Supplemental Information

Size: px
Start display at page:

Download "Supplemental Information"

Transcription

1 Cell Stem Cell, Volume 15 Supplemental Information Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts Riguo Fang, Kang Liu, Yang Zhao, Haibo Li, Dicong Zhu, Yuanyuan Du, Chengang Xiang, Xiang Li, Haisong Liu, Zhenchuan Miao, Xing Zhang, Yan Shi, Weifeng Yang, Jun Xu, Hongkui Deng

2 Figure S1, related to Figure 1, 2 (A) RT-PCR analysis of pluripotency marker gene expression in retroviral induced (OK-1, OK-2, OK-3) and episomal vectors-induced (EV-1, EV-2, EV-3) rhesus monkey primed ipscs. Endo indicates endogenous gene expression. (B) Representative images of retroviral-induced and episomal vectors-induced rhesus

3 monkey primed ipsc colonies after staining for ALP or immunostaining for OCT4, SOX2, NANOG and TRA Scale bars: 100 µm. (C) Silenced exogenous gene expression in rhesus monkey primed ipscs (OK-1, OK-2, and OK-3). Exo indicates exogenous genes. OKG-D7: fibroblasts after infection of retroviral-oct4, KLF4 and GFP for 7 days) (D) Genomic PCR demonstrated that the rhesus monkey primed ipsc lines (OK-1, OK-2, and OK-3) have been integrated with OCT4, KLF4, and GFP. pmx indicates exogenous genes. (E) Quantitative RT-PCR analysis of the expression of all exogenous transcription factor genes. All values are mean ± s.e.m from 3 independent experiments. (F) Quantitative RT-PCR analysis of the losing of episomal vectors integrated into the genome of established primed ipsc lines. Fibro-D6: fibroblasts after infection of episomal vectors for 6 days; EViPS-1, 2: 2 primed ipsc lines established by episomal vectors system. All values are mean ± s.e.m from 3 independent experiments. (G) In vivo teratoma differentiation of rhesus monkey primed ipscs. Primed ipscs formed teratomas with cells from the three germ lineages: endoderm, ectoderm and mesoderm. Scale bars, 100 µm. (H) Rhesus monkey naïve ipscs were expanded under basal conversion conditions with the tested signaling modulators for 5 days after plating. Pluripotency maintenance was measured by the proportion of TBX3 or TRA-1-81-single positive colonies among the total colonies. Negative control: 2i/LIF + bfgf. All values are mean ± s.e.m from 3 - well replicates.

4 Figure S2, related to Figure 2 (A) Representative images of rhesus monkey fibroblasts transduced with OCT4, SOX2, KLF4 and GFP (above). Directly converted naïve ipsc colonies showed silenced exogenous GFP expression (bottom). Scale bars, 100 µm. (B) RT-PCR analysis of pluripotency marker gene expression in rhesus monkey

5 directly converted naïve ipscs (DRN-1, DRN-2, DRN-3), female naïve ipscs (FN-1, FN-2, FN-3) and episomal-induced naïve ipscs (EVN-1, EVN-2, EVN-3). (ES-7.5: rhesus monkey ES line). (C) Representative images of rhesus monkey directly converted naïve ipscs, female naïve ipscs and episomal induced naïve ipscs after staining for ALP or immunostaining for OCT4, SOX2, NANOG, TRA-1-81, TRA-1-60 and SSEA-4. Scale bars, 100 µm. (D) Karyotype analysis showing the normal karyotypes of rhesus monkey directly converted naïve ipscs and female naïve ipscs. The passage number at which cells were collected for karyotyping is indicated. (E) In vivo teratoma differentiation of rhesus monkey directly converted naïve ipscs. Naïve ipscs can form teratomas with cells from the three germ lineages, endoderm, ectoderm and mesoderm. Scale bars, 100 µm.

6 Figure S3, related to Figure 3 (A) Rhesus monkey naïve ipscs were expanded under optimized conversion conditions (2i/LIF+bFGF+SP SB203580). In addition, 2 ng/ml TGF-β1 alone and 2 ng/ml TGF-β1 with 10 µm SB (TGF-βR inhibitor) were tested. Pluripotency maintenance was measured by the fold change in TRA-1-81 positive

7 dome-shaped colonies relative to the control (2i/LIF+bFGF+SP SB203580). The morphology of ipscs under the different conditions is shown on the right. Scale bars, 100 µm. All values are mean ± s.e.m from 3 - well replicates. (B) Rhesus monkey naïve ipscs were expanded under optimized conversion conditions (2i/LIF+bFGF+SP SB203580). Different concentrations of Ly were tested as indicated for 5 days. Pluripotency maintenance was measured by the number of TRA-1-81 positive dome-shaped colonies. All values are mean ± s.e.m from 3 - well replicates. (C) Representative images of rhesus monkey naïve ipsc colonies under different concentration of Ly were shown after immunostaining for TRA Scale bars, 100 µm. (D) Gene ontology (GO) analysis showing up and down regulated signaling pathway-related gene categories between monkey naïve and primed ipscs. (E) Overlap of genes with more than 2 fold-increased expression in rhesus monkey naïve ipscs, compared with primed ipscs with genes that show increased expression in human naïve ipscs as compared to primed ipscs as previous reported or genes that show increased expression in human ICM cells as compared to hescs. Significance score was determined using Fisher's exact test.

