INTRODUCTION. The Technology of Microarrays January Hanne Jarmer

Transcription

1 INTRODUCTION The Technology of Microarrays January Hanne Jarmer

2 The Concept gene mrna gene specific DNA probes labeled target

3 Spotted arrays

4 High-density arrays micron features ~60 micron features 5-11 micron features

5 The spotting Coating glass slides Deposition of probes Post-processing Hybridization

6 The spotting

7

8

9 Spotted microarrays SAMPLE CONTROL mrna mrna cdna cdna Cy5-cDNA Cy3-cDNA

10 Spotted microarrays SAMPLE CONTROL mrna mrna cdna cdna Cy5-cDNA Cy3-cDNA

11 The Output Cy5 Cy3

12 Affymetrix GeneChip oligonucleotide array

13 Affymetrix GeneChip oligonucleotide array 11 to 20 oligonucleotide probes for each gene Expensive to make On-chip synthesis of 25 mers ~20,000 genes per chip High-quality data Up to 6.4 M features

14 The Chip 5-11 micron features

15 Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups

16 Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups

17 Photolithography in situ synthesis T T T

18 Photolithography in situ synthesis T T T A A A

19 The Eberwine Protocol

20 The Eberwine Protocol SAMPLE

21 The Eberwine Protocol SAMPLE RNA

22 The Eberwine Protocol SAMPLE RNA T7 70 C 10 min

23 The Eberwine Protocol SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min

24 The Eberwine Protocol SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase dsdna

25 The Eberwine Protocol SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase clean up dsdna dsdna

26 The Eberwine Protocol SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase T7 pol dsdna

27 The Eberwine Protocol SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase T7 pol 37 C 6 h dsdna + Biotin-labeled nucleotides

28 The Eberwine Protocol SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase T7 pol 37 C 6 h dsdna arna + Biotin-labeled nucleotides

29 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( )

30 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( )

31 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-sape IgG

32 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-sape IgG biotinylated anti-anti IgG

33 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-sape IgG biotinylated anti-anti IgG

34 Each gene is represented like this: PM MM - Perfect Match (PM) - MisMatch (MM) PM: MM: CGATCAATTGCACTATGTCATTTCT CGATCAATTGCAGTATGTCATTTCT

35 Roche-NimbleGen

36 Roche-NimbleGen High density: 70,000 to 2.1 M features Low design costs Probe length: mers Multi-well system Full service!

37 Photolithography - micromirrors micron features

38 Agilent

39 Agilent Density: K features No design fee Probe length: mers

40 The output Cyanine5 Cyanine3 Overlay

41 Ink-Jet Printing Resistor on/off - vapourizing liquid < 1 msec

42 Multi-well formats High Density Premium Whole Genome Replicate Features High Performance 244K Medium Density Premium Partial Genome Replicate Features 2 x 105K Low Density, Low Cost Whole/Partial Genome Single Probe Per Gene 4 x 44K 8 x 15K

43 Applications Gene expression SNP analysis ChIP-chip (detection of TF-binding sites) Comparative Genomic Hybridization (CGH) Whole genome tiling arrays

44 Comparative Genomic Hybridization Comparing two genomes

45 ChIP-chip ChIP = Chromatin Immuno Precipitation

46 SNP analysis Patients Association study Controls

47 The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression Index Calculation Normalization Comparable Gene Expression Data Statistical Analysis Fit to Model (time series) Advanced Data Analysis Clustering PCA Classification Promoter Analysis Meta analysis Survival analysis Regulatory Network

48 Coffee Break Be back at 10:30