Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
|
|
|
- Dorthy Todd
- 6 years ago
- Views:
Transcription
1 Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out a large portion of nascent rrna in rapidly dividing cell populations. Figure S3: Most introns in Drosophila S2 cells are efficiently spliced cotranscriptionally. Figure S4: Biological replicates have good intron retention correlation values. Figure S5: Different means of analyzing intron retention all show high degree of cotranscriptional splicing efficiency. Figure S6: Biological replicates of the ratios of reads across the 3 SS of analyzed introns show significant correlation. Figure S7: Select introns are dramatically retained in the nascent transcript, while others in the same gene are efficiently spliced. Figure S8: Nascent-Seq in fly head is comparable to S2 cells. Figure S9: A similar degree of cotranscriptional splicing is present S2 cells and the fly head. Figure S10: Longer introns are more retained in S2 Cells and Fly Heads. Figure S11: Longer introns except for extremely long introns show less efficient cotranscriptional splicing by 3 SS ratio. Figure S12: First introns show greater retention in S2 cells and fly heads. Figure S13: Annotation of first introns differs in significance between S2 Cells and fly heads. Figure S14: Nascent-seq of S2 cells containing a stabily-integrated RpII215 C4 mutant is comparable to seq of wild-type cells. Figure S15: Intron length, first position, and alternative annotation continue to be significantly positively correlated with intron retention in S2 RpII215 C4 mutant NUN RNA. Table S1: A list of all primers used in this paper. Table S2: The number of accepted hits in each sequencing run used in this paper.
2 Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. A. A SDS-PAGE gel showing S2 cell fractionation. Note only core histone proteins remaining in detectable quantities in NUN pellet. B. A Western blot against RNA Pol II 215kD subunit on the same gel as in A. Note signal in the S2 NUN fraction. C. RNA signal remaining after washing RNA preparation over Oligo(dT) beads. NUN RNA in blue, control total RNA in red. GAPDH and pa Binding Protein genes were chosen for qpcr. D. The Bioanalyzer profile of NUN RNA is qualitatively different from the profile of total RNA. NUN RNA in blue, total RNA in red. The NUN RNA profile is depleted of processed rrna, and enriched for RNAs between 200 and 4000nt in length.
3 Figure S2: rrna removal procedure is effective for clearing out a large portion of nascent rrna in rapidly dividing cell populations. A. A schematic of the rrna removal procedure. Biotinylated oligos anti-sense to the primary rrna transcript are annealed and reverse transcribed. The RNA:DNA hybrid is then pulleddown onto streptavidin magnetic beads, and the supernatant is reserved for further analysis. B. qpcr analysis of rrna signal depletion in NUN RNA. rrna Depletion amount = 1 (Signal post-depletion / Signal pre-depletion). C. The Bioanalyzer profiles of NUN RNA pre- and post-rrna depletion. Pre-depletion in red, post-depletion in blue. The post-depletion NUN RNA has no detectable mature rrna peaks, and has less RNA in the nt fraction. D. A qpcr of NUN RNA Random and dt primed following a wash on pa beads. E. A schematic of the protocol used to generate NUN sequencing libraries.
4 Figure S3: Most introns in Drosophila S2 cells are efficiently spliced cotranscriptionally. A. and C. An image of the sequencing reads for two typical genes, LanB1 (A) and Bap170 (C), in the Affymetrix Integrated Genome Browser (IGB). pa RNA in red, NUN RNA in blue, gene structure in black. Note breaks in sequencing reads coinciding with intron position. B. and D. Graphs showing the quantitation of intron retention for the introns of the genes shown in A and C. Intron Retention = reads per basepair in intron / reads per basepair in all exons.
5 Figure S4: Biological replicates have good intron retention correlation values. A. The intron retention scores for the two biological replicates of S2 NUN restricted to introns of genes with an average of 3 reads/bp or more in the exons show statistically significant (p<0.01) correlations (Spearman s ρ=0.715). C. The correlations are improved when the analysis is restricted to genes with 10 reads/bp in the exons (Spearman s ρ=0.854).
