Yue Wang, Zhenyu Xu, Junfeng Jiang, Chen Xu, Jiuhong Kang, Lei Xiao, Minjuan Wu, Jun Xiong, Xiaocan Guo, and Houqi Liu
|
|
- Samson Fisher
- 6 years ago
- Views:
Transcription
1 Developmental Cell, Volume 25 Supplemental Information Endogenous mirna Sponge lincrna-ror Regulates Oct4, Nanog, and Sox2 in Human Embryonic Stem Cell Self-Renewal Yue Wang, Zhenyu Xu, Junfeng Jiang, Chen Xu, Jiuhong Kang, Lei Xiao, Minjuan Wu, Jun Xiong, Xiaocan Guo, and Houqi Liu Inventory of Supplementary Information Figure S1 related to Figure 1 (A) OCT4 or NANOG knockdown results in the decrease of linc-ror in self-renewal hesc X-01. (B) The kinetic expression levels of linc-ror and core TFs in differentiated X-01 hesc. Figure S2 related to Figure 2 (A, B) Transient transfection efficiency of linc-ror overexpressing vector, control vector, linc-ror-specific sirna and control RNA. (C-F) Relative mrna and protein levels of OCT4, SOX2, and NANOG in linc-ror-overexpressing or knockdown hes X-01 cells. (G) Effort of linc-ror on the Oct4 promotor reporter in hescs. Figure S3 related to Figure 3 (A)The kinetic expression levels of mirnas in differentiated hescs. (B)RIP analysis for the Ago2 protein.
2 (C) mirna expression profiling upon knockdown and overexpressin of linc-ror and Oct4 knockdown. (D) The influence of mir-145 to linc-ror expression levels. (E-G) The target validation using luciferase reporters in self-renewal hescs H1. Figure S4 related to Figure 4 (A-B) linc-ror suppresses mature mir-145 expression in hesc X-01 line. (C) Copy numbers of linc-ror and mir-145 in two hesc lines under self-renewal or differentiated state. Figure S5 related to Figure 5 (A-B, D-E) The role of linc-ror in the maintenance of core TFs and hesc X-01 self-renewal. (C) The apoptosis rates in linc-ror knock-down hesc H1 and X-01. Figure S6 related to Figure 6 Characteristic of linc-ror-overexpressing cells (A-D) and the kinetic expression levels of core TFs and mir-145 in linc-ror knock-down cells (E). Table S1 realted to Figure 3 The predicted mirnas targeting OCT4, NANOG, SOX2 or linc-ror. Supplemental experimental procedures
3 Supplementary Information Supplemental Figures and Legends Figure S1 related to Figure 1 Linc-RoR expression is positively correlated with the undifferentiated state of ES cell X-01. (A) The relative level of linc-ror decreased in self-renewal hesc X-01 3 days after the transfection of sirnas (si) targeting OCT4 or NANOG. The interfering efficiency was confirmed with qrt-pcr. Data are represented as mean ± SEM. **, p<0.01, n=3. (B) The kinetic expression levels of linc-ror, NANOG, SOX2, and OCT4 in differentiated X-01 hesc line by withdrawal of bfgf. The relative expression levels of RNA were quantified by qrt-pcr and were normalized to GAPDH; Data are represented as mean ± SEM.
4 Figure S2 related to Figure 2 (A, B) Transient transfection efficiency of linc-ror overexpressing vector, control vector, linc-ror-specific sirna and control RNA. (A) The percents of GFP positive (+) hes H1 cells under self-renewal conditions expressing vector-encoding GFP 3 days after transient transfection of linc-ror overexpressing vector and control vector. (B) The percents of FITC positive (+) hescs under self-renewal conditions 3 days after transient transfection of FITC-labeled linc-ror-specific sirna (siror) or
5 negative control (NC) RNA. (C-F) Relative mrna and protein levels of OCT4, SOX2, and NANOG in linc-ror-overexpressing or knockdown hes X-01 cells. (C-D) Relative mrna and protein levels of OCT4, SOX2, and NANOG in hesc X-01 under self-renewal (C) or differentiation (D) conditions that were transfected with linc-ror-overexpressing vector (linc-ror) or control vector (vector). The GFP-positive hescs were isolated by FACS. (E-F) Relative mrna and protein levels of OCT4, SOX2, and NANOG in hescs under self-renewal (E) or differentiation (F) conditions that were transfected with sirna targeting linc-ror (siror) or negative control RNA (NC). RNA and protein levels were assayed by quantitative RT-PCR and western blotting analysis; GAPDH is the normalization control. Data are represented as mean ± SEM. **, p<0.01, n=3. (G) Effort of linc-ror on the OCT4 promotor reporter in hescs. The luciferase reporters containing OCT4 promotor were co-transfected with the shown linc-ror sirna or linc-ror overexpressing vectors and their controls in the self-renewal or differentiated H1 cells. The relative luciferase activities were assayed 48 hrs after transfection and normalized to untreated self-renewal hescs. Data are represented as mean ± SEM.
