PLEASE SCROLL DOWN FOR ARTICLE

Size: px
Start display at page:

Download "PLEASE SCROLL DOWN FOR ARTICLE"

Transcription

1 This article was downloaded by:[national Chung Hsing University] On: 8 November 2007 Access Details: [subscription number ] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales Registered Number: Registered office: Mortimer House, Mortimer Street, London W1T 3JH, UK Hemoglobin Publication details, including instructions for authors and subscription information: Hb Hekinan in a ese Subject: A T Substitution at Codon 27 of the α1-globin Gene Abolishes an HaeIII Site Hung-Chang Shih ab ; Mu-Chin Shih a ; Yu-Chang Chang a ; Ching-Tien Peng ac ; Tien-Jye Chang b ; Jan-Gowth Chang d a Department of Laboratory Medicine, China Medical University Hospital, Taichung, b Department of Veterinary Medicine, National Chung Hsing University, Taichung, c Department of Biotechnology and Bioinformatics, Asia University, Taichung, d Department of Laboratory Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Online Publication Date: 01 October 2007 To cite this Article: Shih, Hung-Chang, Shih, Mu-Chin, Chang, Yu-Chang, Peng, Ching-Tien, Chang, Tien-Jye and Chang, Jan-Gowth (2007) 'Hb Hekinan in a ese Subject: A T Substitution at Codon 27 of the α1-globin Gene Abolishes an HaeIII Site', Hemoglobin, 31:4, To link to this article: DOI: / URL: PLEASE SCROLL DOWN FOR ARTICLE Full terms and conditions of use: This article maybe used for research, teaching and private study purposes. Any substantial or systematic reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone is expressly forbidden. The publisher does not give any warranty express or implied or make any representation that the contents will be complete or accurate or up to date. The accuracy of any instructions, formulae and drug doses should be independently verified with primary sources. The publisher shall not be liable for any loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever caused arising directly or indirectly in connection with or arising out of the use of this material.

2 Hemoglobin, 31 (4): , (2007) Copyright Informa Healthcare USA, Inc. ISSN: print/ x online DOI: / LHEM X Hemoglobin, Vol. 31, No. 4, August 2007: pp. 1 6 SHORT COMMUNICATION Hb HEKINAN IN A TAIWANESE SUBJECT: A G T SUBSTITUTION AT CODON 27 OF THE a1-globin GENE ABOLISHES AN HaeIII SITE Hb H.-C. Hekinan Shih et in al. the ese Hung-Chang Shih, 1,2 Mu-Chin Shih, 1 Yu-Chang Chang, 1 Ching-Tien Peng, 1,3 Tien-Jye Chang, 2 and Jan-Gowth Chang 4 1 Department of Laboratory Medicine, China Medical University Hospital, Taichung, 2 Department of Veterinary Medicine, National Chung Hsing University, Taichung, 3 Department of Biotechnology and Bioinformatics, Asia University, Taichung, 4 Department of Laboratory Medicine, Kaohsiung Medical University Hospital, Kaohsiung, We recently observed a heterozygote for Hb Hekinan in a ese subject. The molecular lesion of Hb Hekinan is a substitution of G T at codon 27 of the a1-globin gene, which abolishes an HaeIII restriction enzyme site. Hb Hekinan [a27(b8)glu Asp, GAG GAC (a2)] has not been found in. This variant can be detected by high performance liquid chromatography (HPLC) but not by capillary or cellulose electrophoresis. Keywords Hb Hekinan, α1-globin gene, Codon 27, ese Hb Hekinan [α27(b8)glu Asp, GAG GAC (α2)] has been reported in Japanese, Thai, Chinese and Guyanan people (1 4). It is due to a substitution of a glutamic acid by an aspartic acid residue at position 27 of the α1- or α2-globin chain). We recently observed this variant in the heterozygous state in a ese subject. The subject was a 10-years-old boy admitted to the Department of Pediatric Hematology of China Medical University Hospital (Taichung, ) for anemia. The hemogram showed: Hb 9.9 g/dl, RBC Received 28 February 2007; accepted 6 June Address correspondence to Dr. Jan-Gowth Chang, Department of Laboratory Medicine, Kaohsiung Medical University Hospital, 100 Tzyou 1st Road, Kaohsiung 807, ; Tel.: ; Fax: ; jgchang@ms.kmuh.org.tw or Dr. Tien-Jye Chang, Department of Veterinary Medicine, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 404, ; Tel.: , Ext. 54; Fax: ; tjchang@dragon.nchu.edu.tw 495