8 Figure S4, related to Figure 4 (A) Representative images of fibroblasts from mouse, human and rhesus monkey, after immunostaining with an anti-human nuclei antibody. The human nuclei monoclonal antibody reacts specifically with human and rhesus monkey cells; it

9 shows no reactivity against mouse cells. Scale bars, 100 µm. (B) Representative images showing integration of rhesus monkey naïve ipscs into different locations in the whole body of an E10.5 mouse embryo, after whole-mount immunostaining with an anti-human nuclei antibody and confocal analysis. DAPI was used for counterstaining. Scale bars: 150 µm. The second and third columns show a magnified images focusing on the head region (yellow square) where the rhesus monkey ipscs -derived cells (green) are noted (z-stack interval 10 µm; 7 focal-planes total) where the rhesus monkey ipscs - derived cells (green) are noted (z-stack interval 10 µm; 7 focal-planes total). Scale bars: 150 µm. Obvious integration was not detected in the control primed ipscs -injected mouse embryo (lower panels). Z-stack interval 10 µm; 7 focal-planes total. (C) Representative whole-embryo confocal images showing chimeric E16d embryos after the whole embryo was embedded, frozen and sliced (10 µm thick slices), then co-stained with an anti-human nuclei antibody and the pluripotent specific markers OCT4 and NANOG. Scale bars: 1.2 mm. In zoomed in areas: 600 µm. (D) Summary of cross-species chimeric assay.

10 Table S1 related to Figure 2,3 and Figure S1, S2 - List of primers used in this study. Primers for Quantitate RT- PCR DLL1- S DLL1- A NANOG- S NANOG- A PRDM14- S PRDM14- A XIST- S XIST- A endo OCT4- S endo OCT4- A endo SOX2- S endo SOX2- A endo c- MYC- S endo c- MYC- A endo KLF4- S endo KLF4- - A CRIPTO- S CRIPTO- A DNMT3B- S DNMT3B- A SALL4- S SALL4- A NANOG- S NANOG- A DPPA2- S DPPA2- A LIN28- S LIN28- A GAPDH- S GAPDH- A XIST- S XIST- A pmx- S pmx OCT4- A pmx SOX2- A pmx KLF4- A GATTCTCCTGATGACCTCGCA TCCGTAGTAGTGTTCGTCACA GATTTGTGGGCCTGAAGAAA CAGATCCATGGAGGAAGGAA AATCATTGGTGGCGACAACGA CCCGTACAGAACGAAGTGCAG TAATGTGCCAGATACCATGCTGGG ACTTAACCTCACCAGTAAAGTCTTGAT Primers for RT- PCR CAGATCAGCCACATTGCCCAG CAAAAGCCCTGGCACAAACTCT GGTTACCTCTTCCTCCCACTCC CCTCCCATTTCCCTCGTTTT GCGTCGTGGGAAGGGAGATAC CACCGAGTCGTAGTCGAGGTCATA TTTTCGGTTTTGGCTTCGTTTC GTCCAGGTCCAGGAGATCGTTG CCCATGGGGATACAGCACAG AAGGCAGATGCCAACTAGCA GGTGGAGGCAGACAGTGGA TGGTACATGGCTTTTCGATAGG CGACTCGTCCTCGCTGATA CCATGTTGCTTGGCCTGT CCTATGCCTGTGATTTGTGGG AGGTTGTTTGCCTTTGGGAC CCCCTCCCTTGCCAACCATT CACTGCCTTGCGTTTCCTCGA GTTCGGCTTCCTGTCCAT CACTCCCAATACAGAACACCC AATCCCATCACCATCTTCCAGGAG CACCCTGTTGCTGTAGCCAAATTC TAATGTGCCAGATACCATGCTGGG ACTTAACCTCACCAGTAAAGTCTTGAT Primers for Genomic- PCR CCTCAAAGTAGACGGCATCGCA TTATTCGGGGCACCTGCTTGA AACCTGAGGCCCACAGTACGC CTCCGACAAAAGTTTCCACTCTGC

11 pmx c- MYC- A pmx GFP- A EBNA- 1- S EBNA- 1- A AGGCGTGACCGCAACGTAGG GGGGTAGCGGCTGAAGCACT ATCAGGGCCAAGACATAGAGATG GCCAATGCAACTTGGACGTT Table S2 related to Figure 1-4 and Figure S1 - S4. Summary of established rhesus monkey naïve ipsc lines

12 Supplemental Experimental Procedures Cell culture Primary rhesus monkey skin fibroblasts were isolated from the ear edge of 2-year-old rhesus monkey. Fibroblasts and 293T cells were cultured in Dulbecco s modified Eagle s medium (DMEM; Hyclone) containing 10% fetal bovine serum (Invitrogen). Rhesus monkey embryonic stem (ES) cells (ES-7.5), established by Thomson et al. (Thomson J A et al., 1995), and rhesus monkey primed ipscs were cultured and passaged as previously described (Liu H et al., 2008). Rhesus monkey naïve ipscs were cultured in optimized conversion medium consisting of 85% KnockOut DMEM (KO-DMEM, Invitrogen), 15% KnockOut serum replacement (KSR, Invitrogen), N2 supplement (100X, Invitrogen), 1 mm L-Glutamine, 0.1 mm NEAA, 0.1 mm 2-ME with 4 ng/ml bfgf (R&D systems), 10 ng/ml human LIF (Millipore), CHIR99021 (3 µm; Stemgent), PD (0.5 μm; Stemgent), SB (10 µm; Tocris) and SP (10 µm; Tocris). Rhesus monkey naïve ipscs were single-cell passaged every 4 days using accutase (Millipore) on feeder cells. The medium was changed daily. Retroviral infection and rhesus monkey primed ipsc generation Retroviral vectors containing reprogramming factors (OCT4, KLF4) were described in a previous report (Liu H et al., 2008). Retrovirus production, collection and infection were also conducted as described (Liu H et al., 2008 and Zhao, Y et al., 2008).