6 Figure S5: Different means of analyzing intron retention all show high degree of cotranscriptional splicing efficiency. A. The observed high degree of cotranscriptional splicing we see in our global analysis (blue) is preserved when we limit our analysis to only genes with one isoform (light blue). B. Analyzing the genome by flattening genes with multiple isoforms into one transcript and analyzing non-exonic regions for retention (pale blue) still results in a high degree of cotranscriptional splicing, though less than an analysis that treats all introns as separate cases (blue). C. We observe a high degree of cotranscriptional splicing in both the intron retention default analysis (blue) and by taking the ratio of reads across the 3 SS (blue-white).
7 Figure S6: Biological replicates of the ratios of reads across the 3 SS of analyzed introns show significant correlation (Spearman s ρ=0.461, p<0.01).
8 Figure S7: Select introns are dramatically retained in the nascent transcript, while others in the same gene are efficiently spliced. A. and C. Two genes, jumu and CG10802, that have introns with high retention (red arrows) in the NUN RNA sample (blue) and no matching intron signal in the pa (red) control sample. Gene structure in black. B. and D. Graphs of the quantification of intron retention for jumu (B) and CG10802 (D).
9 Figure S8: Nascent-Seq in fly head is comparable to S2 cells. A. The number of introns in genes that received an average of 3reads/bp or more in S2 cell and fly head NUN samples, as well as the overlap used for analysis between the two samples. B. The intron retention scores of the 2 biological replicates of Fly Head NUN RNA show a statistically significant (p<0.01), high level of correlation (Spearman s ρ=0.711). C. Intron retention correlation improves when analysis is restricted to genes with 10reads/bp in the exons (Spearman s ρ=0.840).
10 Figure S9: A similar degree of cotranscriptional splicing is present S2 cells and the fly head. A. and C. Two examples of genes, CG5059 and CG17090, whose introns are similarly spliced in the fly head (purple) and S2 cell (blue) NUN RNA fractions. S2 cell (red) and fly head (magenta) pa tracts are presented for comparison of intron signal. Gene structure in black. B. and D. Quantification of intron retention for the introns of A and C. Though some introns are quantifiably differently spliced, the differences are not always visually dramatic in A and C.
11 Figure S10: Longer introns are more retained in S2 Cells (A and C) and Fly Heads (B and D). Longer introns are more retained regardless of position (A and B) or alternative or constitutive annotation (C and D). (p<0.001, Kruskal-Wallis Test, all pairwise.)
12 Figure S11: Longer introns except for extremely long introns show less efficient cotranscriptional splicing by 3 SS ratio. A. and D. S2 cells (A) and fly heads (D) show similar increase in 3 SS ratio for longer introns, except extremely long introns (p<0.001, Kruskal-Wallis Test, all pairwise). B. and E. Longer introns have higher 3 SS ratios regardless of position in S2 cells (B) and fly heads (E) (p<0.001, Kruskal-Wallis Test, all pairwise). C. and F. Longer introns have higher 3 SS ratios regardless of alternative or constitutive annotation in S2 cells (C) and fly heads (F) (p<0.001, Kruskal-Wallis Test, all pairwise).
13 Figure S12: First introns show greater retention in S2 cells and fly heads. A. and B. First introns are more retained in S2 cells (A) and fly heads (B) regardless of length (p<0.001, Mann-Whitney U-Test). C. and D. Alternative or constitutive annotation does not account for less efficient cotranscriptional splicing of first introns in S2 cells (C) and fly heads (D) (p<0.001, Mann- Whitney U-Test).
14 Figure S13: Annotation of first introns differs in significance between S2 Cells and fly heads. A. There are no significant differences between alternative and constitutive first introns in S2 cells (p=0.188, Mann-Whitney U-Test). B. Alternative first introns in fly heads have significantly higher 3 SS ratios than constitutive first introns (p<0.001, Mann-Whitney U-Test).
