cdna Cloning of Porcine Transforming Growth mrnas
|
|
- Melinda Pitts
- 6 years ago
- Views:
Transcription
1 THE JOURNAL OF BOLOGCAL CHEMSTRY Vol. 263, No. 3, ssue of December 5, pp ,1988 Printed in U. S.A. cdna Cloning of Porcine Transforming Growth mrnas EVDENCE FOR ALTERNATE SPLCNG AND POLYADENYLATON* (Received for publication, February 19, 1988) Paturu Kondaiah, Ellen Van Obberghen-Schilling, Robert L. Ludwig, Ravi DharS, Michael B. Sporn, and Anita B. Roberts From the Laboratory of Chemopreuention and $Laboratory of Molecular Virology, National Cancer nstitute, National nstitutes of Health, Bethesda, Maryland Most eukaryotic cells encode principally a 2.5-kilo- present evidence for multiple mechanisms of transcriptional base (kb) transforming growth factor (TGF)-Bl regulation of the porcine TGF-Pl gene, resulting in the genmrna. However, we have found two major TGF-Bl eration of several different mrnas by means of alternative RNA species, 3.5 and 2.5 kb long, in porcine tissues. splicing and selection of poly(a) sites. The 3.5-kb species has a longer 3"untranslated sequence generated by the selection of an alternate pol- EXPERMENTAL PROCEDURES yadenylation site. There is a 117-nucleotide sequence within this unique 3' region, which is similar to the RNA Extraction and Northern Blot Analysis-RNAs from the PRE-1 repetitive sequence of unknown function, re- peripheral blood lymphocytes and other tissues of a miniature swine (13) were extracted as described previously (1). Poly(A)+ RNA was ported earlier in the porcine genome. We have also prepared by selection on an oligo(dt)-cellulose column (15). RNA cloned and characterized an alternately spliced mrna electrophoresis, blotting, and hybridizations were done essentially as species specific for the TGF-B1 gene, in which exons described (16) except that Nytran membrane (Schleicher & Schuell) V and V of the corresponding human TGF-81 gene are was used in place of nitrocellulose. Washes were carried out in 2 X deleted. The nucleotide sequence of this cdna clone SSC, 0.1% SDS at room temperature followed by 0.1 X SSC, 0.1% predicts a putative precursor protein of 256 amino SDS at 65 " Some blots were also hybridized and washed with an acids; the N-terminal211 amino acids of this putative alternate procedure (17). An oligonucleotide probe was hybridized in protein are identical to the TGF-B1 precursor protein 6 X SSC, 10 X Denhardt's solution, 1% glycine, and 250 pg/ml salmon (exons, 11, and 11 of the human TGF-B1 gene), but sperm DNA at 2 "C and washed in 3 X SSC and 0.1% SDS at 65 " the C-terminal 5 amino acids are distinct, due to a Construction of cdna Library and Screening-A porcine cdna library was constructed by the method of Okayama and Berg (18,191 frameshift in the translation of exons V and V. n using poly(a)+ RNA from lymphocytes and a dt-tailed linear pcdvl addition we provide data for the existence of other plasmid as vector (obtained from Pharmacia LKB Biotechnology mrna species generated in a tissue-specific manner nc.). The library was screened essentially as described previously either by alternate splicing orbyheterogeneous 5' (16) using a 32P-labeled single-strand probe of 218 nucleotides in the leader sequences. mature coding region of the human TGF-01 cdna (2) described elsewhere (5). Transforming growth factor-pl (TGF-Pl)' is a homodimeric protein of Mr 25,000 synthesized by most eukaryotic cells. t plays a critical role in embryogenesis and tissue repair and has been shown to modulate the growth, differentiation, and function of many cultured cells (1). Each chain of TGF- Dl is first synthesized as a 390-amino acid precursor protein and later cleaved to generate the C-terminal mature protein of 112 amino acids which is identical in all the known species with the exception of a single amino acid change in murine TGF-01 (2-6). The human TGF-01 RNA is coded by 7 exons (7). Thus far little is known about the specific factors involved in the regulation of TGF-P1 gene expression; however, it has been shown that TGF-01 itself induces its own mrna expression in both normal and transformed cells (8). Recently it has been shown that the genes of three unrelated growth factors, the A chain of platelet-derived growth factor, colony-stimulating factor 1, and insulin-like growth factor 1, can each generate different protein products by alternative splicing of their precursor RNAs (9-12). n this report we * The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S. Section 173 solely to indicate this fact. The abbreviations used are: TGF-01, transformingrowth factor- 01; kb, kilobase(s); SDS, sodium dodecyl sulfate; bp, base pair(s) Sequence Determination-The DNA sequence of the clones on both strands was established by the