide of 25 base-pairs ( 25-mer ). Based on Information from
More informationBioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.
Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand
More informationBackground Analysis and Cross Hybridization. Application
Background Analysis and Cross Hybridization Application Pius Brzoska, Ph.D. Abstract Microarray technology provides a powerful tool with which to study the coordinate expression of thousands of genes in
More informationPhilippe Hupé 1,2. The R User Conference 2009 Rennes
A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech
More informationHumboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture
Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization
More informationExpression summarization
Expression Quantification: Affy Affymetrix Genechip is an oligonucleotide array consisting of a several perfect match (PM) and their corresponding mismatch (MM) probes that interrogate for a single gene.
More informationMicroarray Data Analysis Workshop. Preprocessing and normalization A trailer show of the rest of the microarray world.
Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Preprocessing and normalization A trailer show of the rest of the microarray world Carsten Friis Media glna tnra GlnA TnrA C2 glnr C3 C5 C6
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationTowards an Optimized Illumina Microarray Data Analysis Pipeline
Towards an Optimized Illumina Microarray Data Analysis Pipeline Pan Du, Simon Lin Robert H. Lurie Comprehensive Cancer Center, Northwestern University Oct 01, 2007 Outline Introduction of Illumina Beadarray
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationMicroarrays & Gene Expression Analysis
Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed
More informationDNA Microarrays and Clustering of Gene Expression Data
DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);
More informationMicroarray pipeline & Pre-processing
Microarray pipeline & Pre-processing Solveig Mjelstad Olafsrud J Express Analysis Course November 2010 Some slides adapted from Christine Stansberg thank you Christine! The microarray pipeline The goal
More informationGene expression microarrays and assays. Because your results can t wait
Gene expression microarrays and assays Because your results can t wait A simple path from data to decision-making The power of expression microarrays Transcriptome-wide analysis can be complex. Matching
More informationWet-lab Considerations for Illumina data analysis
Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina
More informationCS-E5870 High-Throughput Bioinformatics Microarray data analysis
CS-E5870 High-Throughput Bioinformatics Microarray data analysis Harri Lähdesmäki Department of Computer Science Aalto University September 20, 2016 Acknowledgement for J Salojärvi and E Czeizler for the
More informationMICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
More informationComputing with large data sets
Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationIntroduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information
HELSINKI UNIVERSITY OF TECHNOLOGY LABORATORY OF COMPUTER AND INFORMATION SCIENCE Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information Jarkko Salojärvi Lecture slides by
More informationHow it All Works. Sample. Data analysis. Library Prepara>on. Sequencing
Library PREP How it All Works Extract DNA Fragment Sample Data analysis Sequencing Library Prepara>on Polymerase Chain Reaction Polymerase Chain Reaction Polymerase Chain Reaction Polymerase Chain Reaction
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationGene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome
Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
More informationRafael A Irizarry, Department of Biostatistics JHU
Getting Usable Data from Microarrays it s not as easy as you think Rafael A Irizarry, Department of Biostatistics JHU rafa@jhu.edu http://www.biostat.jhsph.edu/~ririzarr http://www.bioconductor.org Acknowledgements
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationToday s Topic: Microarrays. but first, student slides from HW
Today s Topic: Microarrays but first, student slides from HW Back to Microarrays (Reference: Zvelebil and Baum 2008, chap. 15) We refer specifically to DNA microarrays DNA: deoxyribonucleic acid microarray:
More informationIntroduction to DNA microarrays. DTU - January Hanne Jarmer
Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go Microarrays - The Concept Measure
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationMicroarray Data Analysis. Normalization
Microarray Data Analysis Normalization Outline General issues Normalization for two colour microarrays Normalization and other stuff for one color microarrays 2 Preprocessing: normalization The word normalization
More informationThe first and only fully-integrated microarray instrument for hands-free array processing
The first and only fully-integrated microarray instrument for hands-free array processing GeneTitan Instrument Transform your lab with a GeneTitan Instrument and experience the unparalleled power of streamlining
More informationGene Expression Analysis Superior Solutions for any Project
Gene Expression Analysis Superior Solutions for any Project Find Your Perfect Match ArrayXS Global Array-to-Go Focussed Comprehensive: detect the whole transcriptome reliably Certified: discover exceptional
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationDetermining Method of Action in Drug Discovery Using Affymetrix Microarray Data
Determining Method of Action in Drug Discovery Using Affymetrix Microarray Data Max Kuhn max.kuhn@pfizer.com Pfizer Global R&D Research Statistics Groton, CT Method of Action As the level of drug resistance
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center DNA Technologies & Expression Analysis Cores HT Sequencing (Illumina
More informationSTATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from
STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated
More informationNext Genera*on Sequencing II: Personal Genomics. Jim Noonan Department of Gene*cs
Next Genera*on Sequencing II: Personal Genomics Jim Noonan Department of Gene*cs Personal genome sequencing Iden*fying the gene*c basis of phenotypic diversity among humans Gene*c risk factors for disease
More informationLibrary construc.on (overviews and challenges)
Computa(onal Biology and Genomics Workshop April 18-22, 2016 Colorado State University Todos Santos Center Library construc.on (overviews and challenges) Aines Castro Prieto ainescastrop@gmail.com Content
More informationBioinformatics for Biologists
Bioinformatics for Biologists Microarray Data Analysis. Lecture 1. Fran Lewitter, Ph.D. Director Bioinformatics and Research Computing Whitehead Institute Outline Introduction Working with microarray data
More informationGENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationRNA Seq: Methods and Applica6ons. Prat Thiru
RNA Seq: Methods and Applica6ons Prat Thiru 1 Outline Intro to RNA Seq Biological Ques6ons Comparison with Other Methods RNA Seq Protocol RNA Seq Applica6ons Annota6on Quan6fica6on Other Applica6ons Expression
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationGene expression. What is gene expression?
Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationGENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists
More information1. Introduction Gene regulation Genomics and genome analyses
1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing
More informationFACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY
FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY K. L. Knudtson 1, C. Griffin 2, A. I. Brooks 3, D. A. Iacobas 4, K. Johnson 5, G. Khitrov 6,
More information