15 Figure S14: Nascent-seq of S2 cells containing a stabily-integrated RpII215 C4 mutant is comparable to seq of wild-type cells. A. A Western blot for the Myc-tagged RNA RpII215 C4 protein stabily-integrated into S2 cells. B. The intron retention scores of the 2 biological replicates of S2 RpII215 C4 NUN RNA show a significant (p<0.01) high level of correlation (Spearman s ρ=0.631). C. The correlation between replicates improves when analysis is restricted to 10reads/bp (Spearman s ρ=0.749). D. The number of introns in genes that received an average of 3 reads/bp or more in wild-type and RpII215 C4 S2 cell NUN samples, as well as the overlap used for analysis between those samples.
16 Figure S15: Intron length (A), first position (B), and alternative annotation (C) continue to be significantly positively correlated with intron retention in S2 RpII215 C4 mutant NUN RNA. A. p<0.001, Kruskal-Wallis Test, all pairwise. B. p<0.001, Mann-Whitney U-Test. C. p<0.001, Mann-Whitney U-Test. D. The 3 SS ratios of alternative and constitutive first introns are not significantly different (p=0.480, Mann-Whitney U-Test).
17 Table S1: A list of all primers used in this paper. Primer To Sequence 28S rrna CGAAAGACCAATCGAACCATCTAG 28S rrna AGGGCTAGTTGCTTCGGCAGG 18S pre-rrna GGTGAACCTGCGGAAGGATCA 18S pre-rrna GAGGTTGCCAAGCCCCACACT GAPDH CTACCTGTTCAAGTTCGATTCGAC GAPDH AGTGGACTCCACGATGTATTCG PABP CTGCCTGGTCGAATCCAT PABP GCCATATTTGGTGATCAGGT rrna Antisense Oligo /5Biosg/AACTACTGGCAGGATCAACC rrna Antisense Oligo /5Biosg/TTCCAATTACAGGGCCTCGG rrna Antisense Oligo /5Biosg/TTTGGCAAATGCTTTCGCTT rrna Antisense Oligo /5Biosg/AACCAACAGGTACGGCTCCA rrna Antisense Oligo /5Biosg/AATATTTATTAACGGTAAGG rrna Antisense Oligo /5Biosg/ATGGGGTTTGCTATTTTGGG rrna Antisense Oligo /5Biosg/AGCCGAGTGATCCACCGCTT rrna Antisense Oligo /5Biosg/CGTTCAAAATGTCGATGTTC rrna Antisense Oligo /5Biosg/tacaaccctcaaccatatgtagtccaagca rrna Antisense Oligo /5Biosg/CGAACCAACGAAGAATAATAAC rrna Antisense Oligo /5Biosg/AACGTTATACGGGCCTCATT rrna Antisense Oligo /5Biosg/TTCAAGACGGGTCCCGAAGG rrna Antisense Oligo /5Biosg/AAGGTTCTTACCCATTTAAA rrna Antisense Oligo /5Biosg/GCGGATTTCGACTTCCATGA rrna Antisense Oligo /5Biosg/TGGAACCGTATTCCCTTTCG rrna Antisense Oligo /5Biosg/TTGTTTCCCAATCAAGGCCG rrna Antisense Oligo /5Biosg/CGCTAATTATTCCAAGCCCG rrna Antisense Oligo /5Biosg/GCCGAGCTTTTGCTGTCCCT rrna Antisense Oligo /5Biosg/GGTGATCGAAGATCCTCCCA rrna Antisense Oligo /5Biosg/TTGATGACGAGGTGTTTGGC rrna Antisense Oligo /5Biosg/CGAGGTGTTTGGCTACTCTT rrna Antisense Oligo /5Biosg/TGAGAGGTCGGCAACCACTG rrna Antisense Oligo /5Biosg/GCTAGCTTACACTACTATATCCATT rrna Antisense Oligo /5Biosg/TGAGAGGTCGGCAACCACTG rrna Antisense Oligo /5Biosg/CCATTCACTAAAATGGCTTT rrna Antisense Oligo /5Biosg/ACCCTCTGTCGTAAAACAGC rrna Antisense Oligo /5Biosg/TATTCCTATTATCCGCGGAG rrna Antisense Oligo /5Biosg/CCATTCGAATACGGCCATTT rrna Antisense Oligo /5Biosg/GCGATCGCTTGGTTTTAGCC rrna Antisense Oligo /5Biosg/AGCGTGGTATGGTCGTTGGC rrna Antisense Oligo /5Biosg/CGCCCGACGCTGCTTAATTT rrna Antisense Oligo /5Biosg/CACGCGGTGTTCCCAAGCGG
18 Table S2: Number of accepted hits for all sequencing done in this paper. Sample Replicate Accepted Hits S2 Cell pa S2 Cell pa S2 Cell NUN S2 Cell NUN Fly Head NUN Fly Head NUN S2 Cell RpII215 C S2 Cell RpII215 C
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Figure S1. nuclear extracts. HeLa cell nuclear extract. Input IgG IP:ORC2 ORC2 ORC2. MCM4 origin. ORC2 occupancy
A nuclear extracts B HeLa cell nuclear extract Figure S1 ORC2 (in kda) 21 132 7 ORC2 Input IgG IP:ORC2 32 ORC C D PRKDC ORC2 occupancy Directed against ORC2 C-terminus (sc-272) MCM origin 2 2 1-1 -1kb
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Development of conditions to convert 4-thiouridine (s 4 U) into a convertible nucleoside. Development of conditions to convert 4-thiouridine (s 4 U) into a convertible nucleoside.
Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Origin use and efficiency are similar among WT, rrm3, pif1-m2, and pif1-m2; rrm3 strains. A. Analysis of fork progression around confirmed and likely origins (from cerevisiae.oridb.org).