dideoxy chain termination method (20) after subcloning restriction fragments into M13 vectors (21). M13 universal primer and synthetic primers were used when necessary. Sequence ambiguities were resolved by using dtp in place of dgtp in combination with the Klenow fragment of DNA polymerase (Boehringer Mannheim), avian myeloblastosis virus-reverse transcriptase (B), and Sequenase (United States Biochemicals). Nuclease S Mapping-Nuclease S1 mapping of RNAs was performed on 75 pgof total RNA using 30,000 cpm of the probe by annealing at 55 "C and digesting at 37 " The procedure was as described earlier (22). The probe was a 1.26-kb primer-extended single-stranded DNA (Fig. 3C), made essentially as described (5), using an M13mp18 construct having an insert from ptgf(333of about 710 bp from the Sac1 site to the Puu site at the 3' end. The primer (from nucleotide 1998 to 201 of ptgfp33) was labeled at the 5' end with [Y-~'P]ATP using T polynucleotide kinase, extended by Klenow polymerase and dntps, and subsequently digested with Nae, at a restriction site present 560 bp upstream of the polylinker. The S1 nuclease reaction products were resolved on a 5% denaturing polyacrylamide gel essentially as described (16). RESULTS AND DSCUSSON Transcriptional regulation of eukaryotic genes is highly complex and can be mediated through selection of promoters, enhancers, specific transcriptional factors, splicing patterns, and polyadenylations. The role of alternate splicing of precursor RNA in the generation of multiple proteins in eukaryotes has been reported for several genes, and many models have been proposed for the patterns of alternate splicing of
2 1831 Porcine TGF-Pl and Alternate Splicing o Kbp r FG. 1. A, diagram of porcine TGF- 01 cdna clones. Schematic representation of porcine TGF-pl cdnas approximately to scale beginning with the most upstream nucleotide of ptgfp9, shown on top. Roman numerals represent the exon numbers in the corresponding human TGF-p1 gene (7). ATTAAA and AATAAA represent the polyadenylation signals. Translational start (ATG) and stop (TGA) codons are shown. The deletion in clone ptgfp9 (exons V and V) is represented by joining exons 111 and V. The G tracts represent the 5 end of the clone. B, intron-exon structure of the human TGF-pl gene. Schematic representation of the published human TGF-01 gene intron and exon structure (7). The translational start (ATG) and stop (TGA) codons and potential polyadenylation signals are shown in the diagram. Exons are shown as boxes and numbered in Roman numerals; introns are represented by split lines. C, composite nucleotide sequence of clones, ptgfp33, ptgfp18, and ptgfp9, and deduced amino acid sequence of ptgfp33. The beginning of each clone is depicted above its respective nucleotide. Nucleotides are numbered from the first nucleotide of the clone with the longest 5 end (ptgfp9) to the last nucleotide of the clone with the longest 3 end (ptgfp18). Amino acids are numbered on top of the sequence. An asterisk (*) represents the end of clones ptgfp33 and ptgfp9. The polyadenylation signal sequences (ATTAAA, AATAAA) are underlined. The overlined area represents the 112 amino acid residues of mature TGF-61. The heavy underline of the sequence represents the deletion in the clone ptgfp9 (corresponding to exons V and V). 1 represents exon junctions. The exon numbers are depicted in roman numerals. The PRE-1 repeat sequence is from position 297 to ptgffi 18 TGA ptgffi9 GGGGG-/ ATG 73 CTAGGCCCCCGGCCCGGGGCAGGGGGGACGCCCCCTCCGGGGCACCCCCCGGCTCGGAGCCGCCTGCGGGGCCAGCCTCAGCCA~GAGGAGGMGAAGCCGCCGAGGAGCAGCCCGA 192 GGCCCCAGGGTCTCAGGCCAGCCGCGCCGCCCCCGCCGCCGCCGCCGCCGCCGCTGCGGGGAGGAGGGGGAGGAGGAGCGGGAGGAGGGACGAGCTGGTTGGGAGMGAGGAAAAMAG 311 TTTTGAGACTTTTCCGCTGCCGCTGGGAGCCCGAGGCGCGGGGACCGTTCGCGCAGCGCTGCCCCGCGAGGCAGGACTTGGGGACCCCAGACCGCACCCTACCACCGCCTCGGACGCTT 30 GCTCCCTCCCGCCC~C~TGCGCGGCGTTCCCTAGGTGCCCCCAT~CCGGACCTGCCGTCTGGAGCCGCAAACCCGACTCCCGC~GACTTGACCCCAAAGCTCGGGCGCACCCCCCTG 59 CACACTTCCCCACT~T~AGCCTCTCTGCTGAGCCCCTGCGCATCCMGGACCCTTCTCGGATCCGGGAGACGGMTCTGTCTCAGACCTGCCTCAGCTTTCCTATTCMGACCACCCAC M8 CTCTGGTACCAGATCTCGCCCATCTCGGTTTTTTCCGTAGGATACCGAGMCCCACCCATCAGAGCCTCCCTTCCACCTCTGCTCCTCCGTTCTCCCTGAGAGCCTCMCTTCCCTCCC 787 ACCCCAGATCCTCCTACCTTTTCTGGGGAGACCCCTCAGCCCCTGTAGGGGCGGGGCCTCCCTCTTCCTACCCCAGCCGGCTCGCACTCTCGGCTGTGCCGGGGGGCGCCGCCTCCCCC 1 25 Met Pro Pro Ser Gly Leu Arg Leu Leu Pro Leu Leu Leu Pro Leu Leu Trp Leu Leu Val Leu Thr Pro Gly Arg Pro Ala Ala Gly Leu 906 ATC CCG CCTCG GGG CTG COG CTC TTG CCG CTG CTG CTG CCC CTG CTG TGG CTG CTA GTG ClC ACG CCT GGC CGG CCG GCC GCC GGA CTG 50 Ser Thr Cys Lys Thr le Asp Met Glu Leu Val Lys Arg Lys Arg le Glu Ala le Arg Gly Gln le Leu Ser Lys Leu Arg Leu Ala 996 TCC ACC TCC M G ACC ATC GAC ATG GAG CTG GTG M C CGG M C CCC