earray 5.0 Create your own Custom Microarray Design

Size: px
Start display at page:

Download "earray 5.0 Create your own Custom Microarray Design"

Transcription

1 earray 5.0 Create your own Custom Microarray Design

2 earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene Expression Probe Design CGH High Definition (HD) databases Page 2

3 earray 5.x Agilent Microarray Solution SurePrint tm Technology Agilent Array Technology at a Glance: - In situ oligo synthesis process - Ink-jet printing/phosphoramidite chemistry - Array design defined by electronic file The Agilent Advantage: - Accurate probe synthesis and placement - Great feature morphology - Print any probe sequence between 25-60bp - Multiple file formats to choose from SurePrint technology is uniquely suited to leverage a flexible, webbased approach to creating custom microarrays. Page 3

4 earray 5.x Agilent Microarray Solution Agilent s Microarray Portfolio Agilent provides microarray solutions for a comprehensive set of genomic applications earray currently/ soon will provide a custom component to these applications. DNA RNA acgh/ CNV CH 3 ChIP GX mirna OLS Copy number Cancer Research Cytogenetics Population Studies Methylation Discover and monitor epigenetic changes that play a role in cellular processes Transcription Factors Elucidate the role that protein-dna interaction plays in transcription, replication, and repair Gene Expression Explore gene transcription on a genome-wide basis across a variety of model systems RNA interference Profile micrornas and explore the role they play in gene regulation Oligo Library Synthesis (OLS) Gene Silencing Protein Mutagenesis Whole Gene Synthesis Genome Partitioning Now Now Now Now 2008 Now Page 4

5 earray 5.x Agilent Microarray Solution Agilent Solution Workflow Agilent provides custom solutions, not just products Scanning and Feature Extraction Data Analysis & Viewers earray earray is the first step in Agilent s Microarray solution offering Automated Hyb & Wash Sample Preparation Arrays Sample QC Amplification & Labeling Page 5

6 earray 5.x Functional Overview Function Highlights earray is a secure, web based application that allows you to: Create custom microarray designs Examine Agilent Catalog Content Work collaboratively with others and share designs Search High Definition (HD) CGH/LA Databases Design Custom Probes for Gene Expression (GE) Support High Density Array formats (1 244K, 2 105K, 4 44K, 8 15K) for Free! Page 6

7 earray 5.x Functional Overview The Content Paradigm Agilent Probe 001 Annotation Agilent Probe 002 Annotation Agilent Probe 003 Annotation Agilent Domain Probes Probe Groups Microarray Design Microarray Slide Your Probe 001 Your Probe 002 Your Probe 003 Your Probe 004 Your Probe 005 Your Probe 006 Your WorkGroup Page 7

8 earray 5.x Functional Overview Content Tools Ways to Search Content Keyword searches :GB accession numbers, Gene Symbols, Probe IDs Text string searches (description field) Gene Ontology (GO) Categories Chromosomal Locations; Cytoband IDs Tools and Links Links to NCBI Genbank Pages Filter Probes Based upon metrics Compare Probe Groups Links to EMBL and UCSC genomic browsers Page 8

9 earray 5.x Functional Overview The Workgroup Paradigm Agilent Domain Agilent Catalog HD CGH Probe Database HD ChiP Probe Database Superadmin Your WorkGroup Collaboration Space Other WorkGroup Admin Users Probes, Probe Groups, Microarray Designs Probes, Probe Groups, Microarray Designs Page 9

10 earray 5.x Functional Overview Collaboration Space Example Page 10

11 earray 5.x Functional Overview The Array Creation Process earray provides an easy way of managing the array creation process. Search Agilent Probes Design Probes Create Probe Groups Create Microarray Designs Submit to Manufacture Order Arrays Upload Probes Download Design Files Page 11

12 earray 5.x Functional Overview The UI Design Wizards Design Wizards Takes you through the most common scenarios for creating a microarray design, from start to finish. Page 12

