Chemically defined conditions for human ipsc derivation and culture
|
|
- Frederica Marianna Bridges
- 6 years ago
- Views:
Transcription
1 Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto, Sara E Howden, Nicole R Diol, Nicholas E Propson, Ryan Wagner, Garrett O Lee, Jessica Antosiewicz-Bourget, Joyce M C Teng & James A Thomson Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Defining essential media components for human pluripotent stem cells Global gene expression analysis of human ES and ips cells in defined conditions. Growth factor maintenance in E8 media in regular cell culture processes Optimization of fibroblast reprogramming in defined condition. Media components used in this study. Primer set used for RT-qPCR. Pluripotent cells maintained in defined conditions.
2 Supplementary Figure 1. Defining essential media components for human pluripotent stem cells. a. TGFβ, LiCl, Pipecolic acid and GABA are not required for short-term survival and proliferation of human ES cells in TeSR. When those factors were removed from TeSR 1
3 (TeSR core), H1 ES cells survived (24 hours, blue columns) and proliferated (82 hours, red columns) as well as in TeSR. b. Addition of NODAL (100 ng/ml) and TGFß (2 ng/ml) in defined media (DMEM/F12, Insulin, FGF2, LAA and Selenium) maintained significantly higher NANOG expression in human ES cells (*p < 0.05, n = 3). H1 cells were maintained in specific media for 5 days (2 passages), and RNA was purified for qrt-pcr to detect NANOG expression relative to GAPDH. c. DMEM/F12 basic media is among the best basic media in our screen that supports human ES cell survival and proliferation. A variety of basic media were used to make growth media with additional components (Insulin, FGF2, LAA, Selenium and NaHCO 3 ) (Supplementary Table 1). Dissociated H1 cells were plated in different media on matrigel-coated plates. Cell survival was measured at 24 hours (blue column), and cell proliferation at 52 hours (red column). d. Defined media (DMEM/F12, Insulin, FGF2, LAA and Selenium) with NODAL supports pluripotency of human ips cells. Flow cytometry detected high expression of pluripotency marker OCT4 in two ips cell lines 1. Green Peak: OCT4 antibody with Alexa-488 conjugated secondary antibody; Grey peak: mouse IgG control. Similar results were also obtained from H1 and H9 ES cells maintained in the same media. e. Normal karyotypes were maintained after long-term passage for those ips cells shown above. Normal karyotypes were also maintained in H1 and H9 ES cells cultured in the same media listed above. f. ROCK inhibitor HA100 (10 µm) improved cell survival after dissociation in TeSR (*p < 0.05, 2
4 n = 3). g. HA100 also improved cloning efficiency as efficiently as Y27632 and Blebbistatin in E8 media. Cells were treated with HA100(10 µm) and Y27632(10 µm) for 24 hours, and with blebbistatin (10 µm) for 4 hours (*p < 0.05, n = 3). h. E8(TGFβ) supported proliferation and pluripotency after long-term passage in H1 and ips cells 2. High OCT4 expression was detected in H1 and ips cells. Surface marker SSEA4 is also highly expressed i. Normal karyotypes were maintained after 25 passages. 3
5 Supplementary Figure 2. Global gene expression analysis of human ES and ips cells in defined conditions. a. ES cell gene expression is similar in cells grown in E8 media compared to those in TeSR. Human ES H1 cells were maintained in either TeSR or E8 (TGFβ) medium for 3 passages, and gene expression was analyzed by RNA-seq with Illumina Genome 4
6 Analyzer GAIIX. The global gene expression correlation is R = (Spearman Correlation). b. Gene expression of ips cells is similar to that of ES cells. ips cells were derived from foreskin fibroblasts in E8 based cell culture (Figure 4). H1 ES and ips cells were maintained in E8 (TGFβ) medium before RNA was harvested for RNA-seq. Pluripotency markers were highly expressed in both ES and ips cells, while fibroblast specific marker genes were not expressed. Foreskin fibrolasts were maintained in E8 with hydrocortisone. ips cells from foreskin fibroblasts were derived under defined condition (Figure 4, ips Cells (E8)), or were derivated under undefined conditions on MEF (ips Cells (Feeder)) 2. c. Global gene expression of human ES and ips cells is closely correlated (R = 0.955). ips cells were derived from foreskin fibroblasts on feeder cells 2 or in defined conditions (Figure 4), and they and ES cells were maintained in E8 (TGFβ). Gene expression was analyzed by RNA-seq. d. Global gene expression of ips cells is closely correlated (R = 0.959), regardless of derivation conditions. ips cells were derived from foreskin fibroblasts on feeder cells 2 or in defined conditions (Figure 4), and they and ES cells were maintained in E8(TGFβ). Gene expression was analyzed by RNA-seq. 5