6 Figure S3 related to Figure 3 (A) The kinetic expression levels of mirnas in differentiatied hescs. The relative expression levels of mirnas in hescs were quantified by qrt-pcr and
7 normalized to U6 snrna 3 days or 7 days after differentiation by the withdrawal of bfgf. Data are represented as mean ± SEM. (B) The binding ability of linc-ror, OCT4, SOX2 and NANOG full-length transcripts to Argonaute 2 (Ago2) protein. HEK293 cells were transfected with vectors expressing linc-ror, OCT4, SOX2 or NANOG full-length transcripts combined with MS2bs elements and co-transfected them into HEK293 cells with an MS2BP-YFP expression vector and a mixture of these micrornas: mir-145, mir-181a, mir-34a and mir-16. MS2BS-Renilla luciferase (RL) was used as a negative control. The transcript-specific binding RNA-protein complexes were then immunoprecipitated with YFP antibody, and IgG was used as a negative control. The immunoprecipitated proteins were assayed by Western Blotting with Argonaute 2 (Ago2) antibody. (C) mirna expression profiling upon knockdown and overexpressin of linc-ror and Oct4 knockdown. The relative expression levels of mirnas in hescs were quantified by qrt-pcr and normalized to U6 snrna 3 days after transfection of linc-ror specific sirna (siror), Oct4 specific sirna (sioct4) or linc-ror overexpressing vector (linc-ror) with scramble negative control (NC) RNA or blank vector as negative controls, respectively. Data are represented as mean ± SEM. (D) The influence of mir-145 to linc-ror expression levels. hescs H1 were transfected with mir-145 mimics. HEK293 cells were transfected with mir-145 mimics combined with vectors over-expressing (OE) linc-ror full-length transcripts. NC RNA was used as a negative control. The relative expression levels of linc-ror
8 were determined with qrt-pcr 24 hrs or 48hrs after transfections. Data are represented as mean ± SEM. ** p < 0.01, n=3. (E-G) The target validation using luciferase reporters in self-renewal hescs H1. (E) The relative luciferase activities of luciferase reporters (Luc-) containing linc-ror (RoR), OCT4, NANOG or SOX2 transcripts were assayed 48 hrs after co-transfection with the indicated micrornas or scramble NC RNA. Luc-control, the basal luciferase reporter without inserts. Data are represented as mean ± SEM. ** p < 0.01, n=3. (F) Co-expression of wild-type linc-ror (RoR WT) rescued the relative luciferase activities of luciferase reporters containing OCT4, NANOG and SOX2 when co-transfected with mir-145 in self-renewal hescs H1. Blank vector (vector) and mutant linc-ror (RoR-Mut) were used as controls. Data are represented as mean ± SEM. ** p < 0.01, n=3. (G) The self-renewal H1 cells were transfected with luciferase reporters containing wild-type (WT) or mutant (Mut) transcripts and then changed to bfgf-removing medium (-bfgf). The relative luciferase activities of cells were assayed 3 days after transfection with transfected self-renewal H1 as control (+bfgf). Data are represented as mean ± SEM. ** p < 0.01, n=3.
9 Figure S4 related to Figure 4 (A-B) linc-ror suppresses mature mir-145 expression in hesc X-01 line. The expression levels of mature mir-145 and its primary (pri-) or pre-mature (pre) transcripts in self-renewal hesc X-01 transiently transfected with wildtype (WT) linc-ror or mutant (Mut) linc-ror overexpressing vectors (A) or linc-ror-specific sirna (siror) (B). Blank vector or negative control RNA (NC) was used as controls. The relative expression levels of RNA were all quantified by qrt-pcr and were normalized to GAPDH. Data are represented as mean ± SEM. ** p < 0.01, n=3. (C) Copy numbers of linc-ror and mir-145 in two hesc lines under self-renewal or differentiated state. The exact copy numbers of primary transcripts of mir-145 (pri-mir-145), mature mir-145 and linc-ror transcripts per cell in hescs H1 and X-01 were quantified with real-time quantitative RT-PCR. The hescs H1 and X-01 were cultured under
10 self-renewal condition or differentiated condition (diff) by removing bfgf from medium. For exact quantification of gene copies per cell, linc-ror or pri-mir-145 expressing vector and reverse-transcribed mir-145 cdna were used as standard templates to formulate standard curves with limit dilution approaches, and then the exact copies of linc-ror, pri-mir-145 and mir-145 per cell were calculated according to their molecular weight and cell counts. Data are represented as mean ± SEM. ** p < 0.01, * p < 0.05, n=3.
11 Figure S5 related to Figure 5 The role of linc-ror in the maintenance of core TFs and hesc self-renewal (A) The relative mrna or mirna levels in LV-shROR infected X-01 cells referring to LV-NC infected cells. Expressions were confirmed with qrt-pcr and GAPDH or U6 snrna were used as the normalization controls. Data are represented as mean ± SEM. ** p < 0.01, n=3. (B) The cell morphology and alkaline phosphatase (AP) activity quantified by the total areas of AP positive (AP+) clones for LV-shROR-infected X-01 cells and control
12 cells under self-renewal conditions. The rescue effect of mir-145 inhibitor (inh) was also shown with negative control (NC) RNA as a control. The scale bar represents 100 μm. Data are represented as mean ± SEM. ** p < 0.01, n=3. (C) The apoptosis rates in linc-ror knock-down hescs. The apoptosis rates were assayed by apoptosis marker annexin V flow cytometry in lentivirus expressing shrna targeting linc-ror and vector-encoding GFP (LV-shROR) or negative control shrna (LV-NC) infected hescs. Lentivirus expressing shrna targeting OCT4 (LV-shOct4) was used as a positive control. The rescue effect of mir-145 inh are also shown with NC RNA as a control. Data are represented as mean ± SEM. ** p < 0.01, n=3. (D) The expression levels of differentiation markers for the three germinal layers in LV-shROR or LV-NC infected X-01 cells and mir-145 inh rescued cells were confirmed with qrt-pcr. Data are represented as mean ± SEM. ** p < 0.01, ref. to LV-NC infected cells, n=3. (E) Comparison of the expression levels of differentiation markers for the three germinal layers in LV-shROR infected hescs and mir-145 minics transfected hescs. The expression levels of differentiation markers for the three germinal layers in LV-shROR or LV-NC infected hescs, mir-145 or NC RNA transfected hescs were confirmed with qrt-pcr 3 days after treatments. Data are represented as mean ± SEM. ** p < 0.01, n=3.
