Lab-on-a Chip Systems. with Optical Detection of Toxicological Effects. in Medicine

Size: px
Start display at page:

Download "Lab-on-a Chip Systems. with Optical Detection of Toxicological Effects. in Medicine"

Transcription

1 Lab-on-a Chip Systems with Optical Detection of Toxicological Effects in Medicine Karl-Heinz Feller Ernst-Abbe-Fachhochschule Jena Jencolor Innovation Forum Jena

2 RESEARCH GROUP INSTRUMENTAL ANALYTICS supervisor: Prof. Dr. Karl-Heinz Feller 5 PhD students, 3 Post-Doc, 3 scientific co-workers, student research assistants

3 Detection of toxic/irritating effects Development of a cell-based sensorchip for the complex description of the physiological property of a substance towards keratinocytes (HaCaT cell line) in a real time and sensitive manner to be applied within the cosmetic and pharmaceutical industry. Determination of toxic effects: - strong reaction (apoptosis) - weak reaction (cellular stress, irritation) - no reaction Development of a fast method based on a lab-on-achip by application of early biomarker 8. Jahrestagung AK BioMST

4 Detection of toxic/irritating effects test substance microscopy cell density cell adhesion supervision fluorescence cellular stress level promoter reporter gene GFP detection Possibility to differentiate between competing, stress- or growth-related effects cell model electrochemistry cell morphology cell damage impedance spectroscopy detection

5 Detection of toxic/irritating effects test substance fluorescence cellular stress level promoter reporter gene GFP detection Possibility to differentiate between competing, stress- or growth-related effects cell model electrochemistry cell morphology cell damage impedance spectroscopy detection

6 Establishment of the fluorescence-based assay Measurement of fluorescence intensity in dependance on the cellular stress level Identification of a powerful biomarker for detection of cellular stress Cloning Stable Transfection Real-Time quantitative PCR Genomic DNA Establishment of a reporter assay PCR Selection by G418 Implementation of the fluorescence- based assay on the lab-on-a-chip

7 Setup of the Lab-on-a-Chip micro mixer test substance cell culture media reference substance keratinocyte Lab-on-a-Chip

8 Setup of the Lab-on-a-Chip micro mixer test substance cell culture media reference substance stress keratinocyte promoter reporter gene green fluorescent protein Lab-on-a-Chip

9 Setup of the Lab-on-a-Chip micro mixer test substance cell culture media APD detection reference substance stress keratinocyte temperature control electrochemical readout promoter reporter gene green fluorescent protein Lab-on-a-Chip control and data analysis

10 Incubator-independent cultivation Conventional cell culture practice work flow microscope limitation CO 2 - incubator No online-monitoring CO 2 -incubator for optimal culture conditions condition temperature 37 C constant ph HCO H 3 O + <-> CO 2 + 2H 2 O high humidity solution transparent heater CO 2 -independent medium sterile cultivation under flow conditions (flow rate < 10µl/min) 8. Jahrestagung AK BioMST

11 MICROFLUIDICS & MICROSENSORS Systematic built-up of a measuring system with LEDs and multi-color sensors

12 FLUID DYNAMICS SIMULATION WITH ANSYS CFX CFD enables an optimization before the manufacturing process Micromixer improve the homogenity, selectivity and cost efficiency investigation and combination of different micromixer modules

13 NUMERICAL SIMULATIONS fluid flow simulation of mixing and multi- phase- systems fluid- structure interaction simulation of e.g. valve s, pumps etc.

14 OPTICAL SIMULATION FRED is used for numerical simulation of optical processes to optimize the opt. Yield as well as to minimize optical losses

15 DETECTORS true-colour/multicolor Sensor (MAZeT): color regions per sensor (Δλ~50 nm) Mini-Spectrometer (Ocean Optics): - small, high spectral resolution (Δλ=0,5 nm) CCD Camera: - high sensitivity, special resolution Avalanche photodiode: - highest sensitivity, small

16 SENSOR PRINCIPLE with MIPs Glycoprotein Multicolour Sensor MIP Optical Fiber Light source CCD-Camera Sample Micromixer Chip-cuvette with spotted MIP s Spectrometer Solvent