7 Supplementary Figure 3. Growth factor maintenance in E8 media in regular cell culture processes. a. b. c. d. Total Supernatant Plate Total Filtered E8 E8 E8 E8 E8+BSA E8+BSA E8+BSA E8+BSA Day 0 Day 14 0hr 8hr 24hr E8 media was subjected to different treatments, and FGF2 western blot was performed to detect the impact of BSA on growth factor maintenance in media. a. Media were added into plate for 24-hour storage at 4 o C, and proteins were harvested from supernatant and plate to detect the localization of FGF2. b. Media were filtered with 0.22 µm filter, and the filter-through was used for FGF2 western. c. Media were stored at 4 o C for 2 weeks, and FGF2 was measured before and after storage. d. Media were incubated at 37 o C, and were harvested at different time points (8-hour and 24-hour) to assay the loss of FGF2. 6
8 Supplementary Figure 4. Optimization of fibroblast reprogramming in defined condition. a. FGF2 promotes the growth of foreskin cells. Foreskin fibroblast cells were used to screen fibroblast growth factors in E8 based media for cell proliferation in 120 hours, compared with FBS-containing media. (*p < 0.05, n = 3) b. Hydrocortisone and TGFβ promotes fibroblast cell growth. Adult cell line PRPF8-2 adult fibroblast cells were cultured in specific media for 90 hours before cell growth was measured. (*p < 0.05, n = 3) 7
9 c. EBNA1 mrna co-transfection improved transfection efficiency. orip-plasmid expressing GFP was electroporated into adult fibroblast cell lines. EBNA1 mrna significantly improved GFP expression percentage (*p < 0.05, n = 2). The same experiment was repeated in another unrelated adult fibroblast, and similar results were obtained. BioRad Gene Puler II was used for the electroporation (250 V, 1,000 µf) in a 0.4cm cuvette for 1 million cells suspended in Opti-MEM (Invitrogen). d. During the reprogramming process, many colonies emerged with transformed non-fibroblast morphologies, but they were not ips cells. The photos demonstrate typical non-ips colonies after 25 days of reprogramming. Colonies with these morphologies were not counted when determining reprogramming efficiencies. Scale bar = 100 µm. e. Normal karyotypes were detected for ips cells that were derived in fully defined conditions (Fig. 4b). f. Defined cell culture condition in Step 2 is critical for reprogramming (Fig. 4a). One day after lentivirus transduction, cells were dissociated, and plated into three conditions: feeder cells with FBS media (MEF-FBS), matrigel with FBS media (FBS) and E8 based media (Fig. 4a). Five days after plating, all cells were switched to E8 without TGFβ, and ips cells were scored ~ 25 days after transduction. (*p < 0.05, n = 3) 8
10 Supplementary Table 1: Media components used in this study. Components TeSR TeSR core E8* DMEM/F12 (liquid) L-Ascorbic Acid Selenium Transferrin NaHCO3 Glutathione L-Glutamine Defined lipids Thiamine Trace elements B Trace elements C ß-mercaptoethanol Albumin (BSA) Insulin FGF2 TGFß1 Pipecolic acid LiCl GABA H2O NODAL Hydrocortisone Butyrate * In E8 media, NODAL (100 ng/ml) and TGFβ (2 ng/ml) are interchangeable in maintaining ES and ips cells. When NODAL is used, the media is specified as E8 (NODAL), and vice versa for TGFβ, specified as E8 (TGFβ). 9
11 Supplementary Table 2. Primer set used for RT-qPCR. Gene names Forward primer Reverse primer GAPDH GTGGACCTGACCTGCCGTCT GGAGGAGTGGGTGTCGCTGT NANOG TTCCTTCCTCCATGGATCTG TCTGCTGGAGGCTGAGGTAT Supplementary Table 3: Pluripotent cells maintained in defined conditions. Cell lines maintained in E8 media ES cells H1, H9 ips cells ips-imr90 1, ips-foreskin 1, ips-df19 2, and all ips lines derived in E 8 media ips cells derivated and maintained in E8 based media + * % Banked cells Foreskin-p10 (30-200), OAT-p6 (30), PRPF-p6 (8), PRPF8-2-p6 (4), AG04054-p7 (32) Derived cells 004-p4 (120), 005-p4 (60), 010A-p4 (~1000), 10B-p4 (100) 1 ips cells derived with lentiviral approaches 1. 2 ips cells derived with episomal approaches 2. + Only episomal-reprogrammed cells were listed in the table. More cell lines were derived with lentiviral approach in E8 based media. * Reprogramming efficiency (ips cell colonies/10 6 transfected cells) for each cell line was listed in brackets. % Fibroblast culture passage number was placed at the end of cell name. For example, Foreskin-p8 means that foreskin cells were reprogrammed at passage 8. 10