13 Figure S6 related to Figure 6 (A, B) Characteristic of linc-ror-overexpressing (linc-ror OE) cells. We transfected a linc-ror-encoding lentivirus vector into ES cells, performed puromycin
14 selection to isolate linc-ror OE cells. The relative RNA levels in linc-ror OE cells referring to vector-transfected cells were assayed by qrt-pcr. GAPDH or U6 snrna were used as the normalization controls. Data are represented as mean ± SEM. **, p<0.01, n=3. (C) The cell morphology after alkaline phosphatase (AP) straining for linc-ror OE cells and vector-transfected cells under self-renewal conditions. The scale bar represents 100 μm. (D) qrt-pcr analysis for the expression levels of differentiation markers. The expression levels of differentiation markers for the three germinal layers in H1 cells transiently transfected with vectors over-expressing wildtype linc-ror or linc-ror Mut (linc-ror with the mutant mir-145 binding sites) were confirmed with qrt-pcr 3 days after transfection. Data are represented as mean ± SEM. ** p < 0.01, n=3. (E) The kinetic expression levels of core TFs and mir-145 in linc-ror knock-down cells. The kinetic expression levels of core TFs mrnas and mir-145 transcripts in LV-shROR transiently transfected hescs or control vector-transfected hescs were quantified by qrt-pcr and normalized to GAPDH or U6 snrna under differentiation conditions. Data are represented as mean ± SEM. ** p < 0.01, n=3.
15 Supplemental Table S1 related to Figure 3 Table S1 Predicted mirnas targeting OCT4, NANOG, SOX2 or linc-ror mirna name Positions of mirna binding sites OCT4 NANOG SOX2 linc-ror hsa-mir-145-5p ; hsa-mir-181a-5p ; hsa-mir-99b-3p hsa-mir-34a-5p ; hsa-mir-30c-1/2-3p hsa-mir-19b-2-5p ; hsa-mir-19a-5p to 1521 hsa-mir-125a-3p hsa-let-7a , hsa-mir-331-3p hsa-mir-205-5p hsa-mir-520c-3p Table S1 legend MiRNAs that target the full-length transcripts of OCT4, SOX2, NANOG or linc-ror were predicted using the bioinformatics tool Miranda (Enright et al., 2003). Energy Threshold: kcal/mol. The positions (ref. to the mrna start site) of these binding sites were shown.
16 Supplemental experimental procedures Cell Culture hescs (H1 and X-01) were obtained from Prof. Xiao, Zhejiang University, and cultured according to the protocol from WiCell Research Institute. Briefly, hescs were maintained in hesc culture medium on c-irradiated mouse embryonic fibroblasts (MEFs) prepared using WiCell instructions. hescs ranging from passage number were used for all of our experiments. hesc complete culture medium is composed of DMEM/F12 supplemented with 20% knockout serum replacement, 1 mm Lglutamine, 1% nonessential amino acids, 4 ng/ml human FGF2 (all from Invitrogen), and 0.1 mm 2-mercaptoethanol (Sigma). The medium was changed daily, and cells were passaged every 4-6 days with 1 mg/ml Collagen IV (Invitrogen). For differentiation studies hescs were cultured in differentiation medium (hesc medium without FGF) containing 1 mm BMP4 for 5 days, with fresh medium change daily. hescs were also maintained as feeder-free cultures on hesc qualified Matrigel (BD Biosciences) in mtesr1 medium (Stemcell Technologies) and MEF conditioned medium (CM). CM was prepared in our facility by culturing c-irradiated MEFs in complete hesc culture medium for 24 hrs, collected daily, filtered, and freezed at 220uC. FGF was added to CM before use to a final concentration of 10 ng/ml to culture the cells grown on Matrigel under pluripotent conditions. Passage 32 hescs were grown on mtesr1 medium for five passages. hescs were cultured on Matrigel following manufacturer s instructions and received fresh mtesr1 medium daily, and cells were passaged every 4-6 days with 1 mg/ml Dispase (Stem cell Technologies).