ATC GAG GCC AT1 CGt GGC CAC ATT CTG TCC M G CTT CGG CTC GCC 75 Ser Pro Pro Ser Gln Gly Asp Val Pro Pro Gly Pro Leu Pro Gu Ala Val Leu Ala Leu Tyr Asn Ser Thr Arg Asp Arg Val Ala Cly 1086 AGC CCC CCG AGC CAC CGG GAC GTG CCG CCC GGC CCG CTG CCT GAG GCC GTA CTC GCT CTT TC M C ACT ACC CGC GAC CGG GTA GCC GGG 100 p ptgfr18 1 Glu Ser Val Glu Pro Clu Pro Glu Pro Glu Ala Asp Tyr Tyr Ala Lys Glu Val Thr Arg Val Leu Met Val Glu Ser Gly Asn Gln le 1176 GAA ACT GTC G M CCG GAG CCC GAG CCA GAG GCG GAC TAC TAC GCC M C GAG GTC ACC CGC GTG CTA ATC CTG GAA AGC GGC AAC CA ATC Tyr Asp Lys Phe Lys Cly Thr Pro His Ser Leu Tyr Met Leu Phe As Thr Ser Glu Leu Arg Clu Ala Val Pro Glu Pro Val Leu Leu 1266 TAT GAT AAA TTC AAG GGC ACC CCC CAC AGC TTA TAT ATG CTG TTC AAC ACG TCG GAG CTC CGG G M GCC GTC CCG GAA CCT GTA TTG CTC E 175 Ser Arg Ala G Leu Arg Leu Leu Arg Leu Lys Leu Lys Val Clu Gln His Val Glu Leu Tyr Cln Lys Tyr Ser Asn Asp Ser Trp Arg 1356 TCT CGG GCA GAG CTG CGC CTC CTC AGG CTC AAG TTA AM GTC GAG CAG CAC GTG GAG CTA TAC CAG AAA TC AGC M T GAT TCC TGG CGC 200 Tyr Leu Ser Asn Arg Leu Leu Ala Pro Ser Asp Ser Pro Glu Trp Leu S ~ Phe Asp Val Thr Gly Val Val Arg Gln Trp Leu lhr Arg 16 TC CTC AGC M C CGC CTG CTG GCC CCC ACT GAC TCA CCG GAG TGG CTG TCC TTT GAT GTC ACC GGA GTT GTG CGG CAG TGG CTG ACC CBC x 225 E& Arg Glu Ala le Glu Gly Phe Arg Leu Ser Ala His Cys Ser Cys Asp Ser Lys Asp Asn Thr Leu His Val Glu le Asn Gly Phe Asn 1536 AGA GAG CCT ATA GAG GGT TTT CCC CTC ACT GCt CAC TGT TCC TCT GAC ACC AAA GAT M C ACA CTC CAC GTC G M AT1 LAC GGG 1TC AAT 250 Ser Gly Arg Arg Gly Asp Leu Ala Thr le His Cly Met Asn Arg Pro Phe Leu Leu Leu Met Ala Thr Pro Leu Clu Arg Ala Gln His 1626 TCT GGC CGC CGG GGT GAC CTG CCC ACC ATT CAC GGC ATG M C CGC CCC TTC CTG CTC CTC ATC GCC ACC CCG CTG GAG AGG GCC CAG CAC 275 Y & 300- Leu His Ser Ser Arg H i s m A l a Leu Asp Thr Asn Tyr Cys Phe Ser Ser Thr Glu Lys Asn Cys Cys Val Arg Gln Leu lyr le 1716 CTG CAC ACC TCt CCC CAC CGC CGA GCC CTG GAT ACC M C TC TGC TTC AGC TCC ACG GAG AAG M C TGC TGC GTG CGG CAG CTt TAC AT1 325 Asp Phe Arg Lys Asp Leu Gly Trp Lyr Trp le His Glu Pro Lys Cly Tyr His Ala Asn Phe Cys Leu Gly Pro Cys Pro Tyr le Trp 1806 CAC TTC CCG M G GA CTG GGC TCG M G TGG ATT CAT CM CCC AAG GGC TAC CAT GCC AAT TTC TGC CTG GGG CCC TGT CCC TAC ATC TGG = = 350 Ser Leu Asp Thr Gln Tyr Ser Lys Vel Leu Ala Leu Tyr Asn Gln His A m Pro Cly Ala Ser Ala Ala Pro Cys Cys Val Pro Gln Ala 1896 ACC CTA GAC ACT CAC TAC AGC AA GTC CTG GCT CTG TC M C CAG CAC AAC Ctt GGC GCC TCC GCG GCG CCG TGC TCC GTG CCG CAG GCG Leu Glu Pro Leu Pro le Val Tyr Tyr Val Gly Arg Lys Pro Lys Val Glu Gln Leu Ser Asn Met 1le Val Arg Ser Cys Lye Cyr Ser 1986 CTG GAG CCA CTG CCC ATC GTG TC TC GTG GGC Ctt AAG CCC AAG GTG GAG CAC CTG TCC AAC ATG ATC GTG CG TCC TGC AAG 1GC AGC 2076 TGA GCCCCCCCCCCGCCCACAGCCCCGCCCACCCGGCAGGCCCGGCCCCACCCCCGCCCGCCTCACCGGGGCTGTATTTMGGACATCGTGCCCCMGCCCACTTGGGATCG~ 219 GGTGGAGAGAGCXCTGGGTCTCCGTGTGTTGGGCACCTGACTGGGGTCTTCCTTCGGACGTTACCGGACCCCCACTCCCAGCCTCCG~CTGCCTCCGCCTGTGTCTGTCCACCA 2313 TTCTTCCTCCTCCTCATGCAMCGCGTTCCTTGAGCAGGTACTCCTGGTGMClCTACTTAGATTTACTTACTGAGCATCTTGGACClTATCCTGMTGCCTTATATTMTTAACTCAT 232 TTMCCACCATMCAMGtTMGGGACTCT~TMCACCCACTTT~GWMCGGMGCTGGAGTTTCCATTGTGGCTCAGTGGTMCCTACCCGACTGGTATCCTTGAAGACA 2551 CAGGTTCMTCCCTGGCCCTGTTCTGTMGTTAAAGGTCCGGCTGTGGCAGCTGTGGTATAGGCCGGCCAGCTGTCCMCATCGTGCGTTCCTCGMGTGCAGCTGAGCTCCGATTTAA 2670 CCCCTAGCCTCGGMCTTCCATATGTCTCAGGTGCGGCCCT~GAC~G~GGMG~GCCCATAGTGGTTMGGGMTMTTCCTGCCCACCM~CCTGCTT~CGG 2789 CTTTCTCGTGGGGAGACAGACATAGCAAAGTTGTGTG~CAGGMGGCAGTGTGGGTCAGAGAGGGCTTTGGGAGGTGGGAGGGCTTCTTG~GGAGGTGGCACCTGGGCCTTGAAG 2908 GMGCCMWMGCAGCCTACCGGAGCATGGGGGAGGGTGTTCATGGTAGGAGGACMGCAMGTCCTGGMGTGMGATGMTTTGGGGTGAGCTACACCGGCGGGMAGAGGCCA 3027 GTGCGGTTGGMGGGAGGGGCMGGGG~GTMTMCAGTTCTCCAGGCTAGGTATGGAGCTACTAGCTCMGGCATTCTTCCCACAGCCCAGCA~CAGAGGTTGTTAMCTAT 316 TGCCCTCCAGGCACATTCTGACCCGCTGCCTGTTTCTGTAM~GTTTTATTGGAGMC~A
3 Porcine TGF-P and Alternate Splicing A ,*. ~ ~ ~. i_ s- 1% a %180- ( Origin % Nae M13mp18 Hinc 1 Hind ll Sac EcoR Probe,., j ;695NT- 593 *75NT :+397NT- FG.2. Northern blot analysis of porcine cells and tissues showing TGF-Dl-specificmRNA bands. Each lane has 15 pg of total RNA except in lune 1 (lymphocyte), which has 5 pgof total RNA. Panel A, hybridization to a single strand probe in the mature coding region of TGF-Pl cdna andpanel B, hybridization to a nicktranslatedfragment from position 2087 to 2601 derived from ptgfb18. Lanes: 1, lymphocytes; 2, dermal fibroblasts; 3, testes;, spleen; 5, liver; 6, lymph nodes; 7,kidney; 8, heart; 9, thymus. Panel C, 5 pg of poly(a)+ RNA from porcine lymphocytes hybridized to a 5 -labeled 32Pcomplementary oligonucleotide probe spanning the junction of the alternate splice site in the clone ptgfp9 (from position 1522 to 1785, Fig. C) as