13 earray 5.x Gene Expression Probe Design Probe Design Options Options Same algorithms as catalog probes tm matched methodology also available Probe Length between 25-60bp Upload FASTA file or Genbank IDs Page 13

14 earray 5.x Gene Expression Probe Design Probe Design Process Input Sequence Output Probes Preprocessing Masking Candidate Probes Similarity Search Thermo Calc. Hyperlink to process Page 14

15 earray 5.x Gene Expression Probe Design Other Gene Expression Tools GE Transcript Tiling GE Probe Check Page 15

16 earray 5.x Gene Expression Probe Design Research Spotlight Ramsey et al., 2007 Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design Ramsey et al., 2007 BMC Genomics, 8:423 Background Boyce Thompson Institute for Plant Research, Ithaca, NY Studying the green peach aphid, Myzus persicae (Sulzer), a world-wide insect pest capable of infesting more than 40 plant families Methods Constructed 16 cdna libraries from aphid tissue Sequenced 26K ESTs from libraries ESTs Clustered and Annotated SNPs in contig 254, cathepsin B, a putative gut-specific cysteine protease. Three SNPs were validated by sequencing genomic DNA. Three SNPs in the gene result in one silent change (Leu-Leu), one substitution of a negatively charged amino acid for an aliphatic amino acid (Ala-Glu) and one substitution of an aromatic for an aliphatic amino acid (Leu- Phe) in the green M. persicae lineages (G006 and F001) relative to the red USDA lineage. Results Use resulting targets to design an 8 X 15K gene expression microarray in earray for use in future research.

17 earray 5.x CGH Array Design CGH HD Search Options Custom CGH HD Arrays can be used to resolve genomic insertions and/or deletions at defined genomic locations CGH HD Database Probes Probes Tm matched to 80 C (Probes between bp long) Searchable by Genomic Intervals and Genbank accession numbers Probes are unique to the target genome Page 17

18 earray 5.x CGH Array Design CGH High Definition Databases Comparative Genomic Hybridization (CGH) HD Database: Species Probe# Density Build Annotation Human 8.4 Million 200 bp NCBI Build 36 Mouse 7.2 Million 200 bp NCBI Build 36 Rat 6.9 Million 200 bp UCSC Rn4 Chromatin Immuno precipitation (ChIP) HD Database: Species Probe# Density Build Annotation Human 23.8 Million <100 bp NCBI Build 36 Mouse 27.4 Million <100 bp NCBI Build 36 Rat 22.1 Million <100 bp UCSC Rn4 In addition to A. gambiae; A. thaliana; C. elegans; D. melanogaster; S. cerevisiae (~ 1.0 M each) Page 18

19 earray 5.x CGH Array Design Research Spotlight Shen et al., 2007 Development of a focused oligonucleotide-array comparative genomic hybridization chip for clinical diagnosis of genomic imbalance. Shen et al., 2007 Clinical Chemistry 53: Background Department of Laboratory Medicine, Children's Hospital Boston Studying microdeletion and microduplication syndromes and how they contribute to developmental disorders Methods Selected > mer oligonucleotide features from Agilent's earray probe library to interrogate all subtelomeric and pericentromeric regions and 95 additional clinically relevant regions for a total of 179 loci Results Focused CGH array detected all known regions of genomic imbalance in 51 validation samples with 100% concordance and an excellent signalto-noise ratio

20 earray 5.x Summary earray earray is a web based application that enables the creation of custom microarrays leveraging Agilent s oligonucleotide in situ synthesis microarray platform in support of several application workflows, including CGH, ChIP and Gene Expression. Page 20

21 The End Questions? Page 21

Agilent Genomics Software Future Directions

Agilent Genomics Software Future Directions Agilent Genomics Software Future Directions Michael Rosenberg, PhD Director, Genomics Software Agilent: A Focused Measurement Company Serving Diverse End Markets Electronic Measurement 2008 Revenue: $3.6

