Journée de la Transcriptomique Végétale URGV-Génopôle

3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves

Central Dogma Genes are units perpetuating themselves and functioning through their expression in the form of proteins 1 DNA RNA Protein 2 3 1. Replication 2. Transcription 3. Translation Spring 2002 21

Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.

Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out

Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.

Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)

Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow

Regulation of bacterial gene expression

Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

Motivation From Protein to Gene

MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

Finding Genes with Genomics Technologies

PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License

Applied Bioinformatics - Lecture 16: Transcriptomics

Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also

Chapter 6: Transcription and RNA Processing in Eukaryotes

3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation

Quiz Submissions Quiz 4

Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present

PrimePCR Assay Validation Report

Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family

Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.

Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

Nature Immunology: doi: /ni Supplementary Figure 1. Control experiments for Figure 1.

Supplementary Figure 1 Control experiments for Figure 1. (a) Localization of SETX in untreated or PR8ΔNS1 virus infected A549 cells (4hours). Nuclear (DAPI) and Tubulin staining are shown. SETX antibody

Functional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq

Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste

In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features

In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features Yiliang Ding, Yin Tang, Chun Kit Kwok, Yu Zhang, Philip C. Bevilacqua & Sarah M. Assmann (2014) Seminar RNA Bioinformatics

Genome annotation & EST

Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.

Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona

Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

Intro to RNA-seq. July 13, 2015

Intro to RNA-seq July 13, 2015 Goal of the course To be able to effectively design, and interpret genomic studies of gene expression. We will focus on RNA-seq, but the class will provide a foothold into

Computing with large data sets

Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application

Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John

Multiple choice questions (numbers in brackets indicate the number of correct answers)

1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318

SCBC203 Gene Expression Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 Rutaiwan.toh@mahidol.ac.th 1 Gene Expression Gene expression is a process where by the genetic

02 Agenda Item 03 Agenda Item

01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application

Applied Biosystems SOLiD 3 Plus System. RNA Application Guide

Applied Biosystems SOLiD 3 Plus System RNA Application Guide For Research Use Use Only. Not intended for any animal or human therapeutic or diagnostic use. TRADEMARKS: Trademarks of Life Technologies Corporation

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID peptidylglycine alpha-amidating monooxygenase PAM Human This gene encodes a multifunctional

PrimePCR Assay Validation Report

Gene Information Gene Name integrin, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ITGA1 Human This gene encodes the alpha 1 subunit of integrin

1. Cross-linking and cell harvesting

ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

PrimePCR Assay Validation Report

Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs

PrimePCR Assay Validation Report

Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

PrimePCR Assay Validation Report

Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by

Chapter 17. From Gene to Protein. AP Biology

Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

Selected Techniques Part I

1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

Next-generation sequencing technologies

Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html

Impact of Nutraceuticals on TERT gene encoded protein

Impact of Nutraceuticals on TERT gene encoded protein Xu Liu Department of Biological Sciences Fordham University, Bronx, New York, 10458 Abstract Telomerase is a Ribonucleo-protein polymerase that plays

Videos. Lesson Overview. Fermentation

Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

Gene Expression Technology

Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu *

RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu * School of Biomedical Sciences, Thomas Jefferson University, Philadelphia, USA *For correspondence:

PrimePCR Assay Validation Report

Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.

Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation

Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN

A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

PrimePCR Assay Validation Report

Gene Information Gene Name heat shock 10kDa protein 1 (chaperonin 10) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HSPE1 Human This gene encodes a major

TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA

TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

CHAPTER 4 Cloning, expression, purification and preparation of site-directed mutants of NDUFS3 and NDUFS7

CHAPTER 4 Cloning, expression, purification and preparation of site-directed mutants of NDUFS3 and NDUFS7 subunits of human mitochondrial Complex-I Q module N DUFS2, 3, 7 and 8 form the core subunits of

PrimePCR Assay Validation Report

Gene Information Gene Name 3-hydroxybutyrate dehydrogenase, type 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BDH1 Human This gene encodes a member of

Isolation of total nucleic acids from FFPE tissues using FormaPure DNA

APPLICATION NOTE Isolation of total nucleic acids from FFPE tissues using FormaPure DNA Jung Hoon Doh, Ph.D. Senior Application Scientist Beckman Coulter Life Sciences, Indianapolis, IN USA Summary Extensive