3 496 H.-C. Shih et al /L, PCV L/L, MCV 72.9 fl, MCH 21.7 pg, MCHC 29.7 g/dl and ferritin 2.58 ng/ml. Electrophoresis of freshly prepared hemolysates in cellulose acetate at ph 8.6 or in capillary electrophoresis showed no remarkable change. On electrophoresis by automated high performance liquid chromatography (HPLC) (PRIMUS CLC 385; Primus Company, Kansas City, MO, USA), an abnormal peak that was distinguished from Hb A in the amount of 14.7% was found (Figure 1A). The abnormal hemoglobin (Hb) could not be detected by capillary electrophoresis (Figure 1B). The α1-, α2- and β-globin gene analyses were performed and DNA was isolated from white blood cells using standard methods. The α1-globin gene was specifically amplified with primers P1 (forward primer, 5 non coding area): 5 -CTC TTC TGG TCC CCA CAG AC-3 and P2 (reverse primer, 3 non coding area): 5 -AGG GGC AAG AAG CAT GGC CA-3, to amplify the whole coding region and two introns. The α2-globin gene was specifically amplified with primers P1 and P3 (reverse primer, 3 non coding area): 5 -CAG GAA GGG CCG GTG CAA GGA G-3, to amplify the whole coding region and two introns. The β-globin genes were amplified with primers P4 (forward primer, 5 non coding area): 5 -GCT TAC CAA GCT GTG ATT CC-3, and P5 (reverse primer, 3 non coding area): 5 -GGA CTT AGG GAA CAA AGG AAC C-3, to amplify the whole coding region and two introns. The polymerase chain reaction (PCR) conditions were as follows: the amplification was performed in 50 μl which consisted of 500 ng genomic DNA, 50 ng each of the primers (P1 + P2 or P1 + P3 or P4 + P5), 0.3% DMSO, 50 μm of each dntp, 1 PCR buffer and 2.5 units of Taq (A) HPLC HBA 82.8% (B) CE HBA 97.7% HBX 14.7% HBA 2 2.5% HBA 2 2.3% FIGURE 1 A) An abnormal peak was distinguished from Hb A by HPLC and amounted to 14.7% of the total Hb. B) The abnormal hemoglobin could not be detected by capillary electrophoresis.

4 Hb Hekinan in the ese 497 polymerase (Perkin Elmer Corporation, Norwalk, CT, USA), using 35 cycles of 2 min. at 94 C for denaturation, 2 min. at 60 C for annealing, and 3 min. at 72 C for extension, and a final extension of 5 min. at 72 C, using a Perkin Elmer Cetus PCR thermocycler. The PCR products were isolated and sequenced as described previously (5,6). In addition to primers P1, P2, P3, P4, and P5, the sequencing primers for the α-globin gene were as follows: P6 (reverse primer, intron 1): 5 -CAG GAC GGT TGA GGG TGG CCT-3, P7 (forward primer, intron 1): 5 -ACC CCA CCC CTC ACT CGC TT-3, P8 (reverse primer, intron 2): 5 -TGC GAG GAA GGC GCC ATC TC- 3 and P9 (forward primer, intron 2): 5 -GCA GAG GAT CAC GCG GGT TG-3. The sequencing primers for the β-globin genes were: P10 (reverse primer, intron 1): 5 -GGC AGA GAG AGT CAG TGC CTA-3, P11 (reverse primer, exon 2, near intron 2): 5 -CCT GAA GTT CTC AGG ATC CA-3 and P12: (forward primer, intron 2): 5 -TGC TAA TCA TGT TCA TAC CT-3. The results showed a G T substitution at the third base of codon 27 of α1-globin gene (GAG GAT) that resulted in the substitution of a glutamic acid for an aspartic acid residue (Figure 2A). This mutation abolishes an HaeIII restriction enzyme site. We further amplified the mutation area using primers (P1 + P6), and the PCR products were digested with HaeIII. The results are shown in Figure 2B. Hb Hekinan co-migrates with Hb A on cellulose acetate electrophoresis and capillary electrophoresis, and is difficult to distinguish from Hb A by (A) Normal (B) Codon bp 73bp 48bp 65bp 200bp 100bp N M HaeIII FIGURE 2 The results of direct sequencing of the α1-globin gene showed a G T substitution at codon 27. Upper case: normal control; lower case: the variant. The results of restriction enzyme HaeIII digestion of PCR products showed that the patient (lane 3) and positive control (lane 1) had fragments of 121 and 65 bp, respectively (the18 bp fragment was not visible), and the normal control (lane 2) had fragments of 73, 65 and 48 bp, respectively (the 18 bp fragment was not visualized). M: 100 bp ladder.