13 Medium supplemented with the small molecules VPA (0.5 mm; Sigma), CHIR99021 (3 µm; Stemgent), (1 µm; Calbiochem) and tranylcypromine (5 µm; Tocris) was changed every 2 days. Rhesus monkey primed ipsc colonies were selected around day 25 to day 35 after viral transduction and maintained on feeder cells in the culture conditions for rhesus monkey primed ipscs. Generation of rhesus monkey naïve ipscs from primed ipscs Rhesus monkey primed ipscs were dissociated into single cells by accutase and reseeded on feeder cells. The converting medium with 4 ng/ml bfgf (R&D Systems), 10 ng/ml human LIF (Millipore), CHIR99021 (3 µm; Stemgent) and PD (0.5 µm; Stemgent) was changed daily. At approximately day 7 to day 10, dome-shaped colonies were selected and transferred onto fresh feeder cells,traditional 2i/LIF conditions - 10 ng/ml human LIF (Millipore), CHIR99021 (3 µm; Stemgent) and PD (0.5 µm; Stemgent) were also tested and served as negative control. Conversion condition optimization for rhesus monkey naïve ipscs Rhesus monkey primed ipscs were dissociated into single cells by accutase and reseeded on feeder cells. The basal culture medium with 4 ng/ml bfgf (R&D Systems), 10 ng/ml human LIF (Millipore), CHIR99021 (3 µm; Stemgent) and PD (0.5 µm; Stemgent) was changed daily. The small molecules tested for culture condition optimization were SB (10 µm; Tocris), SP (10 µm;

14 Tocris), Y27632 (10 µm; Tocris) and GÖ6983 (5 µm; Tocris). After treatment for 8 days, cells were fixed and immunostained for TRA Direct conversion of naïve ipscs from rhesus monkey fibroblasts Retroviral vectors containing reprogramming factors (OCT4, SOX2 and KLF4) were as described (Liu H et al., 2008). Basal medium (KO-DMEM, 15%KSR) was changed every 2 days after infection. At approximately day 20, the medium was exchanged for optimized conversion medium containing 4 ng/ml bfgf (R&D Systems), 10 ng/ml human LIF (Millipore), CHIR99021 (3 µm; Stemgent), PD (0.5 μm; Stemgent), SB (10 µm; Tocris) and SP (10 µm; Tocris) for another 7 to 10 days. Then, dome-shaped colonies were selected and transferred onto fresh feeder cells. Signaling analysis of rhesus monkey primed ipscs and naïve ipscs Rhesus monkey primed ipscs were maintained as described (Liu H et al., 2008). Rhesus monkey naïve ipscs were maintained in the optimized medium with 4 ng/ml bfgf (R&D Systems), 10 ng/ml human LIF (Millipore), CHIR99021 (3 µm; Stemgent), PD (0.5 µm; Stemgent), SB (10 µm; Tocris) and SP (10 µm; Tocris). The tested signaling modulators were SU5402 (2 µm;tocris), SB (10 µm;tocris), Stattic (1 µm;tocris) and TGF-β1 (2 ng/ml, Peprotech). After treatment for 5 days, cells were fixed and immunostained for TRA-1-81.

15 Alkaline phosphatase (ALP) detection and immunofluorescence To detect ALP activity, we washed the cells with phosphate-buffered saline three times and stained with BCIP/NBT (Promega) for 15 min. For immunofluorescence, the primary antibodies included those against SSEA-1 (1:50, Chemicon), SSEA-4 (1:20, Santa Cruz Biotechnology), TRA-1-60 (1:50, Santa Cruz Biotechnology), TRA-1-81 (1:50, Santa Cruz Biotechnology), NANOG (1:100, R&D Systems), TBX3 (1:200, Abcam), H3K27me3 (1:200, Millipore), GATA4 (1:200, Santa Cruz Biotechnology), OCT4 (1:200, Abcam) and SOX2 (1:200, Santa Cruz Biotechnology). The secondary antibodies were rhodamine-labeled donkey anti-mouse IgG (1:100, Santa Cruz Biotechnology), rhodamine-labeled donkey anti-rabbit IgG (1:100, Santa Cruz Biotechnology), rhodamine-labeled goat anti-mouse IgM (1:100, Santa Cruz Biotechnology) and rhodamine-labeled donkey anti-goat IgG (1:100, Santa Cruz Biotechnology). DAPI (Roche Applied Science) was used for nuclear staining. RT-PCR and genomic PCR Total RNA was isolated from cells using TRIzol (Invitrogen) and reverse transcribed using EasyScript Reverse Transcriptase (TransGen Biotech) according to the manufacturer s protocol. PCR amplification of different genes was performed using 2 EasyTaq SuperMix (TransGen Biotech). For genomic PCR, genomic DNA was

16 extracted with the DNeasy Blood & Tissue Kit (QIAGEN). The primers used are listed in Supplementary Information, Table S1. Real-time PCR Total RNA from an entire well of cultured cells was isolated using the RNeasy Plus Mini Kit (QIAGEN). RNA was converted to cdna using TransScript First-Strand cdna Synthesis SuperMix (TransGen Biotech). PCR was conducted using Power SYBR Green PCR Master Mix (Applied Biosystems) on an ABI Prism 7300 Sequence Detection System. The data were analyzed using the delta-delta Ct method. The primers used for real-time PCR are listed in Table S1. Teratoma Formation Rhesus monkey naïve and primed ipscs were harvested and resuspended in DF12 medium. Cells from a confluent 60-mm dish were subcutaneously injected into a non-obese diabetes/severe-combined immunodeficient (NOD/SCID) mouse (China). Teratomas formed after 6-8 weeks for rhesus monkey primed ipscs and after 4-5 weeks for naïve ipscs. The teratomas were then embedded in paraffin and processed for hematoxylin and eosin staining. Mouse embryo micromanipulation, whole-mount staining and imaging