17 NANOTOXISCREEN Lab-on-a-Chip-based detection of the cell damaging potential of nano particels on human cells

18 Conclusions and outlook - Development of a lab-on-a-chip system for the complex analysis of cytotoxic effects of chemical substances - no incubator necessary (flow-through cultivation of keratinocytes) - CFD-optimization of the mixing process and the shear stress - Control of the growing cell culture - Combination of optical and electrochemical detection unit - Automatically monitoring of the cell behavior - Integration of the complex analysis in a three-channel-chip - low-cost option for the optical detection by means of avalanche photodiodes 18

19 Thank you very much for your attention!!! Funding: BMWi (ZIM-Programm), EU (EFRE, ITN), BMBF, u. a.

Confocal Microscopy Analyzes Cells

Confocal Microscopy Analyzes Cells Choosing Filters for Fluorescence A Laurin Publication Photonic Solutions for Biotechnology and Medicine November 2002 Confocal Microscopy Analyzes Cells Reprinted from the November 2002 issue of Biophotonics

More information

Optical Observation - Hyperspectral Characterization of Nano-scale Materials In-situ

Optical Observation - Hyperspectral Characterization of Nano-scale Materials In-situ Optical Observation - Hyperspectral Characterization of Nano-scale Materials In-situ Research at the nanoscale is more effective, when research teams can quickly and easily observe and characterize a wide

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Syringe Pumps. Please contact us for help in selecting the best pump for your application and a free quote.

Syringe Pumps. Please contact us for help in selecting the best pump for your application and a free quote. Syringe Pumps Microfluidic Pumps! We are proud to offer select Harvard Apparatus syringe pumps for use with SynVivo biochips. These high quality pumps have been extensively tested and offer a feature rich

More information

Nanophotonics: principle and application. Khai Q. Le Lecture 11 Optical biosensors

Nanophotonics: principle and application. Khai Q. Le Lecture 11 Optical biosensors Nanophotonics: principle and application Khai Q. Le Lecture 11 Optical biosensors Outline Biosensors: Introduction Optical Biosensors Label-Free Biosensor: Ringresonator Theory Measurements: Bulk sensing

More information

N-Lab. Extend your research. New generation label-free surface analysis system

N-Lab. Extend your research. New generation label-free surface analysis system N-Lab Extend your research New generation label-free surface analysis system SEEC technique Application areas A NEW WAY TO ANALYSE YOUR SAMPLE! SEEC* technique is a label free quantitative imaging technique

More information

TransIT -Keratinocyte Transfection Reagent

TransIT -Keratinocyte Transfection Reagent TransIT -Keratinocyte Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2800 INTRODUCTION TransIT -Keratinocyte Transfection Reagent is specifically

More information

CENTER FOR BRAIN EXPERIMENT

CENTER FOR BRAIN EXPERIMENT CENTER FOR BRAIN EXPERIMENT Section of Brain Structure Associate Professor: ARII, Tatsuo, PhD 1967 Graduated from Tohoku University, Faculty of Science. Completed the doctoral course in Engineering, Nagoya

More information

Final Year Project Proposal 1

Final Year Project Proposal 1 Final Year Project Proposal 1 Mechanical testing for high temperature polymers Mr Eric Phua Jian Rong (JRPhua@ntu.edu.sg) In offshore subsea drilling, different types of microelectronics devices and sensors

More information

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody

More information

Accurate and Automated cell confluence assessment in microplates

Accurate and Automated cell confluence assessment in microplates Accurate and Automated cell confluence assessment in microplates TECAN S SPARK 20M MICROPLATE READER WITH INTEGRATED CELL IMAGING SIMPLIFIES CELL CULTURE QC AND SIGNAL NORMALIZATION TO CELL CONFLUENCE

More information

DEPArray Technology. Sorting and Recovery of Rare Cells

DEPArray Technology. Sorting and Recovery of Rare Cells DEPArray Technology Sorting and Recovery of Rare Cells Delivering pure, single, viable cells The DEPArray system from Silicon Biosystems is the only automated instrument that can identify, quantify, and

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Quantum Dot applications in Fluorescence Imaging for Calibration and Molecular Imaging

Quantum Dot applications in Fluorescence Imaging for Calibration and Molecular Imaging Quantum Dot applications in Fluorescence Imaging for Calibration and Molecular Imaging Introduction In this application note, we will discuss the application of quantum dots in fluorescence imaging, both