described under Experimental Procedures. these RNAs (23). n this report, we provide evidence forthe presence of several heterogeneous speciesof porcine TGF-P1 mrnas which utilize alternate poly(a) sites and alternate splicing patterns; we predict synthesis of a novel putative protein from an alternatively spliced mrna. A porcine cdna library from lymphocyte RNA was constructed in an Okayama and Berg expression vector (18, 19) and screened with a single-stranded 32P-labeledhuman cdna probe specific to thetgf-p1 gene (2). n theinitial screening, 35 clones were obtained of which 12 had inserts of 1.5 kb or longer. Two clones having inserts of approximately 2.0 kb (ptgfp18 and ptgfp9) and one with an insert of approximately 2.2 kb (ptgfp33) were analyzed further (Fig. 1A). We found these clones to be specificto thetgf-p1 gene but different from each other on the basis of nucleotide sequence analysis. Fig. 1C is a composite sequence of all three clones: ptgfp33, ptgfp18,and ptgfp9. Clone ptgfp33has a 2205-base pair insert, and itsnucleo- C29NT+ 126Kb h FG. 3. S1 nuclease mapping of porcine RNAs. Panel A, S1 nuclease mapping of RNA from the lymphocytes with a probe described under Experimental Procedures. Lanes: l, Msp-digested PBR 322 labeled with 32P;2, probe alone; 3, S1-digested products of lymphocyte RNA. Panel B, S1 nuclease mapping of RNA from various cells and tissues. Lanes: 1, dermal fibroblasts; 2, testes; 3, spleen;, liver; 5, lymph nodes; 6, kidney; 7, heart; 8, thymus; 9, probe; 10,pBR 322 marker. Panel C is a schematic showing the probe construction and theexpected size of the protected fragments. tide sequence is in agreement with the reported 1.6-kb porcine TGF-Bl cdna sequence which encodesa TGF-P1 precursor protein of390 amino acids (). However, ptgfp33 is 500 nucleotides longer at its 5 end than the published sequence of porcine TGF-P1 cdna (). When compared to thehuman TGF-Pl cdnasequence,ptgfp33 has an additional 36 nucleotides upstream from the suggested human mrna start site (2). The most upstream nucleotide of clone ptgfo33 is at position 10, and the poly(a) site is at position 2206 of the compositesequenceshown in Fig.1 The consensussequence, AATAAA, generally present nucleotides upstream of the poly(a) site, is not present; however, an alternate sequence, ATTAAA, is present 19 bpupstream from the poly(a) site at position 2188 (Fig. C). All 9 clones analyzed, with the exception of one (ptgfbls),have the same polyadenylation signal sequence(attaaa)located at the identical position. The use of this alternate polyadenylationsignal (ATTAAA)has also beenreported for bovinetgf-pl mrna (5). Based onthe datapresented in this report and a previous report (5), we propose that the human TGF-Bl mrna also
4 18316 Porcine TGF-p1 and Alternate Splicing ALT.SPL MPPPS--//--~AP~TAACGSSTLTSGRTUAGSGFMNPRATMPSAUCPVPTSGA PROTEN TGF-gl PPPS--//--RREAEGFRLSAHCSCOSKDNTLMVElNGFNSGRRGDLATlHGMNRPFLLLMATPLERA~HLMSSRM~LDTNYCFSSTEKNCCVRQLYl PRECURSOR DFRKDLGUKUlMEPKGYHANFCLtPCPYlUSLDT~YSKVLALYN~MNPGASAAPCCVP~ALEPLPlVYYVGRKPKVE~LSN~lVRSCKCS FG.. Putative amino acid sequence of the alternately spliced RNA, from the point of divergence from TGF-01 precursor protein, along with the TGF-01 protein, is shown in single letter code. The potential cleavage sites (RRA and RRRT) which would release the mature peptides both in the alternate spliced protein and TGF-01 precursor are underlined. 1 represents the cleavage of the TGF-pl precursor protein. uses this alternate polyadenylation signal (ATTAAA) in ad- RNA samples isolated from different porcine tissues. Two dition to the one proposed earlier (2). The presence of multiple major bands, one of approximately 2.5 kb and another of poly(a) sites has been shown to be important in gene regula- approximately 3.5 kb (in a ratio of about 2:l) are seen with tion, since the differential use of a poly(a) site in the RNA varying intensities in all the RNA samples from different can sometimes determine the order of splicing and thus can tissues. Higher expression is seen in RNAs from lymphocytes, result in the generation of heterogeneous proteins (23). lymph nodes, and heart tissue in comparison with other Clone ptgfpl8 has a sequence of 199 nucleotides with its most upstream nucleotide at position 1213 and the poly(a) site at position 3206 of the composite sequence shown in Fig. samples (Fig. 2A, lunes 1, 6, and 8). Additional minor species of TGF-pl-specific RNAs of higher molecular weight are detected in the RNA from lymphocytes and lymph nodes. As 1 This clone is 1 kb longer at its 3 end when compared to described earlier, the 3.5-kb mrna species corresponds to the other clones; the consensus sequence AATAAA for poly- clone ptgfpl8 which has a unique 3 