17 For naïve and primed ipscs injection, cells were trypsinized and microinjected into 8-cell stage embryos or E3.5 blastocysts of ICR diploid mouse embryo (6 10 cells per embryo). Approximate 15 injected embryos were transferred to each uterine horn of 2.5 days post coitum pseudo-pregnant females. Embryos were dissected at E10-11 developmental stages for whole-mount staining with anti-human nuclei antibody (clone 235-1, 1:200, Millipore) under the whole-mount staining procedure from Abcam. For whole-embryo sliced specimen imaging, embryos were dissected at the E16 developmental stages, following by embedding, freezing and slicing (10 µm thick slices), then co-staining with anti-human nuclei antibody and GATA4 (1:200, Santa Cruz Biotechnology ) or OCT4 (1:200, Abcam) and NANOG (1:200, R&D). For confocal analysis, mounted embryos and sliced species were imaged by UltraVIEW VoX systems (PerkinElmer), Andor's Revolution WD spinning disk confocal microscopy system (Andor) or ImageXpress Micro High Content Screening System (MolDev). Karyotype analysis G-band chromosomal analysis was performed at the Peking University Center of Medical Genetics. Supplemental References Liu, H., Zhu, F., Yong, J., Zhang, P., Hou, P., Li, H., Jiang, W., Cai, J., Liu, M., Cui, K., et

18 al. (2008). Generation of induced pluripotent stem cells from adult rhesus monkey fibroblasts. Cell Stem Cell 3, Thomson, J.A., Kalishman, J., Golos, T.G., Durning, M., Harris, C.P., Becker, R.A., and Hearn, J.P. (1995). Isolation of a primate embryonic stem cell line. Proc Natl Acad Sci U S A 92, Zhao, Y., Yin, X., Qin, H., Zhu, F., Liu, H., Yang, W., Zhang, Q., Xiang, C., Hou, P., Song, Z., et al. (2008). Two supporting factors greatly improve the efficiency of human ipsc generation. Cell Stem Cell 3,

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Supplementary Information A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Bahram Valamehr, Ramzey Abujarour, Megan Robinson, Thuy Le, David Robbins,

More information

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10.

SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10. Supplementary Data SUPPLEMENTARY FIG. S1. Lentivirus-infected canine fibroblasts show YFP expression. (A, B) Uninfected canine skin fibroblasts (CSFs); (C, D) infected CSFs; (E, F) uninfected CTFs; (G,

More information

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

More information

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%

More information

Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency

Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency nature methods Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency Akitsu Hotta, Aaron Y L Cheung, Natalie Farra, Kausalia Vijayaragavan, Cheryle A Séguin, Jonathan S Draper,

More information

Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells

Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the transduction and reprogramming of one well of Oct4-GFP mouse embryonic fibroblasts (MEF) using the Dox Inducible Reprogramming Polycistronic

More information

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP

Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency

More information

Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts

Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts Short Article Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts Graphical Abstract Authors Riguo Fang, Kang Liu,..., Jun Xu, Hongkui Deng Correspondence jun_xu@pku.edu.cn

More information

The p53-puma axis suppresses ipsc generation

The p53-puma axis suppresses ipsc generation The p53-puma axis suppresses ipsc generation Yanxin Li, Haizhong Feng, Haihui Gu, Dale W. Lewis, Youzhong Yuan, Lei Zhang, Hui Yu, Peng Zhang, Haizi Cheng, Weimin Miao, Weiping Yuan, Shi-Yuan Cheng, Susanne

More information

Jing Liao, Chun Cui, Siye Chen, Jiangtao Ren, Jijun Chen, Yuan Gao, Hui Li, Nannan Jia, Lu Cheng, Huasheng Xiao, and Lei Xiao

Jing Liao, Chun Cui, Siye Chen, Jiangtao Ren, Jijun Chen, Yuan Gao, Hui Li, Nannan Jia, Lu Cheng, Huasheng Xiao, and Lei Xiao Cell Stem Cell, Volume 4 Supplemental Data Generation of Induced Pluripotent Stem Cell Lines from Adult Rat Cells Jing Liao, Chun Cui, Siye Chen, Jiangtao Ren, Jijun Chen, Yuan Gao, Hui Li, Nannan Jia,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature08267 Figure S: Karyotype analysis of ips cell line One hundred individual chromosomal spreads were counted for each of the ips samples. Shown here is an spread at passage 5, predominantly

More information

APPLICATION NOTE Page 1

APPLICATION NOTE Page 1 APPLICATION NOTE Page 1 Generation of ips Cells from Oct4-Neo Reporter Embryonic Fibroblasts Dongmei Wu, Yan Gao, Charles Martin, Xun Cheng, Wen Xiong, Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle St.,

More information

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence

More information

Chemically defined conditions for human ipsc derivation and culture

Chemically defined conditions for human ipsc derivation and culture Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

More information

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts

More information

Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM

Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM STEMGENT Page 1 Reprogramming Lentivirus Set: Human OKSM OVERVIEW The following procedure describes the reprogramming of BJ Human Fibroblasts (BJ cells) to induced pluripotent stem (ips) cells using the