More information

Agilent Genomic Workbench 7.0

Agilent Genomic Workbench 7.0 Agilent Genomic Workbench 7.0 Product Overview Guide Agilent Technologies Notices Agilent Technologies, Inc. 2012, 2015 No part of this manual may be reproduced in any form or by any means (including electronic

More information

Complementary Technologies for Precision Genetic Analysis

Complementary Technologies for Precision Genetic Analysis Complementary NGS, CGH and Workflow Featured Publication Zhu, J. et al. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours

High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As

More information

Agilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008

Agilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring

More information

Outline. Array platform considerations: Comparison between the technologies available in microarrays

Outline. Array platform considerations: Comparison between the technologies available in microarrays Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Agilent s Mx3000P and Mx3005P

Agilent s Mx3000P and Mx3005P Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded

More information

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology

More information

Cancer Genetics Solutions

Cancer Genetics Solutions Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting

More information

Custom TaqMan Assays DESIGN AND ORDERING GUIDE. For SNP Genotyping and Gene Expression Assays. Publication Number Revision G

Custom TaqMan Assays DESIGN AND ORDERING GUIDE. For SNP Genotyping and Gene Expression Assays. Publication Number Revision G Custom TaqMan Assays DESIGN AND ORDERING GUIDE For SNP Genotyping and Gene Expression Assays Publication Number 4367671 Revision G For Research Use Only. Not for use in diagnostic procedures. Manufacturer:

More information

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

The Agilent Technologies SureSelect Platform for Target Enrichment

The Agilent Technologies SureSelect Platform for Target Enrichment The Agilent Technologies SureSelect Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Kimberly Troutman Field Applications Scientist January 27 th, 2011 Agenda 1 Introduction:

More information

Introduction to the UCSC genome browser

Introduction to the UCSC genome browser Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA

More information

Data Sheet. GeneChip Human Genome U133 Arrays

Data Sheet. GeneChip Human Genome U133 Arrays GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array

More information

Next Generation Sequencing. Target Enrichment

Next Generation Sequencing. Target Enrichment Next Generation Sequencing Target Enrichment Next Generation Sequencing Your Partner in Every Step from Sample to Data NGS: Revolutionizing Genetic Analysis with Single-Molecule Resolution Next generation

More information

What is a microarray

What is a microarray DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective

More information

Complete Sample to Analysis Solutions for DNA Methylation Discovery using Next Generation Sequencing

Complete Sample to Analysis Solutions for DNA Methylation Discovery using Next Generation Sequencing Complete Sample to Analysis Solutions for DNA Methylation Discovery using Next Generation Sequencing SureSelect Human/Mouse Methyl-Seq Kyeong Jeong PhD February 5, 2013 CAG EMEAI DGG/GSD/GFO Agilent Restricted

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Expression Array System

Expression Array System Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The

More information

Detecting copy-neutral LOH in cancer using Agilent SurePrint G3 Cancer CGH+SNP Microarrays

Detecting copy-neutral LOH in cancer using Agilent SurePrint G3 Cancer CGH+SNP Microarrays Detecting copy-neutral LOH in cancer using Agilent SurePrint G3 Cancer CGH+SNP Microarrays Application Note Authors Paula Costa Anniek De Witte Jayati Ghosh Agilent Technologies, Inc. Santa Clara, CA USA

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

RNA-Sequencing analysis

RNA-Sequencing analysis RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges

More information

The Agilent Technologies SureSelect Platform for Target Enrichment

The Agilent Technologies SureSelect Platform for Target Enrichment The Agilent Technologies SureSelect Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Emily M. Leproust, Ph.D. Director Applications and Chemistry R&D Genomics Agenda: Introduction

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Guided tour to Ensembl

Guided tour to Ensembl Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org

More information

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

More information

IMGM Laboratories GmbH. Sales Manager

IMGM Laboratories GmbH. Sales Manager IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX

Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)

More information

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298

TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES March 2017. March 2017 ABA 298 1 Technologies, Products & Services

More information

The first and only fully-integrated microarray instrument for hands-free array processing

The first and only fully-integrated microarray instrument for hands-free array processing The first and only fully-integrated microarray instrument for hands-free array processing GeneTitan Instrument Transform your lab with a GeneTitan Instrument and experience the unparalleled power of streamlining

More information

Nature Methods: doi: /nmeth.3732

Nature Methods: doi: /nmeth.3732 Supplementary Figure 1 GenomeSpace allows the biologist user to conduct complex analysis. 1a. Flow chart of our analytic approach to dissecting a stem cell-like gene regulatory network in human cancers.