5 498 H.-C. Shih et al. these methods. The HPLC procedure using a weak cation exchange material with polyaspartic acid can differentiate these two Hbs. The Hb variant can be confirmed by either sequencing analysis of the α1-globin gene product or HaeIII digestion of the amplified α1-globin gene product. ACKNOWLEDGMENTS This study was supported by a grant from China Medical University Hospital, (DMR ). REFERENCES 1. Harano T, Harano K, Imai N, Ueda S, Seki M. An electrophoretically silent hemoglobin variant, Hb Hekinan [α27(b8)glu Asp] found in a Japanese. Hemoglobin 1988; 12(1): Merault G, Keclard L, Desfontaines L, Saint-Martin C, Blouquit Y, Rosa J, Galacteros F. Hemoglobin Hekinan [α 2 27(B8)Glu Aspβ 2 ] detected in Guyana. Hemoglobin 1989; 13(4): Zhao W, Wilson JB, Webber BB, Kutlar A, Tamagnini GP, Kuam B, Huisman THJ. Hb Hekinan observed in three Chinese from Macau; identification of the GAG GAT mutation in the α1-globin gene. Hemoglobin 1990; 14(6): Fucharoen S, Changtrakun Y, Ratanasiri T, Fucharoen G, Sanchaisuriya K. Complex interaction of Hb Hekinan [α27(b8)glu Asp] and Hb E [β26(b8)glu Lys] with a deletional α-thalassemia 1 in a Thai family. Eur J Haematol 2003; 70(5): Chang J-G, Yang T-Y, Perng L-I, Wang N-M, Peng C-T, Tsai C-H. Hb Siriraj: a G A substitution at codon 7 of the β-globin chain creates an MboII cutting site. Hemoglobin 1999; 23(2): Chang J-G, Liu H-C, Shih M-C, Liu S-C, Chan W-L, Tsai F-J. Unstable Hb Perth in a ese subject: a T C substitution at codon 32 of the β-globin gene creates an MspI site. Hemoglobin 2002; 26(1):91 94.

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013 Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription

More information

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known

More information

Y-chromosomal haplogroup typing Using SBE reaction

Y-chromosomal haplogroup typing Using SBE reaction Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G

More information

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

More information

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

More information

Hes6. PPARα. PPARγ HNF4 CD36

Hes6. PPARα. PPARγ HNF4 CD36 SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa

More information

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis 1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic

More information

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

More information

Disease and selection in the human genome 3

Disease and selection in the human genome 3 Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression

More information

Supplementary Figure 1A A404 Cells +/- Retinoic Acid

Supplementary Figure 1A A404 Cells +/- Retinoic Acid Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure

More information

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below). Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very

More information

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%) SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian

More information

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G

More information

PCR analysis was performed to show the presence and the integrity of the var1csa and var-

PCR analysis was performed to show the presence and the integrity of the var1csa and var- Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc

More information

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain

More information

NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN

NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer

More information

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table

More information

Supporting Online Information

Supporting Online Information Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical

More information

Legends for supplementary figures 1-3

Legends for supplementary figures 1-3 High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik

More information

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer

More information

Gene synthesis by circular assembly amplification

Gene synthesis by circular assembly amplification Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary

More information

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Supplementary Information. Construction of Lasso Peptide Fusion Proteins Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and

More information

Supplemental material

Supplemental material Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,

More information

Supporting Information

Supporting Information Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT

More information

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

II 0.95 DM2 (RPP1) DM3 (At3g61540) b Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,

More information

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)

More information

for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides

for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon

More information

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3 Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp

More information

MacBlunt PCR Cloning Kit Manual

MacBlunt PCR Cloning Kit Manual MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).