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Distribution of mirnas between lncrna and protein-coding genes. Pie chart showing distribution of human mirna between protein coding and lncrna genes. To the right, lncrna mirna
Genome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
Quantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
Supplementary Fig. 1
a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
Nature Immunology: doi: /ni Supplementary Figure 1. Control experiments for Figure 1.
Supplementary Figure 1 Control experiments for Figure 1. (a) Localization of SETX in untreated or PR8ΔNS1 virus infected A549 cells (4hours). Nuclear (DAPI) and Tubulin staining are shown. SETX antibody
Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis
Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat
Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat units in the human genome. Annotated transposable elements
Then, we went on to discuss genome expression and described: Microarrays
In the previous lecture, we have discussed: - classical sequencing methods - newer authomatic sequencing methods - solid-phase parallel sequencing - Next Generation mass-sequencing methods Then, we went
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
RNA standards v May
Standards, Guidelines and Best Practices for RNA-Seq: 2010/2011 I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable properties for quantification,
Thousands of corresponding human and mouse genomic regions unalignable in primary sequence contain. Elfar Þórarinsson February 2006
Thousands of corresponding human and mouse genomic regions unalignable in primary sequence contain common RNA structure Elfar Þórarinsson February 2006 It s interesting to note that: Approximately half
Figure S1. Figure S2 RT-PCR. qpcr RT-PCR. Northern. IVSwt ΔIVS IVS IVS IVS. NTC mock IVSwt ΔIVS IVS IVS. mock IVSwt ΔIVS
Figure S1 40 cycles IVS IVS IVS NTC wt Δ Δ mut pri-mirna163 * Fig. S1 Transcripts generated from the MIR163 gene variants in which splice sites have been mutated are not spliced. products were separated
APPLICATION NOTE. Abstract. Introduction
From minuscule amounts to magnificent results: reliable ChIP-seq data from 1, cells with the True MicroChIP and the MicroPlex Library Preparation kits Abstract Diagenode has developed groundbreaking solutions
Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum. Blood-stage Development
Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum Blood-stage Development Painter et al. 1 of 8 Supplementary Figure 1: Supplementary Figure
Journée de la Transcriptomique Végétale URGV-Génopôle
Journée de la Transcriptomique Végétale URGV-Génopôle Identification of PPR protein RNA substrates using omic approaches Hakim Mireau, INRA-IJPB Versailles The different genetic compartments of plant cells
Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
Supplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Zorbas et al. Fig S1: Positions of sirnas on transcripts targeted in this work, and sirna-mediated depletion efficiency A, The regions targeted
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Globin Block Modules for QuantSeq Instruction Manual
Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
SUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
Microarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
RNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
Sequence Annotation & Designing Gene-specific qpcr Primers (computational)
James Madison University From the SelectedWorks of Ray Enke Ph.D. Fall October 31, 2016 Sequence Annotation & Designing Gene-specific qpcr Primers (computational) Raymond A Enke This work is licensed under
BS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
ChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
ChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
Microarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
TECH NOTE Stranded NGS libraries from FFPE samples
