Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
|
|
- Garry Wright
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam 1, Ajay Rana 2 and Anumantha G. Kanthasamy 1 1 Parkinson s Disorder Research Laboratory, Iowa Center for Advanced Neurotoxicology, Department of Biomedical Sciences, Iowa State University, Ames, Iowa USA 2 Department of Pharmacology, Stritch School of Medicine, Loyola University Chicago, Maywood, Illinois 60153, USA Experimental Procedures Quantitative real-time RT-PCR- Total RNA was isolated from fresh cell pellets using the Absolutely RNA Miniprep Kit (Stratagene, La Jolla, CA) according the manufacturer s protocols. Aliquots of 3 μg of total RNA were used for first strand cdna synthesis by random primer and AffinityScript Multiple Temperature Reverse Transcriptase in a 20 μl reaction volume using an AffinityScript QPCR cdna Synthesis Kit (Stratagene). Quantitative RT-PCR was performed in an Mx3000P QPCR System (Stratagene) using the Brilliant SYBR Green QPCR Master Mix Kit (Stratagene), with cdnas corresponding to 150 ng of total RNA, 12.5 μl of 2 master mix, μl of reference dye, and 0.2 μm of each primer in a 25-μl final reaction volume. All reactions were performed in triplicate. Sequences for PKCδ primers used in this study are shown in Table S1. β-actin was used as internal standard with the primer set purchased from Qiagen (QuantiTect Primers, catalog number QT ). The PCR Cycling conditions contained an initial denaturation at 95 C for 10 min, followed by 40 cycles of denaturation at 95 C for 30 sec, annealing at 60 C for 30 sec, and extension at 72 C for 30 sec. Fluorescence was detected during the annealing step of each cycle. Dissociation curves were run to verify the singularity of the PCR product. The data
2 were analyzed using the comparative threshold cycle (Ct) method. The PKCδ mrna values were normalized to the amount of β-actin internal control in each sample and expressed as the fold of mrna levels of control samples (set to 1). Methylation specific PCR (MSP)- For MSP experiments, genomic DNA was isolated using the DNeasy blood & tissue kit (Qiagen). Bisulfite modification was subsequently carried out on 500 ng of genomic DNA by the MethylDetector bisulfite modification kit (Active Motif, Carlsbad, CA) according to the manufacturer s instructions. Two pairs of primers were designed to amplify specifically methylated or unmethylated PKCδ sequence using MethPrimer software (1). The cycling condition was: 94 C for 3 min, after which 35 cycles of 94 C for 30 sec, 54 C for 30 sec, 68 C for 30 sec, and finally 72 C for 5 min. PCR products were loaded onto 2% agarose gels for analysis. Statistical analysis- Statistical analyses were performed using the GraphPad Prism 4.0 software (GraphPad Software, San Diego, CA). One-way analysis of variance (ANOVA test) followed by the Tukey multiple comparison tests was used for statistical comparisons, and differences were considered significant if P-values less than 0.05 were obtained.
3 Fig. S1. Additive activation of PKCδ promoter transcription by Sp2 and Sp3. The expression plasmids pn3-sp3 FL, pcdna-sp2, and empty vector pn3 or pcdna3.1 were cotransfected along with the PKCδ promoter reporter construct pgl3-147/+289 into NIE115 either alone or in the different combinations, as indicated below the bar graph. Luciferase activity was determined after 24 h of transfection. Transfection efficiency was normalized by β-galactosidase activity. Data expressed as fold induction relative to that obtained from cells transfected with empty vector alone and represent the mean ± SEM of three independent experiments performed in triplicate.
