Supporting Information. Osteoblast-Targeting Peptide-Modified Nanoparticle for sirna/microrna Delivery
|
|
- Claire Wilcox
- 6 years ago
- Views:
Transcription
1 Supporting Information Osteoblast-Targeting Peptide-Modified Nanoparticle for sirna/microrna Delivery Yao Sun 2,4,5*, Xiongzhen Ye 1*, Mingxiang Cai 2*, Xiangning Liu 3*, Jia Xiao 1, Chenyang Zhang 2,Yayu Wang 1, Li Yang 1, Jiafan Liu 1,Shannai Li 1, Chen Kang 5, Bin Zhang 5, Qi Zhang 2, Zuolin Wang 2,4#, An Hong 1#,Xiaogang Wang 1# 1 Department of Cell Biology & Institute of Biomedicine, College of Life Science and Technology, Jinan University, Guangzhou, China. 2 Department of Oral Implantology, School of Stomatology, Tongji University, Shanghai, China. 3 The First Affiliated Hospital of Jinan University, Guangzhou,China. 4 Shanghai Engineering Research Center of Tooth Restoration and Regeneration, Shanghai, China 5 Sino-Russian Institute of Hard Tissue Development and Regeneration, the SecondAffiliated Hospital of Harbin Medical University, Harbin, China *All these authors contribute equally to this work. #Correspondence to Xiaogang Wang Department of Cell Biology & Institute of Biomedicine, Jinan University 601 Huangpu Avenue. West, Guangzhou, , China Phone: Fax: txg_wang@jnu.edu.cn Or #Correspondence to An Hong Department of Cell Biology & Institute of Biomedicine, Jinan University 601 Huangpu Avenue. West, Guangzhou, , China Phone: Fax: tha@jnu.edu.cn Or #Correspondence to Zuolin Wang Department of Oral Implantology School of Stomatology, Tongji University 399 Middle Yanchang Road, Shanghai, China Phone: Fax: zuolintongji@126.com
2 Results of protein binding of SDSSD peptide in human osteoblasts are performed in supplementary table 1. Results of protein binding of SDSSD peptide in mouse osteoblasts are performed in supplementary table 2. Figure S1 Cytotoxicity assay of SDSSD peptide in vitro. (A-B) Results of mouse and human osteoblasts viability assays after incubation with 1mg/mL SDSSD peptide, DSS6 or control peptide for 24 hours by using the CellTiter-Blue Reagent. Data was shown as mean ± s.d., N=3 per group. (C-D) Results of mouse and human bone microenvironment cells viability assays after incubation with 1mg/mL SDSSD peptide for 24 hoursdetected by thecelltiter-blue Reagent. Data was shown as mean ± s.d., N=3 per group.
3 Figure S2 Design, synthesis and characterization of SDSSD-PU. (A) Schematic procedure of PU synthesis. (B) Fourier transforminfrared spectroscopy (FI-TR) spectra of PU, SDSSD and SDSSD-PU. Arrow points SDSSD covalent linkage to PU. (C) UV-Vis absorption spectra of PU, SDSSD peptide and SDSSD-PU in water. (D) The standard curve for monitoring of SDSSD peptide at the wavelength of 214 nm. (E) H NMR spectrum of PU, SDSSD peptide and SDSSD-PU in D2O.
4 Figure S3 Cytotoxicity assay of SDSSD-PU in vivo. (A-B) Results of mouse and human bone microenvironment cell viability assays after incubation with SDSSD-PU for 24 hours by using the CellTiter-Blue Reagent. Data was shown as mean ± s.d., N=6 per group. (C) Hemagglutination assay: mouse blood cells were incubated with PU or SDSSD-PU for 1hour. Scale bar, 50 µm. (D) H&E staining of heart, liver, spleen and kidney collected from mice with tail vein injected of PU or SDSSD-PU. Scale bar, 20 µm. (E) Quantification of serum CK-MB, ALT, AST and BUN level by a clinical chemistry analyzer. CK-MB: creatine kinase-mb; ALT: alanine aminotransferase; AST: aspartate aminotransferase; BUN: blood urea nitrogen. Data was shown as mean ± s.d., N=6 per group. (F) Quantification analysis of serum IL-6, TNF-α and IFN-α by ELISA. IL-6: interleukin-6; TNF-α: tumor necrosis factor-α; IFN-α: interferon-α. Data shown as mean ± s.d., N=6 per group.