12 Supplemental References 1 Yu, J. Y. et al. Induced pluripotent stem cell lines derived from human somatic cells. Science 318, (2007). 2 Yu, J. Y. et al. Human Induced Pluripotent Stem Cells Free of Vector and Transgene Sequences. Science 324, (2009). 11
Episomal ipsc Reprogramming Vectors FAQs
About Episomal ipsc Reprogramming Vectors Episomal ipsc Reprogramming Vectors Catalog Number A14703 1. What are induced pluripotent stem cells (ipscs)? ipscs are genetically reprogrammed somatic cells
More informationReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)
Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming
More informationStem cell transfection guide
APPLICATION NOTE Stem cell transfection guide Gene delivery solutions Introduction Stem cells continue to show immense promise for the future of regenerative medicine and personalized therapeutic treatments.
More informationXeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications
Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and
More informationTransfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent
APPLICATION NOTE Page 1 Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent Authors: Amelia L. Cianci 1, Xun Cheng 1 and Kerry P. Mahon 1,2 1 Stemgent Inc.,
More informationbfgf Supports Human ES Cell Self- Renewal
APPLICATION NOTE Page 1 bfgf Supports Human ES Cell Self- Renewal Authors: Dongmei Wu, Wen Xiong, Yan Gao, Kristine Guerrero, Yi Chen, Liming Yang, Yang Liu, and Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle
More informationA simple choice. Essential 8 Media
A simple choice Essential 8 Media Your stem cells thrive with the essentials Gibco Essential 8 Medium is a feeder-free, xeno-free medium originally developed in the laboratory of stem cell research pioneer
More informationCorning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture. Catalog Number Guidelines for Use
Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture Catalog Number 354671 Guidelines for Use Discovery Labware, Inc., Two Oak Park, Bedford, MA 01730, Tel: 1.978.442.2200
More informationips Cell Induction from Human Non-T, B Cells from Peripheral Blood Keisuke Okita *
ips Cell Induction from Human Non-T, B Cells from Peripheral Blood Keisuke Okita * Department of Reprogramming Science, Center for ips Cell Research and Application (CiRA), Kyoto University, Kyoto, Japan
More informationADVANCED MEDIA TECHNOLOGY
ADVANCED MEDIA TECHNOLOGY For Human ES and ips Cell Research The right medium makes all the difference in ensuring successful ES and ips cell culture. Stemgent offers high-quality, chemically-defined,
More informationElectroporation of human induced pluripotent stem (ips) cells
Electroporation of human induced pluripotent stem (ips) cells Ribonucleoprotein delivery using the Alt-R CRISPR-Cas9 System and the NEPA21 Electroporator Contributed by Nepa Gene, Chiba, Japan (info@nepagene.jp)
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationAn investigation of the role of integrin alpha-6 in human induced pluripotent stem cell development and pluripotency
An investigation of the role of integrin alpha-6 in human induced pluripotent stem cell development and pluripotency Submitted by Genna Wilber Biology and English To The Honors College Oakland University
More informationFrequently Asked Questions Stem Cells
Q: Do you add antibiotics to your media? A: Coriell does not use antibiotics when culturing stem cells. Customers should be aware that inclusion of antibiotics in media may change growth characteristics
More informationHCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
More informationSupplemental Information
Cell Stem Cell, Volume 15 Supplemental Information Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts Riguo Fang, Kang Liu, Yang Zhao, Haibo Li, Dicong Zhu, Yuanyuan Du,
More informationSupplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
More informationhpsc Maintenance Media
hpsc Maintenance Media Brigitte Arduini, version 2, 2013-Jun-12 Initially, it was found that pluripotency of human pluripotent stem cells (hpscs) can be maintained when plated in co-culture with mouse
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationProtocol: Stemgent StemRNA -NM Reprogramming Kit for Reprogramming Adult and Neonatal Human Fibroblasts