TECH NOTE Stranded NGS libraries from FFPE samples Robust performance with extremely degraded FFPE RNA (DV 200 >25%) Consistent library quality across a range of input amounts (5 ng 50 ng) Compatibility
Supplementary Information
Supplementary Information Table of contents: Pages: Supplementary Methods 2-3 Supplementary Figure 1 4 Supplementary Figure 2 5 Supplementary Figure 3 6 Supplementary Figure 4 7 Supplementary Figure 5
Supplemental Figure 1 A
Supplemental Figure A prebleach postbleach 2 min 6 min 3 min mh2a.-gfp mh2a.2-gfp mh2a2-gfp GFP-H2A..9 Relative Intensity.8.7.6.5 mh2a. GFP n=8.4 mh2a.2 GFP n=4.3 mh2a2 GFP n=2.2 GFP H2A n=24. GFP n=7.
Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
CITE-seq & Cell Hashing Protocol
CITE-seq & Cell Hashing Protocol For experiments involving Cell Hashing, use cost per cell calculator to plan experiments, determine number of hashes, number of cells to load, expected doublet rates (detected
Fig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and
Fig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and transgenic Arabidopsis TPL-HA lysates. Immunoblotting of input
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
Applications and Sample Preparation for SOLiD Runs
Applications and Sample Preparation for SOLiD Runs 1. ChIP-Seq 3. Whole Transcriptome 4. Small RNA Rob David Field Applications Specialist SOLiD Support MAGnify ChIP-Seq Overview Overview of MAGnify ChIP
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification
Executive Summary. clinical supply services
clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive
SUPPLEMENTARY INFORMATION
doi:1.138/nature11233 Supplementary Figure S1 Sample Flowchart. The ENCODE transcriptome data are obtained from several cell lines which have been cultured in replicates. They were either left intact (whole
Transcriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
As a control to demonstrate that we could isolate PCR products that result from ligating
SUPPLEMENTAL INFORMATION (Mullen and Marzluff) RESULTS Oligo(dA) Clones and Oligo(dT) RT-PCR controls. As a control to demonstrate that we could isolate PCR products that result from ligating the authentic
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
Transcription & post transcriptional modification
Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity
High-quality stranded RNA-seq libraries from single cells using the SMART-Seq Stranded Kit Product highlights:
TECH NOTE High-quality stranded RNA-seq libraries from single cells using the SMART-Seq Stranded Kit Product highlights: Simple workflow starts directly from 1 1,000 cells or 10 pg 10 ng total RNA to generate
Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with
Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with transcription buffer with or without a high salt concentration
nature methods A paired-end sequencing strategy to map the complex landscape of transcription initiation
nature methods A paired-end sequencing strategy to map the complex landscape of transcription initiation Ting Ni, David L Corcoran, Elizabeth A Rach, Shen Song, Eric P Spana, Yuan Gao, Uwe Ohler & Jun
RNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
Cell Hashing Protocol
Cell Hashing Protocol For experiments involving Cell Hashing, use cost per cell calculator to plan experiments, determine number of hashes, number of cells to load, expected doublet rates (detected and
Zhang et al., RepID facilitates replication Initiation. Supplemental Information:
Supplemental Information: a b 1 Supplementary Figure 1 (a) DNA sequence of all the oligonucleotides used in this study. Only one strand is shown. The unshaded nucleotide sequences show changes from the
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
RNA-Seq Analysis. Simon Andrews, Laura v
RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+
Transcription Start Sites Project Report
Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:
Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C