17 Differentiation by forming EB suspension was carried out in hesc medium without bfgf. Alternative differentiation method of feeder-free hescs involved the use of nonconditioned hesc medium deprived of bfgf. BMP4 differentiation was done with daily dose of 50 ng/ml BMP4 (R&D Systems) in hesc medium without bfgf for 7 days. Lentiviral Preparation and Transduction in hescs Lentiviral vectors were produced by triple transient transfection of HEK293T cells with a packaging plasmid (phr-cmvδ8.9), a plasmid encoding the envelope of vesicular stomatitis virus (VSVg) (pcmv-vsv-g) (kind gift from Prof Jia Guo, Johns Hopkins University, Shirley, MA) and the expression plasmid, employing Lipofectamine 2000 (Invitrogene). All lentivirus batches used for experiments had comparable titers ranging from to transducing functional U/ml. Virus suspensions were stored at -80 C until use and were briefly centrifuged and kept on ice immediately before use. For infection, ESCs were transduced 1 day after initial seeding of the cells with a multiplicity of infection (MOI) of 20. Cells were incubated in pluripotent maintenance media containing lentiviral particles and 4 μg/ml polybrene (Sigma Aldrich) for 18 hrs at 37 C in a humidified atmosphere containing 5% CO 2. Lentiviral particles were removed and media was replaced with fresh pluripotent maintenance media for an additional 24 hrs to permit cell recovery. Puromycin selection (1 μg/ml) started 3 days posttransduction. Experiments were carried out on the cells after at least 2 passages of continuous puromycin selection. The sequences of shrnas are depicted as follows:
18 OCT4-shRNA Sense 5'-CCGGAACAUGUGUAAGCUGCGGCCCCTCG AGGGGCCGCAGCUUACACAUGTTTTTTTG-3' AS 5'-AATTCAACAUGUGUAAGCUGCGGCCCCTC GAGGGGCCGCAGCUUACACAUGTT-3' lincror-shrna Sense 5'-CCGGTGGAGAGGAAGCCTGAGAGTCTCGA GACTCTCAGGCTTCCTCTCCTTTTTG-3' AS 5'-AATTCAAAAAGGAGAGGAAGCCTGAGAGT CTCGAGACTCTCAGGCTTCCTCTCCA-3' Dicer-shRNA Sense 5'-CCGGTAAGGGCACCCATCTCTAATTACTCG AGTAATTAGAGATGGGTGCCCTTTTTTTG-3' AS 5'-AATTCAAAAAAAGGGCACCCATCTCTAATT ACTCGAGTAATTAGAGATGGGTGCCCTTA-3' Negative control-shrna Sense 5'-CCGGTTTCTCCGAACGTGTCACGTCTCGAG ACGTGACACGTTCGGAGAATTTTTG-3' AS 5'-AATTCAAAAATTCTCCGAACGTGTCACGTC TCGAGACGTGACACGTTCGGAGAAA-3' FACS and Flow Cytometry Analysis of Self-Renewal and Apoptosis. hescs were grown in six-well plates and collected for FACS staining and quality control. Briefly, the cells were removed from the dish with trypsin/edta (Invitrogen). Trypsin was neutralized with MEF medium (DMEM containing 10% FBS [Hyclone]) and pelleted by centrifugation for 5 min at 250 g. Cells were resuspended in FACS buffer (PBS containing 2% FBS and 0.1% sodium azide). All the samples were analyzed using BD FACScalibur equipment (BD Biosciences) according to instructions from facility instrument technicians. For self-renewal analysis, each 100 ml of cell suspension ( cells) was incubated with the primary antibody mouse anti-ssea4 (Cell Signaling Technology) and PE-conjugated Goat anti-mouse (Jackson ImmunoResearch). For apoptosis analysis, cells from each sample were processed with Annexin V-PE (Annexin V-PE apoptosis detection kit, Biovision) according to the manufacturer s instructions. The cell population of interest was determined and dead cells excluded
19 using forward and side scatter parameters. Acquisition was set for 10,000 events per sample. The data were analyzed with FACSDiva software (version 4.1.2; BD Biosciences). Triplicate samples were analyzed in each experiment. Immunostaining and Fluorescent In Situ Hybridization hesc colonies were grown on Matrigel-coated coverslips in mtesr1 or MEF complete CM (CM + FGF, 10 ng/ml) or CM differentiation medium (-FGF) for 3 d. Cells were fixed with 4% paraformaldehyde in water for 15 min at room temperature. Cells were washed three times with PBS and blocked with blocking buffer (10% normal goat serum in PBS) for 2 hrs at room temperature, incubated with anti-nanog, anti-sox2, anti-oct4, anti-sox1, anti-cdx2 and anti-foxa2 antibodies (all from Abcam) overnight at room temperature, and washed twice in PBST (PBS + Tween20). The cells were then incubated with the secondary antibody (TRITC labeled goat anti-mouse IgG; Molecular Probes) for 45 min in the dark at room temperature, followed by two washes with PBST. For the detection of linc-ror, a fragment of linc-ror was amplified by the prime 5'-CCTGACCTGTTGACCCAC-3' and 5'-TTCCCAGCACCTTCTCCT-3' and then cloned in to pmd-18t vector (TAKARA). RNA probes were then transcribed in vitro with the mmassage T7 Ultra in vitro transcription kit (Ambion) and labeled with Digoxigenin (DIG)-UTP (Roche) according to the manufacture s directions. The slides were hybridized with probes overnight, washed three times with 50% formamide/2 saline-sodium citrate (SSC) and three times with 2 SSC at 45 C for 5 min each.