5 Figure S4 SDSSD-PU uptake by human endothelial cells line (HUVEC). (A) Fluorescence micrographs of endothelial cell line (HUVEC) and osteoblasts incubated with PU-Cy3-miRNA or SDSSD-PU-Cy3-miRNA for 6 hours. (B) Q-PCR analysis of cel-mirna-67 level in endothelial cells line (HUVEC) and osteoblasts incubated with PU-cel-miRNA-67 or SDSSD-PU-cel-miRNA-67 for 6 hours.
6 Figure S5 The stability and degradation of SDSSD-PU. (A)The particle size distribution of SDSSD-PU in aging time determined by DLS analysis. (B) Zeta-potential of SDSSD-PU in aging time determined by dynamic light scattering. (C) Localization of mirna in mouse bone tissue after injection of SDSSD-PU-Cy3-miRNA or naked Cy3-miRNA for 48 hours. (D)Colocalization analysis of SDSSD-PU-Cy3-miRNA and endosome marker Rab5 by confocal microscopy in osteoblasts.
Supporting Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2017 Supporting Information Ball-in-ball ZrO 2 Nanostructure for Simultaneous CT Imaging and Highly
More informationSupporting information. Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo
Supporting information Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo Greg Thurber 1, Katy Yang 1, Thomas Reiner 1, Rainer Kohler 1, Peter Sorger 2, Tim Mitchison
More information64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
More informationAPPLICATION NOTE Rev. 7/2017, v4.0 Fluorescent Nanodiamonds: Bio-applications. Physical and Fluorescence Properties
APPLICATION NOTE Rev. 7/2017, v4.0 Fluorescent Nanodiamonds: Bio-applications Fluorescent nanodiamonds (FNDs) offer a unique alternative to currently existing fluorescent biomarkers. With exceptional photo
More informationStrategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
More informationSupporting Information for. Bongseo Choi, 1, Hyojin Moon, 1, Sung Joon Hong, 1 Changsik Shin, 1 Yoonkyung Do, 1 Seongho Ryu, 2,* Sebyung Kang 1,*
Supporting Information for Effective Delivery of Antigen-Encapsulin Nanoparticle Fusions to Dendritic Cells Leads to Antigen-Specific Cytotoxic T Cell Activation and Tumor Rejection Bongseo Choi, 1, Hyojin
More informationSupplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means
More informationSupporting information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting information Near Infrared Light-responsive and Injectable Supramolecular Hydrogels for
More informationContribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis
Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis Yan Liu 1,*, Zhipeng Han 1,*, Yingying Jing 1,*, Xue Yang 1, Shanshan Zhang 1, Chen
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationSupplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
More informationSupporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
More informationRandomly arrayed G-rich DNA sequence for label-free and realtime. assay of enzyme activity
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Randomly arrayed G-rich DNA sequence for label-free and realtime assay of enzyme activity Zhuoliang
More informationNature Medicine: doi: /nm.4464
Supplementary Fig. 1. Amino acid transporters and substrates used for selectivity screening. (A) Common transporters and amino acid substrates shown. Amino acids designated by one-letter codes. Transporters
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
More informationAIE (AIEE) and Mechanofluorochromic Performances of. TPE-methoxylates: Effects of Single Molecular Conformations
AIE (AIEE) and Mechanofluorochromic Performances of TPE-methoxylates: Effects of Single Molecular Conformations Qingkai Qi a, Yifei Liu* b, Xiaofeng Fang b, Yumo Zhang a, Peng Chen a, Yi Wang a, Bing Yang
More informationSupplementary Information. Binding-responsive catalysis of Taq DNA polymerase for sensitive. and selective detection of cell-surface proteins
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Supplementary Information Binding-responsive catalysis of Taq DNA polymerase for sensitive and
More informationPhoton Upconversion Sensitized Nanoprobes for
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Supporting Information Photon Upconversion Sensitized Nanoprobes for Sensing and Imaging of ph
More informationSupplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,
More informationCENTRIFUGAL MICROFLUIDICS
CENTRIFUGAL MICROFLUIDICS Yoon-Kyoung Cho School of Nano-Bioscience and Chemical Engineering, Ulsan National Institute of Science and Technology (UNIST), Republic of Korea ABSTRACT Lab-on-a-disc, in which
More informationElectronic Supplementary Information (ESI) for. In vivo Two-photon Fluorescent Imaging of Fluoride with a Desilylationbased Reactive Probe
Electronic Supplementary Information (ESI) for In vivo Two-photon Fluorescent Imaging of Fluoride with a Desilylationbased Reactive Probe Dokyoung Kim, a Subhankar Singha, a Taejun Wang, b Eunseok Seo,