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

NIA Aging Cell Repository

NIA Aging Cell Repository Certificate of Analysis NIA Aging Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: AG25370*B Diagnosis Alzheimer Disease, Familial, Type 4 Mutation Reprogramming method Publication(s) describing

More information

Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B

Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B Certificate of Analysis NIGMS Human tic Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B Diagnosis Mutation Reprogramming method Publication(s) describing ipsc line establishment

More information

Assuring Pluripotency of ESC and ipsc Lines

Assuring Pluripotency of ESC and ipsc Lines Assuring Pluripotency of ESC and ipsc Lines Introduction Compared to other cell types, stem cells have the unique ability to self-renew their populations by dividing into identical daughter stem cells

More information

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and

More information

hpsc Growth Medium DXF Dr. Lorna Whyte

hpsc Growth Medium DXF Dr. Lorna Whyte hpsc Growth Medium DXF Dr. Lorna Whyte 27.06.2014 Training from Heidelberg Overview Background: Stem Cells Introduction: Human Pluripotent Stem Cells (hpsc) vs. Adult Stem Cells Promise of PSC Research

More information

Supplementary Figure 1 Characterization of OKSM-iNSCs

Supplementary Figure 1 Characterization of OKSM-iNSCs Supplementary Figure 1 Characterization of OKSM-iNSCs (A) Gene expression levels of Sox1 and Sox2 in the indicated cell types by microarray gene expression analysis. (B) Dendrogram cluster analysis of

More information

bfgf Supports Human ES Cell Self- Renewal

bfgf Supports Human ES Cell Self- Renewal APPLICATION NOTE Page 1 bfgf Supports Human ES Cell Self- Renewal Authors: Dongmei Wu, Wen Xiong, Yan Gao, Kristine Guerrero, Yi Chen, Liming Yang, Yang Liu, and Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2239 Hepatocytes (Endoderm) Foreskin fibroblasts (Mesoderm) Melanocytes (Ectoderm) +Dox rtta TetO CMV O,S,M,K & N H1 hes H7 hes H9 hes H1 hes-derived EBs H7 hes-derived EBs H9 hes-derived

More information

hipscs were derived from human skin fibroblasts (CRL-2097) by ectopic

hipscs were derived from human skin fibroblasts (CRL-2097) by ectopic Generation and characterization of hipscs hipscs were derived from human skin fibroblasts (CRL-2097) by ectopic expression of OCT4, SOX2, KLF4, and C-MYC as previously described 1. hipscs showed typical

More information

Disease Clinical features Genotype

Disease Clinical features Genotype Disease Clinical features Genotype Alpha 1 Antitrypsin deficiency (A1ATD) Patient 1 65 year old caucasian male, liver transplant recipient, explant biopsy confirmed A1ATD induced liver cirrhosis Patient

More information

Derivation of UCSFB lines from biopsied blastomeres of cleavage-stage human. Spare embryos were obtained through the UCSF IVF Tissue Bank from donors

Derivation of UCSFB lines from biopsied blastomeres of cleavage-stage human. Spare embryos were obtained through the UCSF IVF Tissue Bank from donors Supplementary Materials and Methods Derivation of UCSFB lines from biopsied blastomeres of cleavage-stage human embryos Spare embryos were obtained through the UCSF IVF Tissue Bank from donors undergoing

More information

CULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION. Stem Cell Research Solutions Promotional offers

CULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION. Stem Cell Research Solutions Promotional offers CULTURE ENGINEERING DIFFERENTIATION CHARACTERIZATION Stem Cell Research Solutions Promotional offers Stem Cell research products For more than a decade, we have provided you with key tools to address challenges

More information

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Soonbong Baek, 1 Xiaoyuan Quan, 1 Soochan Kim, 2 Christopher Lengner, 3 Jung- Keug Park, 4 and Jongpil Kim 1* 1 Lab

More information

Suggested Method Reprogramming MEF Cells into pips Cells using the Stemgent Recombinant Human Protein Set: OSKM-11R

Suggested Method Reprogramming MEF Cells into pips Cells using the Stemgent Recombinant Human Protein Set: OSKM-11R Page 1 Reprogramming MEF Cells into pips Cells using the Cat. No. 00-0062 OVERVIEW The procedure outlined below describes the reprogramming of mouse embryonic fibroblasts (MEF) by the addition of four

More information

Generation of Nkx2.1+ lung endoderm and Nkx2.1+Sox2+ proximal airway progenitors from human embryonic stem cells and ips cells

Generation of Nkx2.1+ lung endoderm and Nkx2.1+Sox2+ proximal airway progenitors from human embryonic stem cells and ips cells Generation of Nkx2.1+ lung endoderm and Nkx2.1+Sox2+ proximal airway progenitors from human embryonic stem cells and ips cells Hongmei Mou Rajagopal Lab March 2012 Step I: Protocol to induce definitive

More information

SUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and

SUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and SUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and first strand cdna was synthesized using 1 μg of RNA and

More information

Nature Biotechnology: doi: /nbt.4166

Nature Biotechnology: doi: /nbt.4166 Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure S1 Colony-forming efficiencies using transposition of inducible mouse factors. (a) Morphologically distinct growth foci appeared from rtta-mefs 6-8 days following PB-TET-mFx cocktail

More information

Supplemental Information. Direct Reprogramming of Fibroblasts. via a Chemically Induced XEN-like State