More information

The Unlimited World of Applications for Nano & Photonics. Benno Oderkerk CEO Avantes BV, Apeldoorn, The Netherlands

The Unlimited World of Applications for Nano & Photonics. Benno Oderkerk CEO Avantes BV, Apeldoorn, The Netherlands The Unlimited World of Applications for Nano & Photonics Benno Oderkerk CEO Avantes BV, Apeldoorn, The Netherlands Contents Avantes Introduction Photonics NL Introduction TKI Chemie Nanotechnology and

More information

PYTHIA: Monolithically integrated interferometric biochips for label-free early detection of Human diseases

PYTHIA: Monolithically integrated interferometric biochips for label-free early detection of Human diseases PYTHIA: Monolithically integrated interferometric biochips for label-free early detection of Human diseases Ioannis Raptis, IMEL NCSR Demokritos raptis@imel.demokritos.gr www.pythia-project.eu The Problem

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

NEW INSIGHTS. NEW DISCOVERIES. Real-time automated measurements of cell health, movement and function inside your incubator.

NEW INSIGHTS. NEW DISCOVERIES. Real-time automated measurements of cell health, movement and function inside your incubator. THE NEXT GENERATION HAS ARRIVED IncuCyte S3 Live-Cell Analysis System Real-time automated measurements of cell health, movement and function inside your incubator. NEW INSIGHTS. NEW DISCOVERIES. See what

More information

Technology Offer. Ultrafast temperature controlled objective. Keywords. Background. File no.: MI WT-WA

Technology Offer. Ultrafast temperature controlled objective. Keywords. Background. File no.: MI WT-WA Technology Offer Ultrafast temperature controlled objective File no.: MI-1401-4735-WT-WA Max-Planck-Innovation GmbH Amalienstr. 33 80799 Munich Germany Phone: +49 (89) 29 09 19-0 Fax: +49 (89) 29 09 19-99

More information

Exam MOL3007 Functional Genomics

Exam MOL3007 Functional Genomics Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting

More information

Micophotometric Control of Particles and Inhomogeneities in Flowing Polymer Melts during Extrusion Processing

Micophotometric Control of Particles and Inhomogeneities in Flowing Polymer Melts during Extrusion Processing M.Stephan, S.Große: Micophotometric Control of Particles and Inhomogeneities in Flowing Polymer Melts during Extrusion Processing Workshop January, 28 th -29 th 2005, Dresden Particulate Heterogeneities

More information

MAKE NO MISTAKE, IT S UV THAT EVERYONE CAN USE. LAMBDA 265 / 365 / 465 UV/Vis Solutions

MAKE NO MISTAKE, IT S UV THAT EVERYONE CAN USE. LAMBDA 265 / 365 / 465 UV/Vis Solutions LAMBDA 265 / 365 / 465 UV/Vis Solutions MAKE NO MISTAKE, IT S UV THAT EVERYONE CAN USE 2 PUTTING OUR FOCUS ON THE NEEDS OF INDUSTRY AND ACADEMIA Based on our long history of UV/Vis leadership, our LAMBDA

More information

NEW INSIGHTS. NEW DISCOVERIES. Real-time automated measurements of cell health, movement and function inside your incubator.

NEW INSIGHTS. NEW DISCOVERIES. Real-time automated measurements of cell health, movement and function inside your incubator. THE NEXT GENERATION HAS ARRIVED IncuCyte S3 Live-Cell Analysis System Real-time automated measurements of cell health, movement and function inside your incubator. NEW INSIGHTS. NEW DISCOVERIES. See what

More information

Cellometer Vision CBA

Cellometer Vision CBA Features of the Vision CBA Image Cytometry System All-in-One System Basic cell counting, primary cell viability, and cellbased assays. See for Yourself Why the Top Ten Pharmaceutical Companies Trust Cellometer

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

European Directorate for the Quality of Medicines & HealthCare (EDQM)

European Directorate for the Quality of Medicines & HealthCare (EDQM) European Directorate for the Quality of Medicines & HealthCare (EDQM) INTERNATIONAL REGULATORY FORUM OF HUMAN CELL THERAPY AND GENE THERAPY PRODUCTS 16 MARCH 2016, OSAKA, JAPAN Dr Stephen J. Wicks Scientific