20 Coverslips with cells were then mounted on glass slides using Antifade mounting reagent from the Slowfade Antifade Kit (Molecular Probes). The cells were examined and photomicrographed using an Olympus fluorescence microscope. RNA Isolation and Real-Time PCR Analysis Total RNA was extracted using Trizol (Invitrogen). The mirna levels were assayed with the Taqman probes and primer sets (Applied Biosystems) according to the manufacturer s instructions. For mrna analysis, the first-strand cdna was generated using the Reverse Transcription System Kit (Promega) with random primers for RT-PCR or real-time PCR using a Power SYBR Green PCR Master Mix (Applied Biosystems) protocol in a StepOne Plus system (Applied Biosystems). U6 snrna or GAPDH mrna level was used as internal normalization control. For exact quantification of gene copies per cell, linc-ror or pri-mir-145 expressing vector and reverse-transcribed mir-145 cdna were used as standard templates to formulate standard curves with limit dilution approaches, and then the exact copies of linc-ror, pri-mir-145 and mir-145 per cell were calculated according to their molecular weight and cell counts. The primer sequences are presented as follows: linc-ror Prime S 5'-CTGGCTTTCTGGTTTGACG-3' Prime A 5'-CAGGAGGTTACTGGACTTGGAG-3' NANOG Prime S 5'-ACCTATGCCTGTGATTTGTGG-3' Prime A 5'-AGTGGGTTGTTTGCCTTTGG-3' OCT4 Prime S 5'-GAAAGCGAACCAGTATCGAGAAC-3' Prime A 5'-CCCCTGAGAAAGGAGACCCA-3' SOX2 Prime S 5'-GGTTACCTCTTCCTCCCACTCC-3' Prime A 5'-CCCTCCCATTTCCCTCGTTT-3' FOXA2 Prime S 5'-GCCGCAGATACCTCCTACTACCA-3' Prime A 5'-CCCCACTTGCTCTCTCACTTGTC-3'
21 GATA6 Prime S 5'-ATGACTCCAACTTCCACCTCTTCTAA-3' Prime A 5'-GCCCATCTTGACCCGAATACTT-3' CDX2 Prime S 5'-GTTGTTGTTGCTGCTGTT-3' Prime A 5'-CCTTCACCATATCACTTCTC-3' Brachyury Prime S 5'-CTTATTTCCGTCCATTTCCCTC-3' Prime A 5'-GCCGCAGTAGTAGTGCTGTTCT-3' MIXL1 Prime S 5'-AGCGAATTGAGATAAAGCGAGAA-3' Prime A 5'-GAGAATCACTTGAACCTGGGAG-3' NODAL Prime S 5'-CCCAAGCAGTACAACGCCTAT-3' Prime A 5'-CACCCACATTCTTCCACGAT-3' GATA4 Prime S 5'-CGGAAGCCCAAGAACCTGA-3' Prime A 5'-GCTGCTGTGCCCGTAGTGAG-3' FABP1 Prime S 5'-CAGAGCCGCAGGTCAGTCGT-3' Prime A 5'-ACCCAGCGGTGATGGTGAA-3' VIMENTEN Prime S 5'-GCCAGGCAAAGCAGGAGTC-3' Prime A 5'-AACATTGAGCAGGTCTTGGTATT-3' OTX2 Prime S 5'-CACTGCTCCAAACCCACCC-3' Prime A 5'-CAGCCCATTGACTGCGTAA-3' GATA2 Prime S 5'-GGACAGACGAAGGCAACCATT-3' Prime A 5'-GGGAAGCCAGAGGAGAAGAGG-3' HAND1 Prime S 5'-CCTATCTGGCTCTTTCTCTCTTGTC-3' Prime A 5'-CATCTTCCTGCGTCTGGTTCTC-3' RUNX2 Prime S 5'-CAGCACTCCATATCTCTACTAT-3' Prime A 5'-CTTCCATCAGCGTCAACA-3' Nestin Prime S 5'-CCCTTCCAGACTCCACTCCC-3' Prime A 5'-CCCAGCCCTCCTTTCCAG-3' PAX6 Prime S 5'-GCTGGCTGGCTTACTTCTTCCT-3' Prime A 5'-CTTTTCTCCCATTCCCACCTCT-3' SOX7 Prime S 5'-CACCAACGGGTCCCACAGA-3' Prime A 5'-GCCACTCAAGGCACAAGAAGG-3' SOX1 Prime S 5'-TCTCCAACTCGCAGGGCT-3' Prime A 5'-GGGCTCCGACTTCACCAG-3' GAPDH Prime S 5'- CGGATTTGGTCGTATTGGG-3' Prime A 5'- CTGGAAGATGGTGATGGGATT-3' Pri-miR-145 Prime S 5'-CACTCGCTCCCACCTTGTC-3' Prime A 5'-TTCTTCTTGAACCCTCATCCTG-3' Pre-miR-145 Prime S 5'-CCTTGTCCTCACGGTCCAGT-3' Prime A 5'-AACCATGACCTCAAGAACAGTATTT-3' MicroRNAs, SiRNAs and MicroRNA Inhibitor Transfection in hescs hesc colonies were grown on matrigel-coated 6-well plates. Twenty to 100 nanomolar sirnas specifically targeting linc-ror and OCT4, mir-145 minics,
22 mir-145 inhibitor or scramble control RNAs (GenePharma, Shanghai, China) microrna and 4 μl transfection reagent RNAiMAX (Invitrogene) were used to transfect each well according to the manufacturer s instructions. The sequences of sirnas are depicted as follows: OCT4-siRNA Sense 5'- AACAUGUGUAAGCUGCGGCCCdTdT -3' AS 5'- GGGCCGCAGCUUACACAUGTTdTdT -3' NANOG-siRNA Sense 5'-AAGGGUUAAGCUGUAACAUACdTdT -3' AS 5'- GUAUGUUACAGCUUAACCCUUdTdT -3' linc-ror-sirna Sense 5'- GGAGAGGAAGCCUGAGAGUdTdT -3' AS 5'- ACUCUCAGGCUUCCUCUCCdTdT -3' Dicer-siRNA Sense 5 -AAGGGCACCCAUCUCUAAUUAdTdT -3 AS 5'- TAATTAGAGATGGGTGCCCTTdTdT -3' Negative control Sense 5'-UUCUCCGAACGUGUCACGUdTdT-3' AS 5'-ACGUGACACGUUCGGAGAAdTdT-3' Vectors Construction and Transfection in hescs The complementary DNA of linc-ror, pri-mir-145, OCT4, NANOG