Supplemental Information. Direct Reprogramming of Fibroblasts. via a Chemically Induced XEN-like State Cell Stem Cell, Volume 21 Supplemental Information Direct Reprogramming of Fibroblasts via a Chemically Induced XEN-like State Xiang Li, Defang Liu, Yantao Ma, Xiaomin Du, Junzhan Jing, Lipeng Wang, Bingqing

More information

SCIENCE CHINA Life Sciences. A novel strategy to derive ips cells from porcine fibroblasts

SCIENCE CHINA Life Sciences. A novel strategy to derive ips cells from porcine fibroblasts SCIENCE CHINA Life Sciences RESEARCH PAPERS June 2011 Vol.54 No.6: 553 559 doi: 10.1007/s11427-011-4179-5 A novel strategy to derive ips cells from porcine fibroblasts RUAN WeiMin 1, HAN JianYong 1,2,

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11272 Supplementary Figure 1. Experimental platform for epigenetic reversion of murine EpiSCs back to naïve ground state pluripotency. a, NGFP1 naïve-ipscs (40XY) expanded in 2i/LIF defined

More information

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4

More information

Biology Open (2015): doi: /bio : Supplementary information

Biology Open (2015): doi: /bio : Supplementary information Fig. S1. Verification of optimal conditions for the generation of LIF-dependent inscs Representative images (from five repeat experiments) of human primary fibroblasts undergoing reprogramming for 21 days

More information

Nature Medicine doi: /nm.2548

Nature Medicine doi: /nm.2548 Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)

More information

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. kda 65 45 45 35 Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. H9 hescs were differentiated with or without BMP4+BMP8A and cell lysates were collected for Western analysis

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin

More information

ADVANCED MEDIA TECHNOLOGY

ADVANCED MEDIA TECHNOLOGY ADVANCED MEDIA TECHNOLOGY For Human ES and ips Cell Research The right medium makes all the difference in ensuring successful ES and ips cell culture. Stemgent offers high-quality, chemically-defined,

More information

Episomal ipsc Reprogramming Vectors FAQs

Episomal ipsc Reprogramming Vectors FAQs About Episomal ipsc Reprogramming Vectors Episomal ipsc Reprogramming Vectors Catalog Number A14703 1. What are induced pluripotent stem cells (ipscs)? ipscs are genetically reprogrammed somatic cells

More information

EZ-iPSC Generation kit - EPISOMAL. ASK-3013 (Episomal vector based ipsc reprogramming kit)

EZ-iPSC Generation kit - EPISOMAL. ASK-3013 (Episomal vector based ipsc reprogramming kit) Applied StemCell, Inc. (866) 497-4180 www.appliedstemcell.com Datasheet EZ-iPSC Generation kit - EPISOMAL Product Information Catalog Number Description ASK-3013 (Episomal vector based ipsc reprogramming

More information

Frequently Asked Questions Stem Cells

Frequently Asked Questions Stem Cells Q: Do you add antibiotics to your media? A: Coriell does not use antibiotics when culturing stem cells. Customers should be aware that inclusion of antibiotics in media may change growth characteristics

More information

TITLE: Induced Pluripotent Stem Cells as Potential Therapeutic Agents in NF1

TITLE: Induced Pluripotent Stem Cells as Potential Therapeutic Agents in NF1 AD Award Number: W81XWH-10-1-0181 TITLE: Induced Pluripotent Stem Cells as Potential Therapeutic Agents in NF1 PRINCIPAL INVESTIGATOR: Jonathan Chernoff, M.D., Ph.D. CONTRACTING ORGANIZATION: Institute

More information

T-iPSC. Gra-iPSC. B-iPSC. TTF-iPSC. Supplementary Figure 1. Nature Biotechnology: doi: /nbt.1667

T-iPSC. Gra-iPSC. B-iPSC. TTF-iPSC. Supplementary Figure 1. Nature Biotechnology: doi: /nbt.1667 a T-iPSC Gra-iPSC B-iPSC TTF-iPSC Ectoderm Endoderm Mesoderm b Nature Biotechnology: doi:.38/nbt.667 Supplementary Figure Klf4 transgene expression Oct4 transgene expression.7 Fold GAPDH.6.5.4.3 Fold GAPDH

More information

Induced Pluripotent Stem Cell

Induced Pluripotent Stem Cell Induced Pluripotent Stem Cell When eventually mastered, the processes involved in the obtaining, cultivating and differencing ESC into cells of clinical interest, another practical limitation should be

More information

Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.

Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1. LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

BF EGFP DsRed. Relative Expression. Day 10 SOX Log2(FPKM + 1)_BCL2L1. Log2(FPKM + 1)_Control

BF EGFP DsRed. Relative Expression. Day 10 SOX Log2(FPKM + 1)_BCL2L1. Log2(FPKM + 1)_Control A B C D L-hESCs TetO L ADsRed IRESNEO TetO ADsRed IRESNEO OCT/DNA Ubc rtta NANOG/DNA E BF EGFP DsRed F Relative Expression..... SOX7 Endoderm..... CXCR..... T Mesoderm..... Relative Expression.6....8.6..

More information

Supplementary Materials and Methods:

Supplementary Materials and Methods: Supplementary Materials and Methods: Preclinical chemoprevention experimental design Mice were weighed and each mammary tumor was manually palpated and measured with digital calipers once a week from 4

More information

produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing

produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing Supplementary Figure 1 Characterisation of newly produced laminins. Human recombinant LN-521 produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing 1 and non-reducing conditions.