More information

Be Among the First to Publish in Science Robotics

Be Among the First to Publish in Science Robotics Be Among the First to Publish in Science Robotics Image: jim /AdobeStock NOW ACCEPTING MANUSCRIPTS ScienceRobotics.org Science Robotics is a unique journal created to help advance the research and development

More information

Performance of the Micro Photon Devices PDM 50CT SPAD detector with PicoQuant TCSPC systems

Performance of the Micro Photon Devices PDM 50CT SPAD detector with PicoQuant TCSPC systems Technical Note Performance of the Micro Photon Devices PDM 5CT SPAD detector with PicoQuant TCSPC systems Rolf Krahl, Andreas Bülter, Felix Koberling, PicoQuant GmbH These measurements were performed to

More information

jetprime in vitro DNA & sirna transfection reagent PROTOCOL

jetprime in vitro DNA & sirna transfection reagent PROTOCOL jetprime in vitro DNA & sirna transfection reagent PROTOCOL DESCRIPTION jetprime is a novel powerful transfection reagent based on a polymer formulation manufactured at Polyplus-transfection. jetprime

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

REIMAGINING DRUG DEVELOPMENT:

REIMAGINING DRUG DEVELOPMENT: Biology Reconstructed REIMAGINING DRUG DEVELOPMENT: Accurate Disease Modeling To Drive Successful Therapies Julia Kirshner, CEO julia@zpredicta.com 1 SUCCESS RATES OF DRUG DEVELOPMENT ARE LOW, " PARTICULARLY

More information

Protein Microarrays?

Protein Microarrays? Protein Microarrays? Protein Chemistry/Proteomics Unit and the Neuroscience Program,Biomedicum Helsinki E-Mail: marc.baumann@helsinki.fi (http://research.med.helsinki.fi/corefacilities/proteinchem) What

More information

Developing a real-time fluorescence cell growth monitoring system

Developing a real-time fluorescence cell growth monitoring system - 65 - Developing a real-time fluorescence cell growth monitoring system Jo-Ting Wang 1, Chun-Han Lu 2, Yao-Nan Wang 2, Ko-Tung Chang 1,* 1 Department of Biological Science and Technology, National Pingtung

More information

Using ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay

Using ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay Using ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay Updated: Nov 11, 2016 Introduction Immunoassay is a widely used method for detecting the presence

More information

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating

More information

Simple, intuitive and accessible MRI solution for preclinical research. M-Series Compact MRI Systems

Simple, intuitive and accessible MRI solution for preclinical research. M-Series Compact MRI Systems Simple, intuitive and accessible MRI solution for preclinical research M-Series Compact MRI Systems Application Oriented Imaging Anatomy and Morphology In vivo soft tissue imaging for morphological characterization.

More information

TransIT -CHO Transfection Kit

TransIT -CHO Transfection Kit Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2170 INTRODUCTION TransIT -CHO Transfection Kit is specifically optimized to provide exceptional transfection efficiency

More information

Spectral Separation of Multifluorescence Labels with the LSM 510 META

Spectral Separation of Multifluorescence Labels with the LSM 510 META Microscopy from Carl Zeiss Spectral Separation of Multifluorescence Labels with the LSM 510 META Indians living in the South American rain forest can distinguish between almost 200 hues of green in their

More information

Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry

Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Clinical proteomics is the application of proteomic approach to the field of medicine. Proteome of an organism changes

More information

AFM-Raman Characterization of Pharmaceutical Tablets

AFM-Raman Characterization of Pharmaceutical Tablets AFM-Raman Characterization of Pharmaceutical Tablets Compound Distribution Studies in Pharmaceutical Tablets by Integrated AFM-Raman Instrument 1,2 1 Sergey Shashkov and Pavel Dorozhkin, 1 NT-MDT Co.,

More information

Fiber Optic Microarray Detection of Freshwater Cyanobacteria. Shonda Gaylord PhD Candidate TCSVM Walt Laboratory Woods Hole Oceanographic Institute

Fiber Optic Microarray Detection of Freshwater Cyanobacteria. Shonda Gaylord PhD Candidate TCSVM Walt Laboratory Woods Hole Oceanographic Institute Fiber Optic Microarray Detection of Freshwater Cyanobacteria Shonda Gaylord PhD Candidate TCSVM Walt Laboratory Woods Hole Oceanographic Institute Why Detection Matters The release of cyanotoxins into