and SOX2 was PCR-amplified from self-renewing hescs cdna by PrimeSTAR HS DNA Polymerase (TaKaRa) and was subcloned into the pcdna3.1-flag (Invitrogen), pmir-report (Ambion), pcdna3-ms2bs or pcms-egfp-vector (Clontech) to generate overexpressing or reporter vectors. Promoter of OCT4 was PCR-amplified from human genomic DNA by TaKaRa LA Taq (TaKaRa) and was subcloned into the pgl3-basic (Promega) to generate reporter vector. Mutated constructs containing the 6-8 point mutations in the seed sequence were synthesized with a QuikChange II Site-Directed Mutagenesis kit (Stratagene). In HEK293 cells, transfections of plasmids were performed using the Lipofectamine 2000 (Invitrogen) according to the manufacturer s instructions. When hescs were used, the hescs were split at 1 to 2 ratios in 24-well or 6-well plates coated with
23 matrigel. Fugene HD reagent (Promega) was used according to the manufacturer s instructions. All of the primer sequences are presented as follows: Linc-RoR For pcdna3.1-flag, pmir-report, pcdna3-ms2bs, pcms-egfp pri-mir-145 Prime S Prime A 5'-GGGGTACCGGTGAAATAAACAGCCATGTTG CTCACA-3' 5'-GGAATTCTTTATTTTTTGAGGAACTGTCATA CCGTTTCC-3' Prime S 5'-GGGGTACCAGAAGGCCAAGGCTCAGGGG-3' For pcdna3.1-flag Prime A 5'-GGAATTCTGGAAAGAAAAGCAACGCAAAG G-3' OCT4 Prime S 5'-GGAATTCCTTCGCAAGCCCTCATTTCAC-3' For pmir-report, Prime A 5'-CGCGGATCCCAGTTTGAATGCATGGGAGAG pcdna3-ms2bs C-3' OCT4 promotor Prime S 5'-GGAATTCGGTAGCTGTGTAATTGGCACCAT-3 For pgl3-basic ' Prime A 5'-CGCGGATCCAACGAACCGTCGCCAGCAA-3' NANOG Prime S 5'-GGAATTCGGAATTCCACCAGTCCCAAAGGC For AAAC-3' pmir-report Prime A 5'-CGCGGATCCCTCATTGAAACACTCGGTGAA pcdna3-ms2bs AT-3' SOX2 Prime S 5'-GGAATTCCTGCCTCTTTAAGACTAGGACTG For -3' pcdna3-ms2bs Prime A 5'-CGCGGATCCTCGGCAGACTGATTCAAATAAT ACA-3' SOX2 Prime S 5'-GGAATTC CCCCTGTGGTTACCTCTTCC-3' For pmir-report Prime A 5'-CGCGGATCCGCTGTCATTTGCTGTGGGTG-3' Luciferase Reporter Transfection and Dual Luciferase Assay HEK293 cells ( ) were seeded into each well of 96-well plate and incubated overnight then co-transfected with 80 ng reporters or mutant reporters (pmir-report), 8 ng internal control prl-tk Renilla luciferase plasmid and indicated microrna minics molecules (final concentration, 50 nm) with 1 μl of Lipofectamine For hescs, 200 ng pmir-report vectors and 20 ng prl-tk plasmid were transfected into hescs in 24-well plate with 2 μl of Lipofectamine Lysates were harvested
24 24 hrs or 48 hrs after transfection, and reporter activity was measured with the Dual Luciferase Assay (Promega). In the promoter activity assay, hescs were transfected with 200 ng of the pgl3 reporter vector, 20 ng of the Renilla control with 1.2 μl of Fugene HD reagent (Promega). The lysates were processed as described above with the Dual Luciferase Assay (Promega). Data were normalized by dividing firefly luciferase activity with that of Renilla luciferase as reported. Western Blotting Analysis Total cell lysates were prepared in a 1 sodium dodecyl sulfate buffer. Identical quantities of proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. The following antibodies were used for Western blotting: anti-nanog, anti-oct4, anti-sox2 (all from Abcam), anti-dicer1 and anti-ago2 (both from Santa Cruz Biotechnology) with anti-gapdh (Santa Cruz Biotechnology) as endogenous control. Chromatin Immunoprecipitation (ChIP) Assay ChIP assays were performed according to the manufacturer s instructions of EZ-Magna ChIP A/G Kit (Millipore). Chromatin was immunoprecipitated using anti-nanog, anti-oct4 and anti-sox2 (all from Abcam) with control total human IgG (Santa Cruz). ChIP-derived DNA was quantified using realtime PCR with SYBR Green incorporation (Applied Biosystems). The promoter (pro) region of linc-ror was analyzed according to the previous report and information from UCSC websites. Three pairs of primers were designed and the best one was chose to detect the enriched genomic DNA fragments. Fold enrichments were calculated from the