4 Fig. S2. Treatment with methylation inhibitor 5 -aza-2 -deoxycytidine (5-Aza-dC) significantly increased endogenous PKCδ mrna and attenuated PKCδ promoter methylation in NIE115 cells. NIE115 cells were treated with varying doses of 5-Aza-dC for 24 h, as indicated, and cells were than collected for real-time PCR analysis of PKCδ mrna (A) or bisulfate-modification and subsequent MSP analysis (B) with primers for methylated (M) and unmethylated (U) DNA. PCR bands in (B) were analyzed using the one-dimensional image analysis software (Kodak Molecular Imaging System), and the relative methylation status was expressed as ratio of methylated versus unmethylated. (*, p<0.05; between the control and 5-Aza-dC-treated samples)
5 Table S1: List of primer sequences used in the study. Primer Sequence (5-3 ) P-1694 F GTCTATCTCGAGGATCTGACGCCCTCTTCTGGAGT P-1193 R1 GTCCTGATAACTGTCCCCACCCCAT P-1217 F ATGGGGTGGGGACAGTTATCAGGAC P+289 R GTCTATAAGCTTACCTCACCCAGGTGCCGG P-1192F ATATATCTCGAGTGGGGACTTAAATACTAATT P-1193R2 ATATATAAGCTTGTCCTGATAACTGTCCCCAC P-660F1 ATATATCTCGAGTATCCTCCCAGGAAGAGTTCTCG P-660F2 P-659R ATATATGGTACCTATCCTCCCAGGAAGAGTTCTCG ATATATAAGCTTTACAAGAGGGTTCTAATAGCC P-147 F ATATATCTCGAGTCTCGGGCAGGACTGGAACC P-148R ATATATAAGCTTGAAGGAGCTGGGAGGTCTCC P+2 F P+2R ATATATCTCGAGTCCTGGGCTCCATTGTGTGTG GTCTATAAGCTTAGGCACCGACGGGGCTTCC P-1072F ATATATCTCGAGCCCCAATGTACATTTAAAATAAGG P-882F ATATATCTCGAGGATCTCGTTAAGGATGGTTGTG P-822F ATATATCTCGAGTCGGAAGAGCAGTCGGGTGCTC P-712F ATATATCTCGAGAGGTAGTTTTCCAGAAGGAAC P-560F ATATATCTCGAGGAGCACTGGAGTATTATTCTGAG P-460F ATATATCTCGAGAGCCCAGGAAGTCATTTCTTTG P-371F ATATATCTCGAGATTTGGTGCTCAGACTTTGGGC P-300F ATATATCTCGAGTCTTATGAGCTTGACTGAGCAAGG P-250F ATATATCTCGAGAGACAGTGAGATGGGGGCAGA P-197F ATATATCTCGAGTGAGACAAACTGGCTAGAACCTC P-561R1 P-561+2F ATATATGCTAGCAGGGGGAGAAAGCAGGAGAAT TGCTTTCTCCCCCTCCTGGGCTCCATTGTGTGTG P-561+2R P+209R CAATGGAGCCCAGGAGGGGGAGAAAGCAGGAGAA GTCTATAAGCTTACGTGAGCTGGGGGTCCAGC P+165F mgc(1) F mgc(1) R mgc(2) F mgc(2) R mgc(3) F mgc(3) R mgc(4) F mgc(4) R mcaccc F mcaccc R ATATATCTCGAGTTGCAACTCAAAGAGGCTGA GGACCCCCAGCTCACGTAAGCTTAGCTTCGAAG ACGTGAGCTGGGGGTCCAGCGCGTCTCAGC TGGGCGGAGCTTCGAAGAAGCTTGCGCCCGTGG CTTCGAAGCTCCGCCCACGTGAGCTGGGGG AGGGGCGGGCGCCCGTGAAGCTTGTCCTGAGTG CACGGGCGCCCGCCCCTTCGAAGCTCCGCC GGGCGGGTCCTGAGTGGAAGCTTGACCGGGGCC CCACTCAGGACCCGCCCCACGGGCGCCCGC GTGTGCAGTGCTCAACTCTAACCTTTAACTTGGCCT GTTGAGCACTGCACACACAATGGAGCCCAG
6 Table S1 (continued). Primer Sequence (5-3 ) Amplicon mgc(2,3) F AGAAGCTTGCGCCCGTGAAGCTTGTCCTGAGTG mgc(2,3) R CACGGGCGCAAGCTTCTTCGAAGCTCCGCC mgc(1,2,3) R PKCδ Fq PKCδ Rq ChIP F=P+2F ChIP R=P+289R Methylated F Methylated R Unmethylated F Unmethylated R CACGGGCGCAAGCTTCTTCGAAGCTAAGCT TCTGGGAGTGACATCCTAGACAACAACGGG CAGATGATCTCAGCTGCATAAAACGTAGCC ATATATCTCGAGTCCTGGGCTCCATTGTGTGTG GTCTATAAGCTTACCTCACCCAGGTGCCGG TGTAATTTAAAGAGGTTGAGACGC TAACCGTCTCTAACTCTTATAACGC TAGTTGGTTAGTGGGGAGTTTTG TTAACCATCTCTAACTCTTATAACACC F, Forward; R, Reverse; q, quantitative RT-PCR; m, mutant primers; ChIP, primers used for ChIP experiments; Methylated and unmethylated, primers used for MSP experiments. Sequence of primers for constructions mouse PKCδ promoter reporter plasmids, site-directed mutagenesis, real-time RT-PCR, and ChIP experiments. Boldface letters indicate mutated bases.