More information

CELL HEALTH. reliable cell viability data. instant time savings. PrestoBlue Cell Viability Reagent

CELL HEALTH. reliable cell viability data. instant time savings. PrestoBlue Cell Viability Reagent CELL HEALTH reliable cell viability data instant time savings PrestoBlue Cell Viability Reagent PrestoBlue Cell Viability Reagent Why should I use the PrestoBlue Cell Viability Reagent? PrestoBlue reagent

More information

SCHOTT MEMpax New options for the MEMS industry. NMN Technology Day Schott AG Grünenplan

SCHOTT MEMpax New options for the MEMS industry. NMN Technology Day Schott AG Grünenplan SCHOTT MEMpax New options for the MEMS industry NMN Technology Day Schott AG Grünenplan 06.11.2012 Agenda 2 Agenda 1. SCHOTT thin glass for Electronics & Biotech 2. MEMS Industry and Motivation for MEMpax

More information

NanoSystemsEngineering: NanoNose Final Status, March 2011

NanoSystemsEngineering: NanoNose Final Status, March 2011 1 NanoSystemsEngineering: NanoNose Final Status, March 2011 The Nanonose project is based on four research projects (VCSELs, 3D nanolithography, coatings and system integration). Below, the major achievements

More information

Supporting Information

Supporting Information Supporting Information Photoinitiated Growth of Sub-7 nm Silver Nanowires within a Chemically Active Organic Nanotubular Template D. M. Eisele 1, H. v. Berlepsch 2, C. Böttcher 2, K. J. Stevenson 3, D.

More information

Carbon. Carbon. Carbon parameters: Carbon

Carbon. Carbon. Carbon parameters: Carbon Carbon Carbon Carbon The main task of a wastewater treatment plant is to reduce the total organic load of wastewater in addition to all the progress made in nitrogen and phosphate elimination. Organic

More information

TransIT -293 Transfection Reagent

TransIT -293 Transfection Reagent TransIT -293 Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2700 INTRODUCTION TransIT -293 Transfection Reagent is specifically optimized to provide

More information

Un biochip per elettrostimolazione cellulare

Un biochip per elettrostimolazione cellulare Un biochip per elettrostimolazione cellulare A. Paccagnella, G. Cellere, L. Bandiera Dipartimento di Ingegneria dell Informazione Università di Padova Outline Introduction & background A biochip for genetic

More information

Miniaturised SAC Measurement for Continuous Monitoring of Water Quality

Miniaturised SAC Measurement for Continuous Monitoring of Water Quality Miniaturised SAC Measurement for Continuous Monitoring of Water Quality White Paper September 2015 Miniaturised SAC Measurement for Continuous Monitoring of Water Quality Andreas Ulsperger, Product Manager

More information

Thermo Scientific ArrayScan XTI High Content Analysis Reader. revolutionizing cell biology with the power of high content

Thermo Scientific ArrayScan XTI High Content Analysis Reader. revolutionizing cell biology with the power of high content Thermo Scientific ArrayScan XTI High Content Analysis Reader revolutionizing cell biology with the power of high content learn more about your cells using high content technology Thermo Scientific High

More information

BioLector I 48 Parallel Microbioreactors. High-Throughput Real-Time Monitoring Scalability Automation.

BioLector I 48 Parallel Microbioreactors. High-Throughput Real-Time Monitoring Scalability Automation. BioLector I 48 Parallel Microbioreactors High-Throughput Real-Time Monitoring Scalability Automation m2p-labs The Microbioreactor Company www.m2p-labs.com High Information Content for fast Selection BioLector

More information

TransIT -LT1 Transfection Reagent

TransIT -LT1 Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2300 INTRODUCTION TransIT -LT1 Transfection Reagent is a broad spectrum reagent that provides high efficiency plasmid

More information

Thermo Scientific GENESYS 10S Bio spectrophotometer

Thermo Scientific GENESYS 10S Bio spectrophotometer PRODUCT SPECIFICATIONS GENESYS 10S Bio UV-Visible Spectrophotometer Thermo Scientific GENESYS 10S Bio spectrophotometer Accurate and convenient life science UV-Visible measurements Designed for performance

More information

TransIT -BrCa Transfection Reagent

TransIT -BrCa Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5500 INTRODUCTION TransIT -BrCa Transfection Reagent is specifically optimized to provide exceptional transfection efficiency