Protocol: Stemgent StemRNA -NM Reprogramming Kit for Reprogramming Adult and Neonatal Human Fibroblasts Overview This protocol describes procedures for reprogramming adult and neonatal human fibroblasts
More informationTo isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationApplication Note Use of a Defined, Low-Growth Factor Xeno-Free Culture Medium for the Long-Term Culture of Undifferentiated Human Embryonic Stem Cells
Undifferentiated Human Authors: Dongmei Wu, M. D., Ph. D., Yan Gao, Wen Xiong, Ph. D., Shuyuan Yao, Ph. D. and Matthew A. Singer, Ph. D. 1 Stemgent, Inc., 10575 Roselle St., San Diego, CA 92121 USA 1 Corresponding
More informationNutriStem V9 XF Medium
Stem Cells NutriStem V9 XF Medium A defined, xeno-free (XF), serum-free (SF) culture medium for hpsc using vitronectin Instructions for Use Product Description NutriStem V9 XF medium is a defined, xeno-free,
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and
SUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and first strand cdna was synthesized using 1 μg of RNA and
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationNutriStem: a Defined, Low-Growth Factor, Xeno-Free Medium for the Long Term Culture of Undifferentiated Human ES Cells
APPLICATION NOTE Page 1 NutriStem: a Defined, Low-Growth Factor, Xeno-Free Medium for the Long Term Culture of Undifferentiated Human ES Cells Authors: Dongmei Wu, M. D., Ph. D., Yan Gao, Wen Xiong, Ph.
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationBest Practices Maintaining Pluripotency. Anne R. Greenlee, PhD
Best Practices Maintaining Pluripotency Anne R. Greenlee, PhD HESI-Workshop Cary, NC 27 Feb 2007 OHSU La Grande Campus Research Directions Past Fertility Risk Factor Study Pesticide effects on embryo development
More informationGenome Edited ipscs APOE -/- Knockout
Applied StemCell, Inc. (866) 497-4180 www.appliedstemcell.com Datasheet Genome Edited ipscs APOE -/- Knockout Product Information Catalog Number Description Amount Parental Cell Line Gene Knockout Generated
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationA15871 A15872 A15876 A15870
TaqMan hpsc Scorecard Kits TaqMan hpsc Scorecard Panels A15871 A15872 A15876 A15870 Product Qty Cat. No. TaqMan hpsc Scorecard Kit 2 x 96w FAST 1 kit A15871 TaqMan hpsc Scorecard Kit 384w 1 kit A15872
More informationSTEMdiff Hematopoietic Kit
For differentiation of human ES or ips cells into hematopoietic progenitor cells Catalog #05310 1 Kit Product Description Kit includes a defined, serum-free basal medium and supplements for the feeder-free
More informationGeneration of ips-derived model cells for analyses of hair shaft differentiation
Supplementary Material Generation of ips-derived model cells for analyses of hair shaft differentiation Takumi Kido, Tomoatsu Horigome, Minori Uda, Naoki Adachi, Yohei Hirai Department of Biomedical Chemistry,
More informationSupplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationPropagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW)
Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Growth and Harvest Modifications Addendum to: Propagation of H7 hesc from UW
More informationTransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
More informationEfficient Feeder-Free Episomal Reprogramming with Small Molecules
Efficient Feeder-Free Episomal Reprogramming with Small Molecules Junying Yu*, Kevin Fongching Chau, Maxim A. Vodyanik, Jinlan Jiang, Yong Jiang Advanced Development Programs, Cellular Dynamics International,
More informationMaintenance of Human Pluripotent Stem Cells in TeSR -E8
Maintenance of Human Pluripotent Stem Cells in TeSR -E8 i Critical Parameters for Successful Cell Culture with TeSR E8 Preparation and Storage of Complete TeSR -E8 Medium It is critical to store complete
More informationWiCell Feeder Based (MEF) Pluripotent Stem Cell Protocols
WiCell Feeder Based (MEF) Pluripotent Stem Cell Protocols Preface This booklet of protocols is intended to serve as a primer for culturing pluripotent stem cells on mouse embryonic fibroblast (MEF) feeder
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationNeural induction Dual SMAD inhibition
Neural induction Dual SMAD inhibition Mark Tomishima, Sloan-Kettering Institute, Center For Stem Cell Biology, New York, NY 10065 US Introduction Dual SMAD inhibition takes a confluent, feeder free culture
More informationTRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES. Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec.
TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec. 15, 2013 Outline Overview of transfection TransfeX Primary/hTERT
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationRNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors
Supplementary Information RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors Pablo Perez-Pinera 1, Daniel D. Kocak 1, Christopher M. Vockley 2,3, Andrew F. Adler 1, Ami M. Kabadi 1,
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationUser s Guide MegaTran 1.0 Transfection Reagent
User s Guide MegaTran 1.0 Transfection Reagent Package Contents and Storage Conditions... 2 Related products... 2 Introduction... 2 Production and Quality Assurance:... 3 Experimental Procedures... 3 Transfection
More informationHuman Pluripotent Stem Cell Growth Medium DXF
Human Pluripotent Stem Cell Growth Medium DXF Instruction Manual Product Size Catalog Number hpsc Growth Medium DXF 500 ml C-28060 Recommended for Human Pluripotent Stem Cells (hpsc) Product Description
More informationGaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
More informationSupplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
More informationConstitutive Reprogramming Lentiviral Vectors Expressing Polycistronic Human OSKM or Monocistronic Human Oct4, Sox2, Klf4, Myc, Lin28 or Nanog for Somatic Cell Reprogramming www.vectalys.com/products/
More informationWiCell Feeder Free Pluripotent Stem Cell Protocols
WiCell Feeder Free Pluripotent Stem Cell MEF Conditioned Medium Preface This booklet of protocols is intended to serve as a primer for culturing pluripotent stem cells using MEF Conditioned Medium. MEF
More informationDirected Differentiation of Human Induced Pluripotent Stem Cells. into Fallopian Tube Epithelium
Directed Differentiation of Human Induced Pluripotent Stem Cells into Fallopian Tube Epithelium Nur Yucer 1,2, Marie Holzapfel 2, Tilley Jenkins Vogel 2, Lindsay Lenaeus 1, Loren Ornelas 1, Anna Laury
More informationTransIT -LT1 Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2300 INTRODUCTION TransIT -LT1 Transfection Reagent is a broad spectrum reagent that provides high efficiency plasmid
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
More informationHUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR)
HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) OBJECTIVE: is performed to analyze gene expression of human Embryonic Stem Cells (hescs) in culture. Real-Time PCR
More informationYue Wang, Zhenyu Xu, Junfeng Jiang, Chen Xu, Jiuhong Kang, Lei Xiao, Minjuan Wu, Jun Xiong, Xiaocan Guo, and Houqi Liu
Developmental Cell, Volume 25 Supplemental Information Endogenous mirna Sponge lincrna-ror Regulates Oct4, Nanog, and Sox2 in Human Embryonic Stem Cell Self-Renewal Yue Wang, Zhenyu Xu, Junfeng Jiang,
More informationNaked Mole Rat Induced Pluripotent Stem Cells and Their Contribution
Stem Cell eports, Volume 9 Supplemental Information Naked Mole at Induced Pluripotent Stem Cells and Their Contribution to Interspecific Chimera Sang-Goo Lee, Aleksei E. Mikhalchenko, Sun Hee Yim, Alexei
More informationCHOgro Expression System
SDS and Certificate of Analysis available at mirusbio.com/6260 INTRODUCTION The CHOgro Expression System is an optimized platform for transient, high titer protein production in suspension CHO derived
More informationStem Cells. Maintenance of Human Pluripotent Stem Cells in. NutriStem hpsc XF Media. Technical Manual
Stem Cells Maintenance of Human Pluripotent Stem Cells in NutriStem hpsc XF Media Technical Manual Version 03 - October 2016 1 NutriStem hpsc XF Cat# 05-100-1 NutriStem hpsc XF, Xeno-free medium for feeder-free
More informationPSC 4-Marker Immunocytochemistry Kit PSC (OCT4, SSEA4) Immunocytochemistry Kit PSC (SOX2, TRA-1-60) Immunocytochemistry Kit
PSC 4-Marker Immunocytochemistry Kit PSC (OCT4, SSEA4) Immunocytochemistry Kit PSC (SOX2, TRA-1-60) Immunocytochemistry Kit Catalog no. A24881, A25526, A25525 Table 1 Contents and storage Kit component
More informationHuman embryonic stem cells for in-vitro developmental toxicity testing
Human embryonic stem cells for in-vitro developmental toxicity testing HESI workshop on alternatives assays for developmental toxicity Raimund Strehl Cellartis The company Founded in early 2001, University
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationRNA Polymerase III Subunit POLR3G Regulates Specific Subsets of
