GFP CCD2 GFP IP:GFP

Size: px

Start display at page:

Download "GFP CCD2 GFP IP:GFP"

Vivien Burns
6 years ago
Views:

D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with

1 D1 D GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant or plasmids. The IP is performed with an anti-gfp antibody, followed by WB with the indicated antibodies. These experiments show that CCD1 domain of is associated with interaction.

(b) NIH3T3 cells stably expressing -EGFP

Beclin 1-Myc for 24 h, then starved with

2 a - Beclin 1-GFP -AsRed b -GFP -AsRed Beclin 1-myc Merge Control EBSS c -GFP -AsRed LC3 Merge Control EBSS d - WIPI2 p62 Merge Control HBSS Supplementary Figure 2: form puncta structures and recruit autophagic markers (a) Beclin 1-EGFP, -AsRed, and - were transfected into HeLa cells, respectively. is diffused in whole cells when expressed alone. Scale bar =50 µm. (b) NIH3T3 cells stably expressing -EGFP were co-transfected with -AsRed and Beclin 1-Myc for 24 h, then starved with EBSS for 2 h, and subjected to immunostaining with anti-myc or LC3 antibodies, respectively. Scale bar =10 µm. (d) MEFs were transfected with - and starved for 4 h in HBSS. The cells were co-stained with GFP, WIPI2 and p62 antibodies. - forms puncta structures under starvation and co-localize with autophagic markers WIPI2 and p62.

Dox 0 10 50 100 200 (ng/ml) AcGFP- LC3-I LC3-II 15KD- p62 β-actin Supplementary Figure 3: Over-expression of up-regulates autophagy AcGFP- stably expressing HeLa cells

3 Dox (ng/ml) AcGFP- LC3-I LC3-II 15KD- p62 β-actin Supplementary Figure 3: Over-expression of up-regulates autophagy AcGFP- stably expressing HeLa cells are induced with different concentration of doxycycline (Dox) for 24 hours and then subjected to WB analysis. LC3-II level is up-regulated after AcGFP- inducibly expressed.

a locus 1 2 3 4 Mutant allele 1 2 3 4 β-geo Truncated 1 10(a.a.) b Trap vector; pu-21w c bp: 1 2 1 2 650 Primer F 517 729 275 bp 213

β-actin Supplementary Figure 4: knockout strategy (a) Schematic representation of gene trap strategy.

4 a locus Mutant allele β-geo Truncated 1 10(a.a.) b Trap vector; pu-21w c bp: Primer F bp 213 bp Total 488 bp Primer R1 Trap allele d Wild allele Brain Liver Kidney Primer F 275 bp 64 bp Total 339 bp Primer R2 β-actin Supplementary Figure 4: knockout strategy (a) Schematic representation of gene trap strategy. (b) Primers design for genotyping. (c) Validation of gene trap on mouse by genotyping. (d) Validation of protein depletion in the brain, liver and kidney of mice.

5 b c 2M 4M 6M 8M 10M 12M p62 Body Weight Survival rate (%) a Male 1cm Ubiquitin Female 1cm Merge d DAPI p62 C-Cas 8 Merge Supplementary Figure 5: Survival, body weight and liver phenotypes of and mice (a) The survival curve of and mice (for each genotype, n>20). (b) The body weight of adult (4 month old) and mice (data shown as mean±sem, P value is indicated on the figure, unpaired Student s t-test., n=15;, n=16). (c) Accumulated p62 colocalizes with ubiquitin. Liver frozen sections are double stained with an anti-p62 antibody and an anti-ubiquitin antibody. Scale bar =20 µm. (d) Activation of Capspase-8 (C-Cas 8) in isolated p62 accumulated hepatocyptes. Liver frozen sections are double stained with an anti-p62 antibody and an anti-cleaved Capspase-8 antibody. Scale bar =20 µm.

--His Myc/ - -GFP UVRAG-GFP Beclin 1-GFP Rubicon-GFP 250KD- 1 1.9 0.7 0.9 1 0.

6 --His Myc/ - -GFP UVRAG-GFP Beclin 1-GFP Rubicon-GFP 250KD / (IP) IB: GFP IP: Myc Supplementary Figure 6: Over-expression of, but not, UVRAG, Beclin 1 or Rubicon, enhances activity HEK293 cells are co-transfected with Myc-Vps3--His and, -, -GFP, UVRAG-GFP, Beclin 1-GFP or Rubicon-GFP. is pulled down by an anti-myc antibody and subjected to kinase assay. IP products and inputs are immunoblotted using the antibodies indicated. The numbers indicate quantification of kinase activity normalized with immunoprecipitated.

7 Fig.1b Fig.1c IP IgG UVRAG Fig.1d Beclin 1 Fig.1f Pull down GST -GST GST -GST IgG -GST GST 250KD- Supplementary Figure 7: full scans of blots in figure 1. To be continued...

8 Fig.2b - dmit- dccd- - dmit- dccd- - dmit- dccd- 250KD- 250KD- 250KD- Beclin 1 IB: GFP IB: GFP IgG (IP) Fig.2d --his his - - IP: FLAG --his - - Flag-UVRAG Flag- FLAG- FLAG-UVRAG IP:FLAG IB: GFP FLAG- FLAG-UVRAG FLAG- FLAG-UVRAG IP:FLAG Supplementary Figure 7: full scans of blots in figure 2. To be continued...

9 Fig.3b Con Rap Con Rap Fig.6a p62 p62 15KD- β-actin LC3 Fig.6d IgG IP: GAPDH IP: IgG Supplementary Figure 7: full scans of blots in figure 3 and figure 6. To be continued...

10 Fig.7d Con TP TN Con TP TN Con TP TN Con TP TN P62 Chop Bip LC3-I/II Cleaved C 8 (P18) C 8 FL Cleaved C 8 (P43) β-actin Cleaved Caspase 3 Supplementary Figure 7: full scans of blots in figure 7. To be continued...

11 Fig.8a IgG IP: IP: Beclin 1 UVRAG Beclin 1 Fig.8d -V5-His IP: Myc -V5-His IP: Myc -V5-His dmit- dccd- - - dmit- dccd- - - dmit- dccd- - - Supplementary Figure 7: full scans of blots in figure 8

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of