More information

New approaches for analyzing multi-channel image data and post-processing of phenotypic data

New approaches for analyzing multi-channel image data and post-processing of phenotypic data New approaches for analyzing multi-channel image data and post-processing of phenotypic data Christian Klukas Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) LemnaTec GmbH, 52076 Aachen,

More information

Next Level of Super Resolution Fluorescence Microscopy

Next Level of Super Resolution Fluorescence Microscopy Work in your familiar GFP/YFP/RFP system from the first experiment to the nanoimage Bwcon business award winner: Inventor Prof Christoph Cremer Next Level of Super Resolution Fluorescence Microscopy Resolution:

More information

Cytomics in Action: Cytokine Network Cytometry

Cytomics in Action: Cytokine Network Cytometry Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University

More information

PROJECT GROUP FOR AUTOMATION IN MEDICINE AND BIOTECHNOLOGY IN MANNHEIM BIOPROCESS ENGINEERING

PROJECT GROUP FOR AUTOMATION IN MEDICINE AND BIOTECHNOLOGY IN MANNHEIM BIOPROCESS ENGINEERING Fraunhofer Institute for Manufacturing Engineering and Automation IPA PROJECT GROUP FOR AUTOMATION IN MEDICINE AND BIOTECHNOLOGY IN MANNHEIM BIOPROCESS ENGINEERING VERGÜTUNG VON ERFINDUNGEN UND TECHNISCHEN

More information

Sensor. Device that converts a non-electrical physical or chemical quantity into an electrical signal. Sensor Processor Display Output signal

Sensor. Device that converts a non-electrical physical or chemical quantity into an electrical signal. Sensor Processor Display Output signal Microsensors Outline Sensor & microsensor Force and pressure microsensors Position and speed microsensors Acceleration microsensors Chemical microsensors Biosensors Temperature sensors Sensor Device that

More information

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices.

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices. DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

Title: The Cell disruption method for various tissue. By: KIbrom Fitwi

Title: The Cell disruption method for various tissue. By: KIbrom Fitwi Title: The Cell disruption method for various tissue By: KIbrom Fitwi December 22, 2010 Out line Questioning The objective cell disruption Various method of cell disruption Evaluation of cell disruption

More information

Fs- Using Ultrafast Lasers to Add New Functionality to Glass

Fs- Using Ultrafast Lasers to Add New Functionality to Glass An IMI Video Reproduction of Invited Lectures from the 17th University Glass Conference Fs- Using Ultrafast Lasers to Add New Functionality to Glass Denise M. Krol University of California, Davis 17th

More information

Neue Technologien für die patientennahe personalisierte Diagnostik

Neue Technologien für die patientennahe personalisierte Diagnostik Neue Technologien für die patientennahe personalisierte Diagnostik 2014 Dr. Soeren Schumacher, M.B.A. 27th of June 2014 1 A heterogeneous pool 27th of June 2014 2 A heterogeneous pool Personalized Medicine

More information

Principles of Electronic Nanobiosensors

Principles of Electronic Nanobiosensors Principles of Electronic Nanobiosensors Unit 5: Putting the Pieces Together Lecture 5.4: Concluding Thoughts By Muhammad A. Alam Professor of Electrical and Computer Engineering Purdue University alam@purdue.edu

More information

Swiss National Optics Plattform SNOP

Swiss National Optics Plattform SNOP Swiss National Optics Plattform SNOP History IZOT founded in 2011 as photonic network platform in Eastern Switzerland First outcome: formation of a group of interest in high end optical coating technologies

More information

NIR Checkmaster Near-infrared spectroscopy On-line analysis of active ingredients during tablet production

NIR Checkmaster Near-infrared spectroscopy On-line analysis of active ingredients during tablet production NIR Checkmaster Near-infrared spectroscopy On-line analysis of active ingredients during tablet production Slash release times with NIR Innovative features Fully automatic assay of tablet weight, hardness,

More information

SO MUCH SCIENCE SO LITTLE BENCH SPACE. VICTOR Nivo Multimode Plate Reader. For research purposes only. Not for use in diagnostic procedures.