extension (Fig. 3B) adenylation is present 21 bp upstream from the poly(a) site suggesting that this clone is missing approximately 1 kb at its at position 3186 of the sequence (Fig. C). This clone appears 5 end as compared to the mrna. As shown in Fig. 2C, the to be missing approximately 1.0 kb from its 5 end since this alternatively spliced mrna species corresponding to clone unique 3 end sequence anneals to an mrna species of ptgfp9 is about the same size as the 2.5-kb species, suggestapproximately 3.5 kb as determined by Northern blot analysis (Fig. 2B). nterestingly, a portion of the 3 untranslated region in the clone ptgfp18 has sequence homology (approximately 80% match) to the recently identified repetitive DNA (PRE-1) present in the porcine genome (2). This sequence of 117 nucleotides (from position 297 to 2613, Fig. C) was found to be highly repetitive in the porcine genome analogous to the Alu and brain identifier repeats present in the human and rat genomes, respectively (25, 26). Although the significance of the PRE-1 repeat element in the 3 -untranslated sequence of the ptgfp18 is unknown, the brain identifier repetitive elements at the 3 end of mrnas have been suggested to play a role in the proliferation of fibroblasts and to be involved in the control of gene expression by regulating alternate splicing patterns of the precursor RNA (27). Thus, it is tempting to speculate that the role of the PRE-1 repeat ing that this species could be longer at its 5 end or has a longer poly(a) tail. n an attempt to confirm the mrna species identified in Fig. 2C corresponding to clone ptgfp9, which represents a deletion of exons V and V, we performed S1 nuclease mapping of RNA from all the tissues that had been subjected to Northern blot analysis, using a specific single-stranded probe generated from clone ptgfp33 as described in Fig. 3C and under Experimental Procedures. S1 nuclease analysis of lymphocyte RNA (Fig. 3A) shows three major bands of approximately 695,397, and 29 nucleotides in length. The 695- nucleotide band corresponds to the fully protected TGF-Pl mrna. This band varies in intensity in RNA from different porcine tissues (Fig. 3B) and is consistent with the intensities of the 2.5-kb mrna band as determined by Northern blot analysis (Fig. 2A). The 29-nucleotide band corresponds to sequences in the porcine genome may be to determine the the protection of exon V to the end of the probe in exon V; regulation of transcription by the use of alternate poly(a) sites and splicing patterns in a tissue-specific manner. Clone ptgfp9 is 1981 nucleotides long, starting at position 1, and having a poly(a) site at position 2206 of the composite sequence shown in Fig. 1 This clone has an interesting structural feature; its sequence is not contiguous with the other cdna clones (ptgfp33 and ptgfp18). Rather, it has a deletion of 226 nucleotides located at position 150 through 1765 of the sequence in Fig. 1 As shown in Fig. la, this deleted region corresponds exactly to exons V and V of the alternatively spliced mrna corresponding to clone ptgfp9 (with deletion) would have a nuclease S1-sensitive site at the junction of exons 11 and V (position 1765, Fig. C), resulting in a protected fragment of 29 nucleotides. The presence of a 29-nucleotide band which represents approximately 10% of the total TGF-p1 mrna, not only in lymphocyte RNA but also in RNA samples from most of the other porcine tissues (some seen after longer exposure) (Fig. 3B) demonstrates that this alternate splice corresponding to clone ptgfp9 is not unique to lymphocytes. The 397- and a minor 75-nucleotidehuman TGF-p1 gene (Fig. 1B) (7). Experimental results long fragments, which are seen in many of the RNA samples presented later (Fig. 3) confirm it to be an authentic cdna (Fig. 3, A and B), most likely represent other alternate splicclone and not the result of cloning artifacts. Restriction ings involving either exons V and V or 11 and V, respecendonuclease digestions of other porcine cdna clones revealed at least two more clones with a deletion located at the same site (data not presented). These clones are interesting because their nucleotide sequence predicts a protein of 256 amino acids, with the N-terminal 211 amino acids (encoded by exons, 11, and 111) identical to those of the TGF-pl tively. The nucleotide sequence data of clone ptgfp9 together with the above S1 nuclease mapping data of porcine RNA suggest that the acceptor and donor splice sites of exons 111, V, and V along with the acceptor site of exon V are conserved between porcine and human TGF-p1 genes (7). n addition to the above mentioned fragments protected precursor protein and a unique C terminus. after S1 nuclease digestion, there is a prominent band of Since our porcine cdna clones predicted multiple mrna species specific for the TGF-p1 gene, total porcine RNA was analyzed on Northern blots to determine the molecular sizes of TGF-pl mrnas and assess tissue-specific regulation. Fig. 2A shows the results of annealing of the TGF-pl probe to approximately 593 nucleotides present mainly in the RNA from heart tissue (Fig. 3B, lune 7). This band has an intensity only slightly less than that of the fully protected 695-nucleotide band. The size of this shorter band corresponds to the protection of an RNA species having an S1 nuclease-sensitive