More information

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were 1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription

More information

Det matematisk-naturvitenskapelige fakultet

Det matematisk-naturvitenskapelige fakultet UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday

More information

NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples

NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples VERSION 2.0 SUMMARY This procedure describes the use of nested Sequence-Based

More information

SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING

SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp

More information

ORFs and genes. Please sit in row K or forward

ORFs and genes. Please sit in row K or forward ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms

More information

Sequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps

Sequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps Supporting information Sequencing of DNA lesions facilitated by site-specific excision via base excision repair DNA glycosylases yielding ligatable gaps Jan Riedl, Aaron M. Fleming, and Cynthia J. Burrows*

More information

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas

More information

Multiplexing Genome-scale Engineering

Multiplexing Genome-scale Engineering Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt

More information

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko

More information

Dierks Supplementary Fig. S1

Dierks Supplementary Fig. S1 Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F

More information

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells

More information

Lecture 11: Gene Prediction

Lecture 11: Gene Prediction Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are

More information

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

Table S1. Bacterial strains (Related to Results and Experimental Procedures) Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)

More information

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short

More information

2

2 1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene

More information

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+ ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*

More information

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification. RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C

More information

Lecture 19A. DNA computing

Lecture 19A. DNA computing Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different

More information

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB

More information

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is

More information

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC

More information

Supporting Information

Supporting Information Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves

More information

Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB

Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURBO DNA-free Kit (Ambion). One µg of total RNA was reverse

More information

An engineered tryptophan zipper-type peptide as a molecular recognition scaffold

An engineered tryptophan zipper-type peptide as a molecular recognition scaffold SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening

More information

11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11

11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11 11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In

More information

Homework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity

Homework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten

More information

PCR-based Markers and Cut Flower Longevity in Carnation

PCR-based Markers and Cut Flower Longevity in Carnation PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso

More information

Table S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes

Table S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes Supplementary Table and Figures for Structural Basis for the Enantiospecificities of R- and S-Specific Phenoxypropionate/α-Ketoglutarate Dioxygenases by Tina A. Müller, Maria I. Zavodszky, Michael Feig,

More information

SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide

SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide former/ working Description a designation Plasmids pes213a b pes213-tn5

More information

Supplemental Table 1. Primers used for PCR.

Supplemental Table 1. Primers used for PCR. Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT

More information

A netlike rolling circle nucleic acid amplification technique

A netlike rolling circle nucleic acid amplification technique Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2014 Supplementary Information A netlike rolling circle nucleic acid amplification technique Xiaoli Zhu,

More information

CELLULAR & MOLECULAR BIOLOGY LETTERS Received: 30 September 2013 Volume 19 (2014) pp

CELLULAR & MOLECULAR BIOLOGY LETTERS  Received: 30 September 2013 Volume 19 (2014) pp CELLULAR & MOLECULAR BIOLOGY LETTERS http://www.cmbl.org.pl Received: 30 September 2013 Volume 19 (2014) pp 277-283 Final form accepted: 04 April 2014 DOI: 10.2478/s11658-014-0192-6 Published online: May

More information

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores. 1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction

More information

A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion,

A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion, TITLE A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion, Survival, and Cancer Cell Behaviors AUTHORS Carolyn R. Shurer *, Marshall J. Colville *, Vivek K. Gupta,

More information

S4B fluorescence (AU)

S4B fluorescence (AU) A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000

More information

Protein Structure Analysis

Protein Structure Analysis BINF 731 Protein Structure Analysis http://binf.gmu.edu/vaisman/binf731/ Iosif Vaisman COMPUTATIONAL BIOLOGY COMPUTATIONAL STRUCTURAL BIOLOGY COMPUTATIONAL MOLECULAR BIOLOGY BIOINFORMATICS STRUCTURAL BIOINFORMATICS

More information

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA

More information

SUPPORTING INFORMATION FILE

SUPPORTING INFORMATION FILE Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature11496 Cl. 8 Cl. E93 Rag1 -/- 3H9 + BM Rag1 -/- BM CD CD c-kit c-kit c-kit wt Spleen c-kit B22 B22 IgM IgM IgM Supplementary Figure 1. FACS analysis of single-cell-derived pre-b cell clones.