SO MUCH SCIENCE SO LITTLE BENCH SPACE. VICTOR Nivo Multimode Plate Reader. For research purposes only. Not for use in diagnostic procedures. SO MUCH SCIENCE SO LITTLE BENCH SPACE VICTOR Nivo Multimode Plate Reader For research purposes only. Not for use in diagnostic procedures. CLEAR A LITTLE ROOM FOR THE NEXT BIG THING IN PLATE READERS COMPACT

More information

Investigation of cellular uptake mechanisms by correlative TEM and SIM

Investigation of cellular uptake mechanisms by correlative TEM and SIM Collaborative Research Center (SFB 1278) Investigation of cellular uptake mechanisms by correlative TEM and SIM Rainer Heintzmann, Fengjiao Ma, Institute of Physical Chemistry Stephanie Höppener, Martin

More information

Avalanche -Omni Transfection Reagent

Avalanche -Omni Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Omni Transfection Reagent Cat. No. EZT-OMNI-1 Description Size: 0.75 ml 1.5 ml Store at 4 C Avalanche -Omni Transfection Reagent is a proprietary lipid-polymer

More information

Program overview. SciLifeLab - a short introduction. Advanced Light Microscopy. Affinity Proteomics. Bioinformatics.

Program overview. SciLifeLab - a short introduction. Advanced Light Microscopy. Affinity Proteomics. Bioinformatics. Open House Program SciLifeLab Open House in Stockholm November 4, 2015 09:00-16:00 Contact: events@scilifelab.se Program overview 09:00-09:30-10:00-10:30-11:00-11:30-12:00-12:30-13:00-13:30-14:00-14:30-15:00-15:30-09:30

More information

jetcrispr RNP transfection reagent PROTOCOL

jetcrispr RNP transfection reagent PROTOCOL jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

TransIT Transfection Reagent

TransIT Transfection Reagent INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent that provides exceptional transfection of plasmid DNA into mammalian cells. TransIT-2020

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

Novel Microfluidic Valving and Packaging Designs for Protein Containing Biochips

Novel Microfluidic Valving and Packaging Designs for Protein Containing Biochips Novel Microfluidic Valving and Packaging Designs for Protein Containing Biochips Chunmeng Lu and L. James Lee Department of Chemical and Biomolecular Engineering The Ohio State University Lab-on on-a-chip

More information

Introduction of Biosensors

Introduction of Biosensors Introduction of Biosensors Lecture April 17 Jeff T.H.Wang website: http://pegasus.me.jhu.edu/~thwang/ New course : BioMEMS and BioSensing (Spring 04 ) What s is a biosensor? Target 4.22 Signal Signal Analtye

More information

EQUIPMENTS & MATERIALS COMMONLY USED IN A LABORATORY

EQUIPMENTS & MATERIALS COMMONLY USED IN A LABORATORY EQUIPMENTS & MATERIALS COMMONLY USED IN A LABORATORY a) Autoclave: An autoclave is a device used to sterilize equipment and supplies by subjecting them to high pressure saturated steam at 121 C for around

More information

BioMater Centre. - the equipment and services at the university - Virpi Tiitu Translational research-kuh and UEF opportunities

BioMater Centre. - the equipment and services at the university - Virpi Tiitu Translational research-kuh and UEF opportunities BioMater Centre - the equipment and services at the university - Virpi Tiitu 21.1. 2011 Translational research-kuh and UEF opportunities Basic Role of BioMater Centre "BioMater Centre acts as an independent

More information

TransIT Transfection Reagent

TransIT Transfection Reagent INTRODUCTION TransIT -2020 is a broad spectrum transfection reagent that provides superior transfection of plasmid DNA into mammalian cells. TransIT-2020 is suitable for both transient and stable transfection

More information

SURFACE PLASMON RESONANCE-BASED SYSTEMS

SURFACE PLASMON RESONANCE-BASED SYSTEMS SURFACE PLASMON RESONANCE-BASED SYSTEMS ADVANCED METHODS IN BIOENGINEERING LABORATORY 3/1/2011 1 Schedule Week 1: Introduction Reagents preparation Ligand immobilization of Protocol 1 Week 2: Kinetics

More information

Photonic integrated circuits in biochemical food analysis

Photonic integrated circuits in biochemical food analysis Photonic integrated circuits in biochemical food analysis What is Photonics? Page 2 Photonics is the physical science of light generation, detection, and manipulation through e.g. transmission, modulation,

More information

How Do You Clone a Gene?