5 Porcine TGF-P and Alternate Splicing site at the junction of exons 1 and 11 (position 122 of the sequence, Fig. C); thus, it could be due to an alternatively spliced mrna or to one having its 5 end at the junction of exons 1 and 111. t is likely that this 593-nucleotide-long S1 nuclease-protected fragment corresponds to the minor mrna species of approximately 1.2 kb present in heart tissue (Fig. 2A). Experiments are underway to characterize the protein product encoded by this transcript. Southern blot analysis of porcine DNA (not shown) suggests that the heterogeneity of TGF-Pl mrna is not due to transcription from different TGF-P genes but due to selection of alternate splicing and poly(a) sites. However, the alternative splicing corresponding to clone ptgfp9 is not due to the selection of a different poly(a) site. The deduced sequence of the clone ptgfp9 suggests that the protein product of this mrna species would have a unique C-terminal 5 amino acids distinct from that of TGF-P1 protein (Fig. ), since the alternate splice results in exons V and V1 being translated in a frame different from that of TGF-81 and brings a stop codon (TAG) into this frame at nucleotide 1900 (Fig. C). t is interesting to note that there are dibasic and tetrabasic sites in this sequence which are similar to the processing sites in many proteins. One of them is similar to the processing site present in the TGF-Pl precursor protein, Arg-Arg-Ala (Fig. ). Thus we speculate that this putative protein could be cleaved at one of the two sites shown in Fig. releasing a novel peptide of either 5 or 39 amino acids. f the protein were cleaved at the more upstream site ( ), the resulting peptide would have at its N terminus a sequence Ala-Pro-Arg-Arg-Arg whichis highly basic and similar to the sequences suggested for the nuclear targeting of proteins (28). Experiments to characterize this protein are underway and may shed some light on its biological function. n summary, we have been able to characterize some aspects of the transcriptional regulation of TGF-81 RNA mediated through selection of poly(a) sites and utilization of splice sites to generate heterogenous mrnas. Analysis and characterization of the putative novel protein transcribed from the alternately spliced mrna may be important in understanding the biological significance of such mechanisms. Acknowledgments-We are indebted to Dr. S. Watanabe and Dr. Baker for their encouragement and help throughout the course of this study. We acknowledge Drs. R. Derynck for the human TGF- 81 probe, D. H. Sachs for porcine blood, D. S. Singer and R. Ehrlich for porcine RNAs, and H. Okayama for useful suggestions on the cdna library. REFERENCES 1. Sporn, M. B., Roberts, A. B., Wakefield, L.M., and de Crombrugghe, B. (1987) J. Cell Biol. 105, Derynck, R., Jarrett, J. A., Chen, E. Y., Eaton, D. H., Bell, J. R., Assoian, R. K., Roberts, A. B., Sporn, M. B., and Goeddel, D. V. (1985) Nature 316, Derynck, R., Jarrett, J. A., Chen, E. Y., and Goeddel, D. (1986) J. Biol. Chem. 261, Derynck, R. and Rhee, L. (1987) Nucleic Acids Res. 15, Van Obberghen-Schilling, E., Kondaiah, P., Ludwig, R. L., Sporn, M. B., and Baker, (1987) Mol. Endocrinol. 1, Sharples, K., Plowman, G. D., Rose, T. M., Twardzik, D. R., and Purchio, A. F. (1987) DNA 6, Derynck, R., Rhee, L., Chen, E. Y., and Van Tilburg, A. (1987) Nucleic Acids Res. 15, Van Obberghen-Schilling, E., Roche, N. S., Flanders, K., Sporn, M. B., and Roberts A. B. (1988) J. Biol. Chem. 263, Collins, T., Bonthron, D. T., and Orkin, S. H. (1987) Nature 328, Tong, B. D., Auer, A. E., Jaye, M., Kaplow, J. M., Ricca, G., McConathy, E., Drohan, W., and Deuel, T. F. (1987) Nature 328, Ladner, M. B., Martin, G. A., Noble, J. A., Nikoloff, D. M., Tal, R., Kawasaki, E. S., and White, T. J. (1987) EMBO J. 6, Roberts, T., Jr., Lasky, S. R., Lowe, W. L., Jr., Seaman, W. T., and Le Roith, D. (1987) Mol. Endocrinol. 