CORRECTION NOTICE Nat. Genet. 47, 598 606 (2015) Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C Borbala Mifsud, Filipe Tavares-Cadete, Alice N Young, Robert Sugar,
Selected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
![Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G](/thumbs/95/123686269.jpg "Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G")
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
SunScript TM One Step RT-qPCR Kit
INDEX Ordering Information...3 Kit Contents...3 Shipping and Storage...3 Handling...3 Quality Control...3 Reagents and Equipment to be Supplied by the User...3 Description...4 Protocol...4 Troubleshooting
Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter
Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site
Introduction to genome biology
Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000
MODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
Transcriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
Finding Genes with Genomics Technologies
PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License
Applied Biosystems SOLiD 3 Plus System. RNA Application Guide
Applied Biosystems SOLiD 3 Plus System RNA Application Guide For Research Use Use Only. Not intended for any animal or human therapeutic or diagnostic use. TRADEMARKS: Trademarks of Life Technologies Corporation
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
SUPPLEMENTARY INFORMATION
18Pura Brain Liver 2 kb 9Mtmr Heart Brain 1.4 kb 15Ppara 1.5 kb IPTpcc 1.3 kb GAPDH 1.5 kb IPGpr1 2 kb GAPDH 1.5 kb 17Tcte 13Elov12 Lung Thymus 6 kb 5 kb 17Tbcc Kidney Embryo 4.5 kb 3.7 kb GAPDH 1.5 kb
mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification
mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification Ademtech * Bioparc BioGalien 27 Allée Charles Darwin * 33600 Pessac France Tel : + 33 (0) 57 02 02 01, Fax : + 33
How to deal with your RNA-seq data?
How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018
Supporting Information
Supporting Information Schnall-Levin et al. 10.1073/pnas.1006172107 SI Text Cell Transfections. S2R þ cells were maintained in Schneider s medium (Invitrogen), supplemented with 10% FBS and 1% pen-strep.
Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
PrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter
CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter SUPPLEMENTARY DATA See Supplementary Sequence File: 1 Supplementary Figure S1: The total protein was extracted from
From reads to results: differential. Alicia Oshlack Head of Bioinformatics
From reads to results: differential expression analysis with ihrna seq Alicia Oshlack Head of Bioinformatics Murdoch Childrens Research Institute Benefits and opportunities ii of RNA seq All transcripts
Targeted RNA sequencing reveals the deep complexity of the human transcriptome.
Targeted RNA sequencing reveals the deep complexity of the human transcriptome. Tim R. Mercer 1, Daniel J. Gerhardt 2, Marcel E. Dinger 1, Joanna Crawford 1, Cole Trapnell 3, Jeffrey A. Jeddeloh 2,4, John
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
Revised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
Nature Methods: doi: /nmeth Supplementary Figure 1. DMS-MaPseq data are highly reproducible at elevated DMS concentrations.
Supplementary Figure 1 DMS-MaPseq data are highly reproducible at elevated DMS concentrations. a, Correlation of Gini index for 202 yeast mrna regions with 15x coverage at 2.5% or 5% v/v DMS concentrations
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John
Bootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
supplementary information
DOI: 10.1038/ncb1862 Figure S1 Identification of SCAI as a Dia1 associating factor. (a) Identification of SCAI (Riken cdna 930041I02) as a Dia1-FH3 interacting protein. Mouse brain lysate was incubated
SQANTI: Classification, Curation and Quantification of a PacBio transcriptome
SQANTI: Classification, Curation and Quantification of a transcriptome Manuel Tardaguila, PhD Ana Conesa Lab in Oligodendrogenesis Neural Stem Cells (neurospheres) Oligodendrocyte Progenitor Cells Immature