More information

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa

More information

Appendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their. Amplified cdna (base pairs) P1-hyg P2-neo All progeny A A

Appendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their. Amplified cdna (base pairs) P1-hyg P2-neo All progeny A A Supplementary information Appendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their double drug resistant progeny (ABI 377). Primer set a,b Amplified cdna (base pairs) P1-hyg P2-neo All progeny

More information

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated

More information

The B1 Protein Guides the Biosynthesis of a Lasso Peptide

The B1 Protein Guides the Biosynthesis of a Lasso Peptide The B1 Protein Guides the Biosynthesis of a Lasso Peptide Shaozhou Zhu 1,2, Christopher D. Fage 1, Julian D. Hegemann 1, Andreas Mielcarek 1, Dushan Yan 1, Uwe Linne 1 & Mohamed A. Marahiel*,1 1 Department

More information

Supporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy

Supporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Supporting Information Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Agata Olszewska, Radek Pohl and Michal Hocek # * Institute of Organic

More information

Dynamic enhancer-gene body contacts during transcription elongation

Dynamic enhancer-gene body contacts during transcription elongation Dynamic enhancer-gene body contacts during transcription elongation Kiwon Lee, Chris C.-S. Hsiung,, Peng Huang, Arjun Raj, *, and Gerd A. Blobel Division of Hematology, The Children s Hospital of Philadelphia,

More information

Supporting Information

Supporting Information Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting

More information

www.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations

More information

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010 Engineering D66N mutant using quick change site directed mutagenesis Harkewal Singh 09/01/2010 1 1- What is quick change site directed mutagenesis? 2- An overview of the kit contents. 3- A brief information

More information

-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and

-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and Supplementary Materials Supplementary Figure 1: Myopia induction was performed using uniocular -10 and -15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and results at 2, 4 and

More information

National PHL TB DST Reference Center PSQ Reporting Language Table of Contents

National PHL TB DST Reference Center PSQ Reporting Language Table of Contents PSQ Reporting Language Table of Contents Document Page Number PSQ for Rifampin 2-6 Comparison table for rpob Codon Numbering 2 rpob mutation list (new numbering system) 3-5 rpob interpretations 6 PSQ for

More information

SUPPLEMENTARY MATERIALS

SUPPLEMENTARY MATERIALS SUPPLEMENTARY MATERIALS Supplementary Table S1: Water sampling sites in Brisbane River and their characteristics Sampling sites GPS coordinates Site characteristics Suspected source of fecal pollution

More information

BioInformatics and Computational Molecular Biology. Course Website

BioInformatics and Computational Molecular Biology. Course Website BioInformatics and Computational Molecular Biology Course Website http://bioinformatics.uchc.edu What is Bioinformatics Bioinformatics upgrades the information content of biological measurements. Discovery

More information

Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit

Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit Mariko Suzuki 1, Saki Kondo 1, Manabu Yamasaki 2, Norie Matsuda 2, Akio Nomoto 2, Tetsuro

More information

Supplementary Information

Supplementary Information Supplementary Information Microbead-based biomimetic synthetic neighbors enhance survival and function of rat pancreatic β-cells Wei Li, a Samuel Lee, b Minglin Ma, a, f Soo Min Kim, b Patrick Guye, c

More information

Fractionation and Characterization of Waxes A. K. Gupta a ; K. M. Agrawal a ;D. Severin b a

Fractionation and Characterization of Waxes A. K. Gupta a ; K. M. Agrawal a ;D. Severin b a This article was downloaded by: [CSIR ejournals Consortium] On: 25 May 2010 Access details: Access Details: [subscription number 919661628] Publisher Taylor & Francis Informa Ltd Registered in England

More information

evaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the

evaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure

More information

Yeast BioBrick Assembly (YBA)

Yeast BioBrick Assembly (YBA) Yeast BioBrick Assembly (YBA) Standardized method for vector assembly of BioBrick devices via homologous recombination in Saccharomyces cerevisiae Martin Schneider, Leonard Fresenborg, Virginia Schadeweg

More information

Additional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name

Additional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name 1 2 3 Additional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name Scientific name Accession number Accession number (introns) Codons

More information

Engineering Escherichia coli for production of functionalized terpenoids using plant P450s

Engineering Escherichia coli for production of functionalized terpenoids using plant P450s Supplementary Information for Engineering Escherichia coli for production of functionalized terpenoids using plant P450s Michelle C. Y. Chang, Rachel A. Eachus, William Trieu, Dae-Kyun Ro, and Jay D. Keasling*

More information

Codon Bias with PRISM. 2IM24/25, Fall 2007

Codon Bias with PRISM. 2IM24/25, Fall 2007 Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide

More information

Supplementary Material and Methods

Supplementary Material and Methods Supplementary Material and Methods Synaptosomes preparation and RT-PCR analysis. Synaptoneurosome fractions were prepared as previously described in 1. Briefly, rat total brain was homogenized in ice-cold

More information