1, Sachs, D. H., Leight, G., Cone, J., Schwarz, S., Stuart, L., and Rosenberg, R. (1976) Transplantation 22, Chirgwin, J. M., Przybya, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18, Aviv, H., and Leder, P. (1972) Proc. Natl. Acud. Sci. U. S. A. 29, Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular C1oning:A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 17. Church, G.M., and Gilbert, W. (198) Proc. Natl. Acad. Sci. U. S. A. 81, Okayama, H., and Berg, P. (1982) Mol. Cell. Biol. 2, Okayama, H., and Berg, P. (1983) Mol. Cell. Biol. 3, Sanger, F., Nicklen, S., and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. U. S. A. 7, Messing, J. (1983) Methods Enzymol. 101, Watanabe, S., and Temin, H. M. (1983) Mol. Cell. Biol. 3, Breitbart, R. E., Andreadis, A., and Nadal-Ginard, B. (1987) Annu. Rev. Biochem. 56, Singer, D. S., Parent, L. J., and Ehrlich, R. (1987) Nucleic Acids Res. 15, Deininger, P. L., and Schmid, W. (1976) J. Mol. Biol. 106, Sutcliffe, J. G., Milner, R. J., Bloom, F. E., and Lerner, R. A. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, Glaichenhaus, N., and Cuzin, F. (1987) Cell 50, Colin, D., and Laskey, R. A. (1986) Annu. Rev. Cell Biol. 2,
Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationLecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
More informationProject 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines
Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)
More informationNAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationLecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
More informationG+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationDet matematisk-naturvitenskapelige fakultet
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationCodon Bias with PRISM. 2IM24/25, Fall 2007
Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationProtein Structure Analysis
BINF 731 Protein Structure Analysis http://binf.gmu.edu/vaisman/binf731/ Iosif Vaisman COMPUTATIONAL BIOLOGY COMPUTATIONAL STRUCTURAL BIOLOGY COMPUTATIONAL MOLECULAR BIOLOGY BIOINFORMATICS STRUCTURAL BIOINFORMATICS
More informationPGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationwww.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations
More informationHomework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity
Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten
More informationPrimer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria
Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationExpression of Recombinant Proteins
Expression of Recombinant Proteins Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression Vector Features
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationSupplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationfor Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides
Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis
More informationΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
More informationNational PHL TB DST Reference Center PSQ Reporting Language Table of Contents
PSQ Reporting Language Table of Contents Document Page Number PSQ for Rifampin 2-6 Comparison table for rpob Codon Numbering 2 rpob mutation list (new numbering system) 3-5 rpob interpretations 6 PSQ for
More informationPROTEIN SYNTHESIS Study Guide
PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationSupporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
More informationMultiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationCat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationLezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza Lezione 10: Sintesi proteica Synthesis of proteins
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationThr Gly Tyr. Gly Lys Asn
Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More informationOverexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
More informationBIOSTAT516 Statistical Methods in Genetic Epidemiology Autumn 2005 Handout1, prepared by Kathleen Kerr and Stephanie Monks
Rationale of Genetic Studies Some goals of genetic studies include: to identify the genetic causes of phenotypic variation develop genetic tests o benefits to individuals and to society are still uncertain
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationIntroduction to Bioinformatics Dr. Robert Moss
Introduction to Bioinformatics Dr. Robert Moss Bioinformatics is about searching biological databases, comparing sequences, looking at protein structures, and more generally, asking biological questions
More informationCreation of A Caspese-3 Sensing System Using A Combination of Split- GFP and Split-Intein
Supplementary Information Creation of A Caspese-3 Sensing System Using A Combination of Split- GFP and Split-Intein Seiji Sakamoto,* Mika Terauchi, Anna Hugo, Tanner Kim, Yasuyuki Araki and Takehiko Wada*
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
More informationMacBlunt PCR Cloning Kit Manual
MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).