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays

High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

Bioinformatics Analysis of Nano-based Omics Data

Bioinformatics Analysis of Nano-based Omics Data Bioinformatics Analysis of Nano-based Omics Data Penny Nymark, Pekka Kohonen, Vesa Hongisto and Roland Grafström Hands-on Workshop on Nano Safety Assessment, 29 th September, 2016, National Technical University

More information

Chimp Sequence Annotation: Region 2_3

Chimp Sequence Annotation: Region 2_3 Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker

More information

New Stringent Two-Color Gene Expression Workflow Enables More Accurate and Reproducible Microarray Data

New Stringent Two-Color Gene Expression Workflow Enables More Accurate and Reproducible Microarray Data Application Note GENOMICS INFORMATICS PROTEOMICS METABOLOMICS A T C T GATCCTTC T G AAC GGAAC T AATTTC AA G AATCTGATCCTTG AACTACCTTCCAAGGTG New Stringent Two-Color Gene Expression Workflow Enables More

More information

Biologists on the cloud

Biologists on the cloud Biologists on the cloud our experiences using galaxy for next-gen sequencing analyses Karen Reddy, Johns Hopkins University School of Medicine Mo Heydarian, Johns Hopkins University School of Medicine

More information

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with

More information

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane

More information

Philippe Hupé 1,2. The R User Conference 2009 Rennes

Philippe Hupé 1,2. The R User Conference 2009 Rennes A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech

More information

ACCEL-NGS 2S DNA LIBRARY KITS

ACCEL-NGS 2S DNA LIBRARY KITS ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries

More information

DNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007

DNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007 DNA Microarrays Introduction Part 2 Todd Lowe BME/BIO 210 April 11, 2007 Reading Assigned For Friday, please read two papers and be prepared to discuss in detail: Comprehensive Identification of Cell Cycle-related

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC

More information

ChroMoS Guide (version 1.2)

ChroMoS Guide (version 1.2) ChroMoS Guide (version 1.2) Background Genome-wide association studies (GWAS) reveal increasing number of disease-associated SNPs. Since majority of these SNPs are located in intergenic and intronic regions

More information

Functional Genomics in Plants

Functional Genomics in Plants Functional Genomics in Plants Jeffrey L Bennetzen, Purdue University, West Lafayette, Indiana, USA Functional genomics refers to a suite of genetic technologies that will contribute to a comprehensive

More information

Target Enrichment Strategies for Next Generation Sequencing

Target Enrichment Strategies for Next Generation Sequencing Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced

More information

What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?

What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells? Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression

More information

Training materials.

Training materials. Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation

More information

Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip

Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Reproducibility of Extraction of Genomic DNA from Whole Blood samples in EDTA using FUJIFILM membrane technology on the QuickGene-810

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

CMPS 3110 : Bioinformatics. High-Throughput Sequencing and Applications

CMPS 3110 : Bioinformatics. High-Throughput Sequencing and Applications CMPS 3110 : Bioinformatics High-Throughput Sequencing and Applications Sanger (1982) introduced chaintermination sequencing. Main idea: Obtain fragments of all possible lengths, ending in A, C, T, G. Using

More information

Do engineered ips and ES cells have similar molecular signatures?