Activation of a Floral Homeotic Gene in Arabidopsis

Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg

Supplementary Materials

Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

High Pure RNA Isolation Kit for isolation of total RNA from 50 samples Cat. No

for isolation of total RNA from 50 samples Cat. No. 1 88 665 Principle A single reagent lyses the sample lysis and inactivates RNase. In the presence of a chaotropic salt (guanidine HCl), the released

Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1

INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot

Fig. S1 Fig. S3 Fig. S4 Fig. S5 Fig. S9 Legend for supplementary figures Fig. S1. RFLP analysis of A7339G clones Platelets from the patient were isolated by centrifugation mixed with mtdna-less rho-0

Supplementary Methods

Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

Figure S1. nuclear extracts. HeLa cell nuclear extract. Input IgG IP:ORC2 ORC2 ORC2. MCM4 origin. ORC2 occupancy

A nuclear extracts B HeLa cell nuclear extract Figure S1 ORC2 (in kda) 21 132 7 ORC2 Input IgG IP:ORC2 32 ORC C D PRKDC ORC2 occupancy Directed against ORC2 C-terminus (sc-272) MCM origin 2 2 1-1 -1kb

Application of NGS (next-generation sequencing) for studying RNA regulation

Application of NGS (next-generation sequencing) for studying RNA regulation SAIHST, SKKU Sung Wook Chi In this lecturre Intro: Sequencing Technology NGS (Next-Generation Sequencing) Sequencing of RNAs

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

Transcription steps. Transcription steps. Eukaryote RNA processing

Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016

Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

SUPPLEMENTARY INFORMATION

Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different

mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification

mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification Ademtech * Bioparc BioGalien 27 Allée Charles Darwin * 33600 Pessac France Tel : + 33 (0) 57 02 02 01, Fax : + 33

Annotating the Genome (H)

Annotating the Genome (H) Annotation principles (H1) What is annotation? In general: annotation = explanatory note* What could be useful as an annotation of a DNA sequence? an amino acid sequence? What

Computational Biology I

Computational Biology I Microarray data acquisition Gene clustering Practical Microarray Data Acquisition H. Yang From Sample to Target cdna Sample Centrifugation (Buffer) Cell pellets lyse cells (TRIzol)

Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide

Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide technology and the 10X Genomics Chromium Single Cell Gene Expression Solution Jocelyn G. Olvera, Brigid S. Boland, John T.

The Agilent Total RNA Isolation Kit

Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation

PrimePCR Assay Validation Report

Gene Information Gene Name bestrophin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BEST3 Human BEST3 belongs to the bestrophin family of anion channels

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

Deep Sequencing technologies

Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University

PrimePCR Assay Validation Report

Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the

Fatchiyah

Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification

Application Note 18 RNA/DNA/Protein Sample Preparation METHODS AND MATERIALS INTRODUCTION

Application Note 18 /DNA/Protein Sample Preparation Sequential Purification of, DNA and Protein from a Single Sample using 's /DNA/Protein Purification Kit and Comparison to a Market B. Lam, PhD 1, C.

Genes and How They Work. Chapter 15

Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

PrimePCR Assay Validation Report

Gene Information Gene Name peptidylprolyl isomerase A (cyclophilin A) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PPIA Human This gene encodes a member

ChIP-seq Protocol for RNA-Binding Proteins

ChIP-seq: Cells were grown according to the approved ENCODE cell culture protocols. Cells were fixed in 1% formaldehyde and resuspended in lysis buffer. Chromatin was sheared to 100-500 bp using a Branson

ChIP-seq and RNA-seq

ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)

Lecture 22 Eukaryotic Genes and Genomes III

Lecture 22 Eukaryotic Genes and Genomes III In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand full of genes.

MRC-Holland MLPA. Description version 15; 23 July 2015

SALSA MLPA probemix P125-B1 Mitochondria Lot B1-0312 B1-0609. Compared to the previous version of this product (lots A1-0606, A1-1105), four probes have been replaced and six extra mitochondrial probes

Chapter 13. From DNA to Protein

Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

Transcription: Synthesis of RNA

Transcription: Synthesis of RNA The flow of information in the cells (the central dogma of molecular biology): Transcription = RNA synthesis on a DNA template. The mrna will provide the information for

PrimePCR Assay Validation Report

Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

PrimePCR Assay Validation Report

Gene Information Gene Name sortilin 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORT1 Human This gene encodes a protein that is a multi-ligand type-1