More information

Cat# Product Name amounts h NANOG (RFP-Bsd) inducible particles

Cat# Product Name amounts h NANOG (RFP-Bsd) inducible particles Premade Lentiviral Particles for ips Stem Factors For generating induced pluripotent stem (ips) cells or other applications. LVP003 LVP004 LVP005 LVP006 LVP007 LVP008 RESEARCH USE ONLY, not intend for

More information

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,

More information

Application Note. Laminin/Entactin Complex: A Feeder-Free Surface for Culture of Human Embryonic Stem Cells. Introduction

Application Note. Laminin/Entactin Complex: A Feeder-Free Surface for Culture of Human Embryonic Stem Cells. Introduction Laminin/Entactin Complex: A Feeder-Free Surface for Culture of Human Embryonic Stem Cells Deepa Saxena, Ph.D. and Susan Qian, Ph.D. Corning Incorporated, Tewksbury, MA, USA Application Note Contents 1

More information

A Survey of Genetic Methods

A Survey of Genetic Methods IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA

More information

Human Pluripotent Stem Cell Functional Identification Kit

Human Pluripotent Stem Cell Functional Identification Kit Human Pluripotent Stem Cell Functional Identification Kit Catalog Number SC027B Reagents for the identification of human pluripotent stem cells by in vitro functional differentiation. This package insert

More information

Supplementary Information

Supplementary Information Silva et al, 2006 Supplementary Information Nanog promotes transfer of pluripotency after cell fusion Supplementary Methods Antibodies RT-PCR analysis Trichostatin A and 5-azacytidine treatment Imaging

More information

Naked Mole Rat Induced Pluripotent Stem Cells and Their Contribution

Naked Mole Rat Induced Pluripotent Stem Cells and Their Contribution Stem Cell eports, Volume 9 Supplemental Information Naked Mole at Induced Pluripotent Stem Cells and Their Contribution to Interspecific Chimera Sang-Goo Lee, Aleksei E. Mikhalchenko, Sun Hee Yim, Alexei

More information

Terrific Validation, Tech Support and Prompt Delivery. User Guide for Selleck Human ipsc Enhancer Kit Cat. No. K2010. Guidelines for Use

Terrific Validation, Tech Support and Prompt Delivery. User Guide for Selleck Human ipsc Enhancer Kit Cat. No. K2010. Guidelines for Use Terrific Validation, Tech Support and Prompt Delivery User Guide for Selleck Human ipsc Enhancer Kit Cat. No. K2010 Guidelines for Use For Research Use Only. Not for use in diagnostic or therapeutic procedures.

More information

NutriStem: a Defined, Low-Growth Factor, Xeno-Free Medium for the Long Term Culture of Undifferentiated Human ES Cells

NutriStem: a Defined, Low-Growth Factor, Xeno-Free Medium for the Long Term Culture of Undifferentiated Human ES Cells APPLICATION NOTE Page 1 NutriStem: a Defined, Low-Growth Factor, Xeno-Free Medium for the Long Term Culture of Undifferentiated Human ES Cells Authors: Dongmei Wu, M. D., Ph. D., Yan Gao, Wen Xiong, Ph.

More information

Supplementary information, Figure S1 Derivation of human diploid ESCs from parthenogenetic blastocysts generated by chemical activation.

Supplementary information, Figure S1 Derivation of human diploid ESCs from parthenogenetic blastocysts generated by chemical activation. Supplementary Information Supplementary information, Figure S1 Derivation of human diploid ESCs from parthenogenetic blastocysts generated by chemical activation. (A) No 1c peak in the initial cell sorting

More information

fragment in exchange with a CAG-eGFP-anillin expression cassette (AseI, HpaI) in a bluntended

fragment in exchange with a CAG-eGFP-anillin expression cassette (AseI, HpaI) in a bluntended Supplementary Methods Generation of a CAG-eGFP-anillin lentivirus The psico vector which is based on Lentilox37 8 was truncated via excision of an XbaI-XhoI fragment in exchange with a CAG-eGFP-anillin

More information

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate

More information

hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm

hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm Supplementary information, Data S1 Materials and Methods Culture and differentiation of hpscs hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm cells as described

More information

Growth inhibition of mouse embryonic stem (ES) cells on the feeders from domestic animals

Growth inhibition of mouse embryonic stem (ES) cells on the feeders from domestic animals African Journal of Biotechnology Vol. 11(80), pp. 14627-14631, 4 October, 2012 Available online at http://www.academicjournals.org/ajb DOI: 10.5897/AJB11.3352 ISSN 1684 5315 2012 Academic Journals Full

More information

HUMAN IPSC CULTURE PROTOCOLS

HUMAN IPSC CULTURE PROTOCOLS HUMAN IPSC CULTURE PROTOCOLS FOR TRAINING COURSE IXCELLS BIOTECHNOLOGIES USA, LLC 10340 CAMINO SANTA FE, SUITE C, SAN DIEGO, CA 92121 TABLE OF CONTENTS CHAPTER 1 BEFORE STARTING 2-7 SECTION 1.1 COATING

More information

ipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer

ipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer ipsc Reprogramming from Human Peripheral Blood Using Sendai Virus Mediated Gene Transfer Wenli Yang 1, Jason A. Mills 2, Spencer Sullivan 3, Ying Liu 1, Deborah L. French 2 and Paul Gadue 2, 1 Institute

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium. Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,

More information

Human Induced Pluripotent Stem Cells

Human Induced Pluripotent Stem Cells Applied StemCell, Inc. (866) 497-4180 www.appliedstemcell.com Datasheet Human Induced Pluripotent Stem Cells Product Information Catalog Number Description Tissue Age Sex Race Clinical information Quantity