Do engineered ips and ES cells have similar molecular signatures? Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series

More information

March 20-23, 2010 Sacramento, CA

March 20-23, 2010 Sacramento, CA Comparison of Commercially Available Target Enrichment Methods for Next Generation Sequencing with the Illumina Platform March 20-23, 2010 Sacramento, CA Anoja Perera, Scottie Adams, David Bintzler, Kip

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

Genomic Medicine: Basic Molecular Biology. Atul Butte, MD. Children s Hospital Informatics Program

Genomic Medicine: Basic Molecular Biology. Atul Butte, MD. Children s Hospital Informatics Program Harvard-MIT Division of Health Sciences and Technology HST.512: Genomic Medicine Prof. Atul Butte Genomic Medicine: Basic Molecular Biology Atul Butte, MD Children s Hospital Informatics Program www.chip.org

More information

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow

More information

Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence

Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

IPA : Maximizing the Biological Interpretation of Gene, Transcript & Protein Expression Data with IPA

IPA : Maximizing the Biological Interpretation of Gene, Transcript & Protein Expression Data with IPA IPA : Maximizing the Biological Interpretation of Gene, Transcript & Protein Expression Data with IPA Marisa Chen Account Manager Qiagen Advanced Genomics Marisa.Chen@qiagen.com (203) 500-1237 Dev Mistry,

More information

Quality Measures for CytoChip Microarrays

Quality Measures for CytoChip Microarrays Quality Measures for CytoChip Microarrays How to evaluate CytoChip Oligo data quality in BlueFuse Multi software. Data quality is one of the most important aspects of any microarray experiment. This technical

More information

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms

More information

The ChIP-Seq project. Giovanna Ambrosini, Philipp Bucher. April 19, 2010 Lausanne. EPFL-SV Bucher Group

The ChIP-Seq project. Giovanna Ambrosini, Philipp Bucher. April 19, 2010 Lausanne. EPFL-SV Bucher Group The ChIP-Seq project Giovanna Ambrosini, Philipp Bucher EPFL-SV Bucher Group April 19, 2010 Lausanne Overview Focus on technical aspects Description of applications (C programs) Where to find binaries,

More information

About Strand NGS. Strand Genomics, Inc All rights reserved.

About Strand NGS. Strand Genomics, Inc All rights reserved. About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive

More information

Modern Epigenomics. Histone Code

Modern Epigenomics. Histone Code Modern Epigenomics Histone Code Ting Wang Department of Genetics Center for Genome Sciences and Systems Biology Washington University Dragon Star 2012 Changchun, China July 2, 2012 DNA methylation + Histone

More information

DNA Microarray Data Oligonucleotide Arrays

DNA Microarray Data Oligonucleotide Arrays DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from

STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Understanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University

Understanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University Understanding protein lists from proteomics studies Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu A typical comparative shotgun proteomics study IPI00375843

More information

Multi-omics in biology: integration of omics techniques

Multi-omics in biology: integration of omics techniques 31/07/17 Летняя школа по биоинформатике 2017 Multi-omics in biology: integration of omics techniques Konstantin Okonechnikov Division of Pediatric Neurooncology German Cancer Research Center (DKFZ) 2 Short

More information

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of

More information

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

PrimeTime Pre-designed qpcr Assays

PrimeTime Pre-designed qpcr Assays PrimeTime Pre-designed qpcr Assays nuclease assays for human, mouse, and rat PrimeTime qpcr Assays IDT now offers PrimeTime Pre-designed qpcr Assays that are guaranteed to work for human, mouse, and rat

More information

Soybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms

Soybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing

More information

Getting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013

Getting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013 Getting the Most from Your DNA Analysis from Purification to Downstream Analysis Eric B. Vincent, Ph.D. February 2013 1 Presentation Outline Genomic Analysis Purification Quantitation Qualification Analysis

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org kcoombes@mdanderson.org

More information

O C. 5 th C. 3 rd C. the national health museum

O C. 5 th C. 3 rd C. the national health museum Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,

More information

Goals of pharmacogenomics

Goals of pharmacogenomics Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion

More information

Computational Biology and Bioinformatics

Computational Biology and Bioinformatics Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management

More information