More informationGenomic Sequence Analysis using Electron-Ion Interaction
University of Aizu, Graduation Thesis. March, 25 s1985 1 Genomic Sequence Analysis using Electron-Ion Interaction Potential Masumi Kobayashi s1985 Supervised by Hiroshi Toyoizumi Abstract This paper proposes
More informationSupplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More informationDNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection
DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA
More informationevaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
More informationSupplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
More informationSUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING
SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp
More informationhcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
More information2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationFROM DNA TO GENETIC GENEALOGY Stephen P. Morse
1. GENES, CHROMOSOMES, AND DNA Chromosomes FROM DNA TO GENETIC GENEALOGY Stephen P. Morse (steve@stevemorse.org) Every human cell = 46 chromosomes (1 to 22 in pairs, 2 sex chromosomes) Male: sex chromosomes
More informationQuantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
More informationSupporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
More informationSUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
More informationBioInformatics and Computational Molecular Biology. Course Website
BioInformatics and Computational Molecular Biology Course Website http://bioinformatics.uchc.edu What is Bioinformatics Bioinformatics upgrades the information content of biological measurements. Discovery
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
More informationPCR-based Markers and Cut Flower Longevity in Carnation
PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso
More informationSupplemental Data. Distinct Pathways for snorna and mrna Termination
Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationTable S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes
Supplementary Table and Figures for Structural Basis for the Enantiospecificities of R- and S-Specific Phenoxypropionate/α-Ketoglutarate Dioxygenases by Tina A. Müller, Maria I. Zavodszky, Michael Feig,
More informationNucleic Acids Research
Volume 10 Number 1 1982 VoLume 10 Number 11982 Nucleic Acids Research Nucleic Acids Research A convenient and adaptable package of DNA sequence analysis programs for microcomputers James Pustell and Fotis
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationChapter 13 Chromatin Structure and its Effects on Transcription
Chapter 13 Chromatin Structure and its Effects on Transcription Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.
More informationiclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3
Bio 111 Handout for Molecular Biology 4 This handout contains: Today s iclicker Questions Information on Exam 3 Solutions Fall 2008 Exam 3 iclicker Question #28A - before lecture Which of the following
More informationINTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE
The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE
More informationAdditional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name
1 2 3 Additional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name Scientific name Accession number Accession number (introns) Codons
More informationComplexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions
Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationGenes and Proteins. Objectives
Genes and Proteins Lecture 15 Objectives At the end of this series of lectures, you should be able to: Define terms. Explain the central dogma of molecular biology. Describe the locations, reactants, and
More informationPromoter 1. Promoter 2. Enhancer 2
Essays 1. An animal normally has two copies of the Xan gene. The protein made by this gene helps the animal clear petroleum-based pollutants from its body. Tine Xan What we know about the Xan gene is shown
More informationConverting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short
More informationSupplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
More informationBiomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
More informationProtein Synthesis. Application Based Questions
Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html
More information(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?
EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is
More informationAnti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
More informationS4B fluorescence (AU)
A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000
More informationThe B1 Protein Guides the Biosynthesis of a Lasso Peptide
The B1 Protein Guides the Biosynthesis of a Lasso Peptide Shaozhou Zhu 1,2, Christopher D. Fage 1, Julian D. Hegemann 1, Andreas Mielcarek 1, Dushan Yan 1, Uwe Linne 1 & Mohamed A. Marahiel*,1 1 Department
More informationISOLATION OF A cdna CODING FOR HUMAN GALACTOSYLTRANSFERASE
August 29, 1986 Pages 1 63-1 68 ISOLATION OF A cdna CODING FOR HUMAN GALACTOSYLTRANSFERASE Hubert E. Appert*l, Thomas J. Rutherford1, 2, George E. Tarr 3, Jon S. Wiest 2, Neil R. Thomford I and D. James
More informationSupplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
More informationIsolation of a Full-length Complementary DNA Coding for Human Ela Subunit of the Pyruvate Dehydrogenase Complex*
THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1988 by The American Society for Biochemistry and Molecular Biology, Inc. Vol. 263, No. 4, hue of February 5, pp. 1991-1995,1988 Printed in U. S. A. Isolation of a
More information