More informationFluorescence Microscopy. Terms and concepts to know: 10/11/2011. Visible spectrum (of light) and energy
Fluorescence Microscopy Louisiana Tech University Ruston, Louisiana Microscopy Workshop Dr. Mark DeCoster Associate Professor Biomedical Engineering 1 Terms and concepts to know: Signal to Noise Excitation
More informationSupplementary Materials for. Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer
Supplementary Materials for Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer Guizhi Zhu, Huimin Zhang,, Orit Jacobson, Zhantong Wang, Haojun Chen,, Xiangyu Yang, ǁ, Gang Niu,
More informationaddresses: and
Supplementary Data Cytotoxicity and potency of mesocellular foam-26 in comparison to layered clays used as haemostatic agents Yao Li 1, April M. Sawvel 2, Young-Si Jun 2, Sara Nownes 2, Ming Ni 1, Damien
More informationA nucleic acid-based fluorescent sensor for expeditious detection of pyrophosphate anions at nanomolar concentrations
Supporting Information for A nucleic acid-based fluorescent sensor for expeditious detection of pyrophosphate anions at nanomolar concentrations Xin Su, Chen Zhang, Xianjin Xiao, Anqin Xu, Zhendong Xu
More informationSupporting Information
Supporting Information Cascade Signal Amplification Based on Copper Nanoparticle-Reported Rolling Circle Amplification for Ultrasensitive Electrochemical Detection of the Prostate Cancer Biomarker Ye Zhu
More informationIn Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1
This journal is The Royal Society of Chemistry 213 In Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1 Dong-Dong Zheng, a Dong Pan, a Xiao Zha, ac Yuqing Wu,* a Chunlai
More informationThe One Year Fate of Iron Oxide Coated Gold. Nanoparticles in Mice
Supporting Information The One Year Fate of Iron Oxide Coated Gold Nanoparticles in Mice Jelena Kolosnjaj-Tabi, 1,2+ Yasir Javed, 3+ Lénaic Lartigue, 1,3 Jeanne Volatron, 1 Dan Elgrabli, 1 Iris Marangon,
More informationFLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range
FLUORESCENT PEPTIDES Peptides and amino acids labeled with and Tide Quencher TM We offer peptides and amino acids tagged with fluorescent dyes. They meet highest demands in fluorescence intensity and photo-stability,
More informationSupporting Information
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Supporting Information Integration of Graphene Oxide and DNA as Universal Platform
More informationA biotin-guided formaldehyde sensor selectively detecting endogenous concentrations in cancerous cells and tissues
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information for A biotin-guided formaldehyde sensor selectively detecting
More informationBioNano Laboratory, School of Engineering, University of Guelph, Guelph, ON N1G 2W1 Canada;
Supplementary Information OPEN ACCESS sensors ISSN 1424-8220 www.mdpi.com/journal/sensors A Homogenous Fluorescence Quenching Based Assay for Specific and Sensitive Detection of Influenza virus A Hemagglutinin
More informationFigure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9
Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,
More informationSupplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient
Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,
More informationSchool of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou , P.R.China
Sequence-specific recognition of double-stranded DNA with molecular beacon with the aid of Ag + under neutral ph environment Zhiyou Xiao, Xiaoting Guo, Liansheng Ling * School of Chemistry and Chemical
More informationImaging of protein crystals with two photon microscopy
Supporting Information Imaging of protein crystals with two photon microscopy Pius Padayatti,*, Grazyna Palczewska,*, Wenyu Sun, Krzysztof Palczewski,# and David Salom Polgenix Inc., Cleveland, Ohio 44106,
More informationSupporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis
Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined Hyperthermia for Enhanced Cancer Cell Apoptosis Birju P. Shah a, Nicholas Pasquale a, Gejing De b, Tao Tan b, Jianjie
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Materials and Methods Circular dichroism (CD) spectroscopy. Far ultraviolet (UV) CD spectra of apo- and holo- CaM and the CaM mutants were recorded on a Jasco J-715 spectropolarimeter
More informationBF Fox-3 HLA merge A 3
Supplementary Figure 1 F Fox-3 merge 3 SN TRL L P L TRL SN P Supplementary Figure 1. Series of low magnification brightfield and immunofluorescence images (Fox-3 in green/, and in red). ircles indicate
More informationContents. The Right Surface for Every Cell Extracellular Matrices and Biologically Coated Surfaces ECM Mimetic and Advanced Surfaces...