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Effect of timing of DE dissociation and RA concentration on lung field specification in hpscs. (a) Effect of duration of endoderm induction on expression of

More information

Application Note Use of a Defined, Low-Growth Factor Xeno-Free Culture Medium for the Long-Term Culture of Undifferentiated Human Embryonic Stem Cells

Application Note Use of a Defined, Low-Growth Factor Xeno-Free Culture Medium for the Long-Term Culture of Undifferentiated Human Embryonic Stem Cells Undifferentiated Human Authors: Dongmei Wu, M. D., Ph. D., Yan Gao, Wen Xiong, Ph. D., Shuyuan Yao, Ph. D. and Matthew A. Singer, Ph. D. 1 Stemgent, Inc., 10575 Roselle St., San Diego, CA 92121 USA 1 Corresponding

More information

Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D

Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D MATERIALS Media Sodium Pyruvate (Mediatech; Cat# MT25-000-CI) Leukemia Inhibitory Factor

More information

In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days

In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days Animal injections and tissue processing In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days before they received any injections. Mice were injected with sesame seed oil

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Full Methods Derivation of resc cell lines Mouse embryos were isolated from E5.5 - E7.5 129/sv or ROSA129/Sv females mated with Oct4-ΔPE-GFP transgenic males with a mixed background of MF1, 129/sv, and

More information

Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts

Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts Short Article Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts Graphical Abstract Authors Riguo Fang, Kang Liu,..., Jun Xu, Hongkui Deng Correspondence jun_xu@pku.edu.cn

More information

hipsc-derived cardiomyocytes from Brugada Syndrome patients without identified mutations do not exhibit clear cellular electrophysiological

hipsc-derived cardiomyocytes from Brugada Syndrome patients without identified mutations do not exhibit clear cellular electrophysiological hipsc-derived cardiomyocytes from Brugada Syndrome patients without identified mutations do not exhibit clear cellular electrophysiological abnormalities Authors: Christiaan C. Veerman, MD # 1 ; Isabella

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb37 a mrna relative expression 1.3 1..8.5.3. CTR NGPS OCT4 SOX2 KLF4 c-myc b BANF1 mrna levels 1.2 1..8.6.4.2. plko.1 shbanf1 c Tra-1-6+ colonies 3 1 plko.1 shbanf1 d BANF1 locus Plasmid donor

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

Supplementary Information to Accompany. Precision Modulation of Neurodegenerative Disease-Related Gene Expression in Human ipsc-derived Neurons

Supplementary Information to Accompany. Precision Modulation of Neurodegenerative Disease-Related Gene Expression in Human ipsc-derived Neurons Supplementary Information to Accompany Precision Modulation of Neurodegenerative Disease-Related Gene Expression in Human ipsc-derived Neurons Sabrina Mahalia Heman-Ackah 1,2,3,*, Andrew Roger Bassett

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

PluriQ TM Serum Replacement (PluriQ TM SR)

PluriQ TM Serum Replacement (PluriQ TM SR) PluriQ TM Serum Replacement (PluriQ TM SR) (PluriQ SR) is a defined, serum-free supplement formulated as a direct replacement for FBS (fetal bovine serum) used in the growth and maintenance of undifferentiated

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

USP19 modulates autophagy and antiviral immune responses by. deubiquitinating Beclin-1

USP19 modulates autophagy and antiviral immune responses by. deubiquitinating Beclin-1 USP19 modulates autophagy and antiviral immune responses by deubiquitinating Beclin-1 Shouheng Jin 1,2,, Shuo Tian 1,, Yamei Chen 1,, Chuanxia Zhang 1,2, Weihong Xie, 1 Xiaojun Xia 3,4, Jun Cui 1,3* &

More information

Components Neural induction basal medium (Cat. # ) 100 ml x 5 Neural induction medium supplement 50x (Cat. # ) 2 ml x 5

Components Neural induction basal medium (Cat. # ) 100 ml x 5 Neural induction medium supplement 50x (Cat. # ) 2 ml x 5 HPSC Neural Induction Medium (PSCNIM) Catalog #5931 Introduction Human embryonic stem cells (hesc) and induced pluripotent stem cells (hipsc) possess the capability of differentiating into all derivatives

More information

Authors: Takuro Horii, Masamichi Yamamoto, Sumiyo Morita, Mika Kimura, Yasumitsu Nagao, Izuho Hatada *

Authors: Takuro Horii, Masamichi Yamamoto, Sumiyo Morita, Mika Kimura, Yasumitsu Nagao, Izuho Hatada * SUPPLEMENTARY INFORMATION Title: p53 Suppresses Tetraploid Development in Mice Authors: Takuro Horii, Masamichi Yamamoto, Sumiyo Morita, Mika Kimura, Yasumitsu Nagao, Izuho Hatada * Supplementary Methods

More information

Culturing Protocol for JM8.N4 ES Cell Clones Revised July 2014

Culturing Protocol for JM8.N4 ES Cell Clones Revised July 2014 Culturing Protocol for JM8.N4 ES Cell Clones Revised July 2014 Cell Line Information The JM8.N4 subline is derived from the JM8 parental line and are considered to be feeder independent. These cells are

More information

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico

More information

First xeno-free serum replacement for pluripotent stem cells

First xeno-free serum replacement for pluripotent stem cells Stem Cell Research First xeno-free serum replacement for pluripotent stem cells KnockOut SR XenoFree Stem Cell Research New, xeno-free growth and expansion of hescs and human ipscs KnockOut SR XenoFree

More information

Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW)

Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Growth and Harvest Modifications Addendum to: Propagation of H7 hesc from UW

More information