How Do You Clone a Gene? S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are

More information

Real Time Cell Electronic Sensing (RT-CES) for Nanotoxicity Evaluation

Real Time Cell Electronic Sensing (RT-CES) for Nanotoxicity Evaluation Real Time Cell Electronic Sensing (RT-CES) for Nanotoxicity Evaluation Reyes Sierra 1, Lila Otero 1, Scott Boitano 2 & Jim Field 1 1 Dept Chemical & Environmental Engineering 1 2 Dept Cell Physiology The

More information

Enel is about to launch a global Call for startups to select innovative projects in the field of the Renewable Energies.

Enel is about to launch a global Call for startups to select innovative projects in the field of the Renewable Energies. CALL FOR START - UP Enel is about to launch a global Call for startups to select innovative projects in the field of the Renewable Energies. Applications are accepted from any country and can be submitted

More information

Figure 1. Few examples of in-vitro models developed using our products

Figure 1. Few examples of in-vitro models developed using our products Introduction IVTech offers products and know-how to improve the outcomes of your in-vitro research and refine your cell and tissue models. Using our systems, you can now implement and visualize dynamic

More information

A handheld system for DNA test based on Lab on chip technologies. Marco Bianchessi

A handheld system for DNA test based on Lab on chip technologies. Marco Bianchessi A handheld system for DNA test based on Lab on chip technologies Marco Bianchessi History 2 Mid 90s: Lab on chip introduction From niche to high-volumes products What is needed: 3 Miniaturization 75 000

More information

Cell Culture Flasks DATA SHEET

Cell Culture Flasks DATA SHEET DATA SHEET Cell Culture Flasks In research cell culture flasks are used as a matter of routine for the cultivation of eukaryotic cells. They are optimal products for adherent cells as well as for suspension

More information

A Lab-on-Chip System for direct SNP sensing from human blood

A Lab-on-Chip System for direct SNP sensing from human blood A LabonChip System for direct SP sensing from human blood Ichiro Yamashita 1,3, Paolo Fiorini 2 1 Advanced Technology Research Laboratory, Panasonic corp. 34 Hikaridai, Seikacho, Sorakugun, Kyoto 6190237,

More information

Image Analysis for Calculation of the Toxicity Degree of Cells in Phase Contrast Microscopy Images

Image Analysis for Calculation of the Toxicity Degree of Cells in Phase Contrast Microscopy Images Image Analysis for Calculation of the Toxicity Degree of Cells in Phase Contrast Microscopy Images M. Athelogou 1, M. Eblenkamp 2, G. Schmidt 1, F. Novotny 2, E. Wintermantel 2, G. Binnig 1 1 Definiens

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

MIRACLE Isolation & analysis for single circulating tumor cells (CTC) in an integrated microsystem

MIRACLE Isolation & analysis for single circulating tumor cells (CTC) in an integrated microsystem MIRACLE Isolation & analysis for single circulating tumor cells (CTC) in an integrated microsystem Wolfgang Eberle, Chengxun Liu, Liesbet Lagae Imec, Leuven, Belgium - contact: Chengxun.liu@imec.be MNBS

More information

Metals Analyzer. OES 6000 Optical Emission Spectrometer. fast and accurate metal analysis

Metals Analyzer. OES 6000 Optical Emission Spectrometer. fast and accurate metal analysis fast and accurate metal analysis Application fields Elemental analysis plays a crusial role in the quality control of the metal smelting, casting and processing industry. Skyray Instruments s are widely

More information

TransIT-TKO Transfection Reagent

TransIT-TKO Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery

More information

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6 Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...

More information

Online Wastewater Process Monitoring

Online Wastewater Process Monitoring Online Wastewater Process Monitoring s::scan Measuring Systems Gary Girolimon, P.E. Ted D. Miller Associates, Inc. Parameter Overview Probe Types Spectrometer Probes ISE Probes Electrochem. Probes other

More information

THE DELIVERY EXPERTS PROTOCOL

THE DELIVERY EXPERTS PROTOCOL THE DELIVERY EXPERTS jetprime in vitro DNA & sirna transfection reagent PROTOCOL DESCRIPTION jetprime is a novel powerful molecule based on a polymer formulation manufactured at Polyplustransfection. jetprime

More information