7 Table S2. Sense sequences of the oligonucleotides used in EMSAs. Probe/Competitor Sense oligonucleotide (5-3 ) PkcδGC(1, 2) PkcδGC(1, 2) mutant Sp1 consensus Sp1 consensus mutant PkcδGC(1) PkcδGC(2) CACGTGGGCGGAGCTTCGAAGGGGCGGGCGCC CACGTaaTCttAGCTTCGAAGaaTCTttCGCC ATTCGATCGGGGCGGGGCGAGC ATTCGATCGaaTCtttGCGAGC GCTCACGTGGGCGGAGCTTC CTTCGAAGGGGCGGGCGCCCG Nucleotide sequences of the consensus binding motif are underlined. Mutated base pairs in mutant oligos are highlighted in bold and in lowercase. References 1. Li, L. C., and Dahiya, R. (2002) Bioinformatics (Oxford, England) 18(11),
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationSideStep Lysis and Stabilization Buffer
SideStep Lysis and Stabilization Buffer INSTRUCTION MANUAL Catalog #400900 Revision B.0 For Research Use Only. Not for use in diagnostic procedures. 400900-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationSYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationStratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationMir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
More informationBauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationSOP: SYBR Green-based real-time RT-PCR
SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationQuantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)
Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the
More informationBrilliant II SYBR Green QPCR Master Mix
Brilliant II SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600828 (single kit) #600831 (10-pack kit) Revision B.01 For In Vitro Use Only 600828-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationscgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
More informationFisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).
175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further
More informationUSB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationRT 2 Easy First Strand Handbook
March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,
More informationStratagene QPCR Human Reference Total RNA
Stratagene QPCR Human Reference Total RNA Instruction Manual Catalog #750500 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750500-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationThyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed
More informationSynthetic sirna Quantitation Core Kit
Cat. # 6142 For Research Use Synthetic sirna Quantitation Core Kit Product Manual v201010da Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 4 IV.
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany RNA ligands that distinguish metabolite-induced conformations in the TPP riboswitch Günter Mayer, Marie-Sophie L. Raddatz, Julia D. Grunwald,
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationQuantiTect Primer Assay Handbook
July 2011 QuantiTect Primer Assay Handbook For genomewide, ready-to-use real-time RT-PCR assays using SYBR Green detection Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the
More informationPrincipals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
More informationSYBR Real-Time PCR Kit
SYBR Real-Time PCR Kit For Amplification and detection of DNA in Quantitative real-time PCR (qpcr). Catalog No. QPG-040/QPG-041/QPG-042/QPG-043 User Manual Table of Contents Kit Contents and Storage...
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationRP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O
www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light
More informationNucleic Acid Research Group Study: A Follow Up on the Comparison of Different Priming Strategies for cdna synthesis by Reverse Transcriptase
Nucleic Acid Research Group 2008-2009 Study: A Follow Up on the Comparison of Different Priming Strategies for cdna synthesis by Reverse Transcriptase NARG Survey Results for Types of Primers Used for
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationAbsolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationSYBR Advantage qpcr Premix. User Manual
User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
More informationQuant-X One-Step qrt-pcr TB Green Kit User Manual
Takara Bio USA Quant-X One-Step qrt-pcr TB Green Kit User Manual Cat. No. 638317 PT5058-1 (022818) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationReagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo
Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationLightCycler 480 qpcr Tools. Meeting the Challenge of Your Research
LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing
More informationAMV First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered
More informationSYBR Green PCR and RT-PCR Reagents Protocol
SYBR Green PCR and RT-PCR Reagents Protocol For Research Use Only. Not for use in diagnostic procedures. Copyright 2001, Applied Biosystems For Research Use Only. Not for use in diagnostic procedures.
More informationProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.
DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Color Probe qpcr Master Mix #K0354 For 5000 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationBrilliant SYBR Green QRT-PCR Master Mix Kit, 1-Step
Brilliant SYBR Green QRT-PCR Master Mix Kit, 1-Step INSTRUCTION MANUAL Catalog #600552 (single kit) #929552 (10-pack kit) Revision #056003b For In Vitro Use Only *600552-12_056003b/* LIMITED PRODUCT WARRANTY
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationEpiQuik Quantitative PCR Fast Kit Base Catalog # P-1029
EpiQuik Quantitative PCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiQuik Quantitative PCR Fast Kit is designed for quantitative real time analysis of DNA samples
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationmirna 1st-Strand cdna Synthesis Kit
mirna 1st-Strand cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600036 Revision B This document contains two instruction manuals for use with Catalog # 600584. See the 600036-12 manual, shown first, for
More informationApplication Note Detecting low copy numbers. Introduction. Methods A08-005B
Application Note Detecting low copy numbers A08-005B Introduction Sensitivity of a qpcr assay is highly dependent on primer efficiency. Not all assays will be capable of detecting a single copy of template
More informationTQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5
www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, no ROX) TQ1100 200 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ1101 500 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x
More informationSupplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application
Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application SCD1 NM_173959.4 CACGCAAAAGCAGGCTCAGGA GCATCTGGGCTCTCAGACACT RT-qPCR ACC1
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationPrimeScript RT reagent Kit (Perfect Real Time)
Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...
More informationEpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide
EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide Table of Contents I. INTRODUCTION II. PRIMER DESIGN A. Finding the target gene using the UCSC Genome Bioinformatics Site B. Identifying
More informationImpact of gdna Integrity on the Outcome of DNA Methylation Studies
Impact of gdna Integrity on the Outcome of DNA Methylation Studies Application Note Nucleic Acid Analysis Authors Emily Putnam, Keith Booher, and Xueguang Sun Zymo Research Corporation, Irvine, CA, USA
More informationBrilliant SYBR Green QPCR Master Mix
Brilliant SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600548 (single kit) #929548 (10-pack kit) Revision B.01 For In Vitro Use Only 600548-12 LIMITED PRODUCT WARRANTY This warranty limits our
More informationShineSybr Real Time qpcr MasterMix Kits User Manual
ShineSybr Real Time qpcr MasterMix Kits User Manual Cat.Nos.ZK00715(50 rxns 50ul) Published 24 Feb 2007 ZK00716(100 rxns 50ul) Ⅰ Description ShineSybr is a 2X convenient premix reagent, specially designed
More informationCHAPTER 3 DEVELOPMENT OF DENV GROUP SPECIFIC REAL TIME RT-PCR
CHAPTER 3 DEVELOPMENT OF DENV GROUP SPECIFIC REAL TIME RT-PCR 28 Dengue is diagnosed by either detecting virus or antibody to the virus in blood. Isolation of virus in cell culture or in infant mouse brain
More informationAssay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
More informationTable of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationRelative Quantification Getting Started Guide
5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Relative Quantification Getting Started Guide Introduction
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationOptimize Your qpcr and RT-qPCR Assays with Careful Planning and Design
Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design Nadine Nassif, January 2013 Outline Real-Time PCR overview / Understanding qpcr data qpcr detection strategies: dye-based versus label-based
More informationUser Bulletin #2. ABI PRISM 7700 Sequence Detection System. Introduction. Contents. December 11, 1997
User Bulletin #2 ABI PRISM 7700 Sequence Detection System December 11, 1997 SUBJECT: Relative Quantitation of Gene Expression Introduction Amplification of an endogenous control may be performed to standardize
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationII First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationPCR Arrays. An Advanced Real-time PCR Technology to Empower Your Pathway Analysis
PCR Arrays An Advanced Real-time PCR Technology to Empower Your Pathway Analysis 1 Table of Contents 1. Introduction to the PCR Arrays 2. How PCR Arrays Work 3. Performance Data from PCR Arrays 4. Research
More informationAll-in-One TM mirna qrt-pcr Detection Kit
mirna qrt-pcr Detection Kit For quantitative detection of mature mirna Cat. No. QP015 (20 RT and 200 qpcr reactions) Cat. No. QP016 (60 RT and 600 qpcr reactions) Used in combination with the All-in-One
More informationTable of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...
Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationBoost Your Real-Time Results
Boost Your Real-Time Results Refresh your knowledge of the fundamentals of real-time PCR Sample & Assay Technologies 1 Introduction Real-time PCR and RT-PCR are highly sensitive techniques that enable
More informationQuantitative Real time PCR. Only for teaching purposes - not for reproduction or sale
Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP
More informationSuperPrep Cell Lysis & RT Kit for qpcr
SuperPrep Cell Lysis & RT Kit for qpcr 1402 F1267K SuperPrep Cell Lysis & RT Kit for qpcr SCQ-101 100 reactions Store at -20 C SuperPrep Cell Lysis Kit for qpcr SCQ-201 100 preparations Store at -20 C
More informationPolymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr
Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase
More informationBioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna
BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign
More informationTECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C
SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit
More informationReverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months
www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT
More informationSYBR Advantage qpcr Premix User Manual
SYBR Advantage qpcr Premix User Manual Cat. No. 639676 PT3883- (PR65850) Published 3 May 006 Table of Contents I. I ntroduction 4 II. List of Components 6 III. Additional Materials Required 6 IV. General
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More information