25 apparent IP efficiency (ratio of ChIP enriched DNA over control IgG input DNA) and normalized to the level at a control region. The primer sequences are as follows: linc-ror pro-1 Prime S 5'- AACTGATGACATTCCACCACAAA-3' Prime A 5'-CAGTCAGCGAAGGGAGATAGG-3' linc-ror pro-2 Prime S 5'-TTTGCTTCTTCGATTCCTCCAT-3' Prime A 5'-TGTGTGGTCTTTATCTGCCTGTT-3' linc-ror pro-3 Prime S 5'-CATCCCCCTGCTATGGACG-3' Prime A 5'-GGAATGCCTTCGCCCTGT-3' linc-ror pro ref Prime S 5'-GTGGTGGAATGTCATCAGTTAAGGCG-3' Prime A 5'-TCTAGGAGTCCACCTCATAAGCAC-3' Control Prime S 5'-GAGGTCTCGTATTTGCTGCATCGTA-3' Prime A 5'-GCTAATTTCCTTCTCCACCCCAACCA-3' RNA-Binding Protein Immunoprecipitation (RIP) Assay The MS2bp-MS2bs based RIP assay was performed according to previously reports with modifications for using the EZ-Magna RIP Kit (Millipore). Briefly, HEK293 cells ( ) were seeded into 100 mm plate and incubated overnight then co-transfected with 20 μg MS2bs-cDNA overexpressing vectors (pcdna3-ms2bs) or blank control vectors with Renilla luciferase inserts (pcdna3-ms2bs-rl), 5 μg MS2bp-YFP overexpressing plasmid and indicated microrna minics molecules (final concentration, 500 nm for each minics) with 100 μl of Lipofectamine After 24 hrs, cells were crosslinked using 1% formaldehyde for 10 min at 25 C and subsequently quenched with 0.25M glycine for 5 min at room temperature. Then cells were lysed with buffer provided in kits and sonicated six times for 30 s to facilitate lysis. Immunoprecipitation was performed using anti-gfp (cross-reacting with YFP) or control IgG (both from Santa Cruz Biotechnology) according to the manufacturer s instructions. The complexes of RNA and co-isolated RNA-binding proteins were then treated with Trizol (Invitrogen) for further purification and analysis.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
More informationProtocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction
More informationProtocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM
STEMGENT Page 1 Reprogramming Lentivirus Set: Human OKSM OVERVIEW The following procedure describes the reprogramming of BJ Human Fibroblasts (BJ cells) to induced pluripotent stem (ips) cells using the
More informationProtocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction
More informationProtocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells
STEMGENT Page 1 OVERVIEW The following protocol describes the transduction and reprogramming of one well of Oct4-GFP mouse embryonic fibroblasts (MEF) using the Dox Inducible Reprogramming Polycistronic
More informationSupplemental Methods Cell lines and culture
Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,
More informationProtocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationSupplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition. through modulation of the mir-130b-zeb1 axis
Supplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition through modulation of the mir-3b-zeb axis AUTHORS: Peixin Dong, Mihriban Karaayvaz, Nan Jia, Masanori
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationEndogenous mirna Sponge lincrna-ror Regulates Oct4, Nanog, and Sox2 in Human Embryonic Stem Cell Self-Renewal
Stem Cell Self-Renewal, (2013), http://dx.doi.org/10.1016/j.devcel.2013.03.002 Article Endogenous mirna Sponge lincrna-ror Regulates Oct4, Nanog, and Sox2 in Human Embryonic Stem Cell Self-Renewal Yue
More informationDocument S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
More informationComparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila
Molecular Cell, Volume 32 Supplemental Data Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Rui Zhou, Ikuko Hotta, Ahmet M. Denli, Pengyu Hong, Norbert Perrimon, and Gregory
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationSupplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
More informationBlimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling
1 2 3 4 5 6 7 8 9 10 11 Supplementary Methods Antibodies Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling (Danvers, MA) and used at 1:1000 to detect the total PRDM1 protein
More informationSupplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
More informationLINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.
Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationTo generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR
Plasmids To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR fragments downstream of firefly luciferase (luc) in pgl3 control (Promega). pgl3- CDK6 was made by amplifying a 2,886
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationPropagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW)
Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Growth and Harvest Modifications Addendum to: Propagation of H7 hesc from UW
More informationSupplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
More informationApplication Note. Laminin/Entactin Complex: A Feeder-Free Surface for Culture of Human Embryonic Stem Cells. Introduction
Laminin/Entactin Complex: A Feeder-Free Surface for Culture of Human Embryonic Stem Cells Deepa Saxena, Ph.D. and Susan Qian, Ph.D. Corning Incorporated, Tewksbury, MA, USA Application Note Contents 1
More informationbfgf Supports Human ES Cell Self- Renewal
APPLICATION NOTE Page 1 bfgf Supports Human ES Cell Self- Renewal Authors: Dongmei Wu, Wen Xiong, Yan Gao, Kristine Guerrero, Yi Chen, Liming Yang, Yang Liu, and Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle
More informationSUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans
SUPPLEMENTARY INFORMATION LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans Priscilla M. Van Wynsberghe 1, Zoya S. Kai 1, Katlin B. Massirer 2-4, Victoria H. Burton
More informationChemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationTranscriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
More informationRegulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
More informationQuantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;
Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More informationTo determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x
Supplementary methods: Cellular growth assay and cell cycle analysis To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x 10 3 cells/well (except for TALL1 and
More informationSupplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationSupporting Information
Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and
More information3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget. Application Guide. OriGene Technologies, Inc
3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget Application Guide OriGene Technologies, Inc Package Contents and Storage Conditions 3 UTR reporter clone as 10ug lyophilized plasmid
More informationused at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were
1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies
More informationSupplementary methods
Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into
More informationHUMAN IPSC CULTURE PROTOCOLS
HUMAN IPSC CULTURE PROTOCOLS FOR TRAINING COURSE IXCELLS BIOTECHNOLOGIES USA, LLC 10340 CAMINO SANTA FE, SUITE C, SAN DIEGO, CA 92121 TABLE OF CONTENTS CHAPTER 1 BEFORE STARTING 2-7 SECTION 1.1 COATING
More informationMag4C-Lv Kit - Results
Mag4C-Lv Kit - Results Mag4C-Lv Kit Magnetic capture for viral concentration & storage buffer for superior viral preservation OZ Biosciences is delighted to announce the launching of a new product Mag4C-Lv
More information(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
More informationOmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
More informationCorning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture. Catalog Number Guidelines for Use
Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture Catalog Number 354671 Guidelines for Use Discovery Labware, Inc., Two Oak Park, Bedford, MA 01730, Tel: 1.978.442.2200
More informationThe Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273
Data Sheet The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273 Background The Wnt / -catenin signaling pathway controls a large and diverse set of cell
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationMammosphere formation assay. Mammosphere culture was performed as previously described (13,
Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts
More informationSupplementary Methods Plasmid constructs
Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned
More informationHCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
More informationXeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications
Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and
More informationAdenoviral Expression Systems. Lentivirus is not the only choice for gene delivery. Adeno-X
Adenoviral Expression Systems Lentivirus is not the only choice for gene delivery 3 Adeno-X Why choose adenoviral gene delivery? Table I: Adenoviral vs. Lentiviral Gene Delivery Lentivirus Adenovirus Infects
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More informationOnline Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Co-immunoprecipitation (Co-IP) assay Cells were lysed with NETN buffer (20 mm Tris-HCl, ph 8.0, 0 mm NaCl, 1 mm EDT, 0.5% Nonidet P-40) containing 50 mm β-glycerophosphate,
More information8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna
More informationProtocol CRISPR Genome Editing In Cell Lines
Protocol CRISPR Genome Editing In Cell Lines Protocol 2: HDR donor plasmid applications (gene knockout, gene mutagenesis, gene tagging, Safe Harbor ORF knock-in) Notes: 1. sgrna validation: GeneCopoeia
More informationReprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D
Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D MATERIALS Media Sodium Pyruvate (Mediatech; Cat# MT25-000-CI) Leukemia Inhibitory Factor
More informationAPPLICATION NOTE Page 1
APPLICATION NOTE Page 1 Generation of ips Cells from Oct4-Neo Reporter Embryonic Fibroblasts Dongmei Wu, Yan Gao, Charles Martin, Xun Cheng, Wen Xiong, Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle St.,
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationFlow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
More informationEmanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera
SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationSupplementary Data. Supplementary Materials and Methods Quantification of delivered sirnas. Fluorescence microscopy analysis
Supplementary Data Supplementary Materials and Methods Quantification of delivered sirnas After transfection, cells were washed in three times with phosphate buffered saline and total RNA was extracted
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationUTR Reporter Vectors and Viruses
UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationGene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG
Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationPartial list of differentially expressed genes from cdna microarray, comparing MUC18-
Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18
More informationUSP19 modulates autophagy and antiviral immune responses by. deubiquitinating Beclin-1
USP19 modulates autophagy and antiviral immune responses by deubiquitinating Beclin-1 Shouheng Jin 1,2,, Shuo Tian 1,, Yamei Chen 1,, Chuanxia Zhang 1,2, Weihong Xie, 1 Xiaojun Xia 3,4, Jun Cui 1,3* &
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationSupporting Information
Supporting Information Davidson et al. 1.173/pnas.111877719 SI Materials and Methods hesc Culture. For experiments where treatments were continued over several weeks, an identical sister plate was harvested
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationSupporting Information
Supporting Information Powell and Xu 10.1073/pnas.0807274105 SI Methods Design of Estrogen Receptor (ER) Fusion Constructs for Use in Bioluminescence Resonance Energy Transfer (BRET) Assay. Because the
More informationProtocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent VSVg Retrovirus Reprogramming Set: Human OKSM
STEMGENT Page 1 VSVg Retrovirus Reprogramming Set: Human OKSM OVERVIEW The following protocol describes the reprogramming of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in
More informationgacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg
Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4
More informationSupplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the phenotype of HDAC1-/- teratomas. 3x10 6 HDAC1 reintroduced (HDAC1-/-re) and empty vector infected
More informationCell extracts and western blotting RNA isolation and real-time PCR Chromatin immunoprecipitation (ChIP)
Cell extracts and western blotting Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with lysis buffer. 1 Total cell extracts were separated by SDS-PAGE and transferred to nitrocellulose
More informationData Sheet. TCF/LEF Reporter Kit Wnt / -catenin signaling pathway Catalog #: 60500
Data Sheet TCF/LEF Reporter Kit Wnt / -catenin signaling pathway Catalog #: 60500 Background The Wnt / -catenin signaling pathway controls a large and diverse set of cell fate decisions in embryonic development,
More informationEPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
More information