Stem Cell Reports, Volume 8 Supplemental Information RNA Polymerase III Subunit POLR3G Regulates Specific Subsets of PolyA + and SmallRNA Transcriptomes and Splicing in Human Pluripotent Stem Cells Riikka
More informationTransIT -VirusGEN Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6700 INTRODUCTION Adeno-associated virus (AAV) is a nonenveloped, single stranded DNA virus from the Paroviridae family
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationTransIT-PRO Transfection Reagent Protocol for MIR 5740 and 5750
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/5740 INTRODUCTION TransIT-PRO Transfection Reagent was developed by empirically testing proprietary lipid and polymer
More informationTransIT -Keratinocyte Transfection Reagent
TransIT -Keratinocyte Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2800 INTRODUCTION TransIT -Keratinocyte Transfection Reagent is specifically
More informationTransIT -293 Transfection Reagent
TransIT -293 Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2700 INTRODUCTION TransIT -293 Transfection Reagent is specifically optimized to provide
More informationOPPF-UK Standard Protocols: Mammalian Expression
OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA
More informationReal-time PCR. TaqMan Protein Assays. Unlock the power of real-time PCR for protein analysis
Real-time PCR TaqMan Protein Assays Unlock the power of real-time PCR for protein analysis I can use my real-time PCR instrument to quantitate protein? Do protein levels correlate with related mrna levels
More informationTransIT Transfection Reagent
INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent that provides exceptional transfection of plasmid DNA into mammalian cells. TransIT-2020
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationVersatility and performance of Lipofectamine Stem Transfection Reagent
PPLICTION NOTE Stem Transfection Reagent Versatility and performance of Stem Transfection Reagent Introduction The ability of stem cells to self-renew and differentiate into various specialized cell types
More informationDirect Reprogramming of Mouse Fibroblasts toward Leydig-like Cells
Stem Cell Reports, Volume 8 Supplemental Information Direct Reprogramming of Mouse Fibroblasts toward Leydig-like Cells by Defined Factors Yan Yang, Ziyi Li, Xupeng Wu, Haolin Chen, Wenting Xu, Qi Xiang,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationConvoy TM Transfection Reagent
Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections
More informationInt. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
More informationTransIT -CHO Transfection Kit
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2170 INTRODUCTION TransIT -CHO Transfection Kit is specifically optimized to provide exceptional transfection efficiency
More informationAlt-R CRISPR-Cas9 system:
Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research
More informationTransIT Transfection Reagent
INTRODUCTION TransIT -2020 is a broad spectrum transfection reagent that provides superior transfection of plasmid DNA into mammalian cells. TransIT-2020 is suitable for both transient and stable transfection
More informationPatents on Technologies of Human Tissue and Organ Regeneration from Pluripotent Human Embryonic Stem Cells
Patents on Technologies of Human Tissue and Organ Regeneration from Pluripotent Human Embryonic Stem Cells The Harvard community has made this article openly available. Please share how this access benefits
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationContents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
More informationTransIT -LT1 Transfection Reagent
INTRODUCTION TransIT -LT1 Transfection Reagent is a broad spectrum reagent that provides high efficiency plasmid DNA delivery in many mammalian cell types including primary cells. TransIT-LT1 is a low
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationMyers Lab ChIP-seq Protocol v Modified January 10, 2014
Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org
More informationSupplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
More informationTransIT -Prostate Transfection Kit
INTRODUCTION TransIT -Prostate Transfection Kit is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in Prostate cell types. Generally, prostate cell types have been
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More information