Contents The Right Surface for Every Cell... 1 Extracellular Matrices and Biologically Coated Surfaces... 2 Corning Matrigel Matrix... 2 Corning BioCoat Cultureware... 3 ECM Mimetic and Advanced Surfaces...
More informationCBI Toolbox Tour 2015
CBI Toolbox Tour 2015 Thermophoresis (NanoTemper) NT.115 & NT.LabelFree Images: NanoTemper Circular Dichroism Jasco J-1500 Spectrometer Six Position Turreted Peltier Temperature Control System Automated
More informationSupplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSupplemental Information. Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis
Supplemental Information Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis Yunpeng Bai ;, Lujuan Zhang #, Hongming Zhou #, Yuanshu Dong #, Qi Zeng, Weinian Shou, and Zhong-Yin Zhang
More informationSupporting Information. Cationic Conjugated Polymers-Induced Quorum Sensing of Bacteria Cells
Supporting Information Cationic Conjugated Polymers-Induced Quorum Sensing of Bacteria Cells Pengbo Zhang, Huan Lu, Hui Chen, Jiangyan Zhang, Libing Liu*, Fengting Lv, and Shu Wang* Beijing National Laboratory
More informationPhagocytosis Assay Kit (IgG PE)
Phagocytosis Assay Kit (IgG PE) Item No. 600540 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationA subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
More informationSupplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway
Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen
More informationSupplementary Information
Supplementary Information Trapping and Detection of Nanoparticles and Cells Using a Parallel Photonic Nanojet Array Yuchao Li, Hongbao Xin, Xiaoshuai Liu, Yao Zhang, Hongxiang Lei*, and Baojun Li* State
More informationNanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41565-017-0012-z In the format provided by the authors and unedited. Nanoparticle orientation to control RNA loading and ligand display on extracellular
More informationThermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol
Protocol Thermo Scientific Transfection Reagents sirna Transfection Protocol The following is a general protocol for use of Thermo Scientific transfection reagents to deliver sirna into cultured mammalian
More informationSupplementary Information. Silver Nanoclusters Beacon as Stimuli-Responsive Versatile. Platform for Multiplex DNAs Detection and
Supplementary Information Silver Nanoclusters Beacon as Stimuli-Responsive Versatile Platform for Multiplex DNAs Detection and Aptamer-substrate Complexes Sensing Guoliang Liu,,, Jingjing Li,, Da-Qian
More informationSupporting Information
Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2017 Supporting Information Supramolecular Conjugated Polymer Materials for Organelle
More informationIn vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay. Josephine MY Ko and Maria Li Lung *
In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay Josephine MY Ko and Maria Li Lung * Clinical Oncology Department, The Univerisity of Hong Kong, Hong Kong, Hong Kong SAR *For
More informationingenio electroporation kits & solution
ingenio electroporation kits & solution Electroporation x DEFINITION and OPTIMIZATION What is ELECTROPORATION? Electroporation is a physical method of nucleic acid transfer wherein the cells and nucleic
More informationTITLE: Novel Small-Molecule Inhibitor of Tyk2: Lucrative Therapeutic Target in Lupus
AWARD NUMBER: W81XWH-16-1-0609 TITLE: Novel Small-Molecule Inhibitor of Tyk2: Lucrative Therapeutic Target in Lupus PRINCIPAL INVESTIGATOR: Abhishek Trigunaite CONTRACTING ORGANIZATION: SRI International
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor
More informationSupporting Information For
Supporting Information For Stimuli-Responsive Functionalized Mesoporous Silica Nanoparticles for Drug Release in Response to Various Biological Stimuli Xin Chen a,b, Xiaoyu Cheng a,b, Alexander H. Soeriyadi
More informationELISPOT and FLUOROSPOT kits
ELISPOT and FLUOROSPOT kits Interleukins Interferons Granzymes and perforins TNF superfamily ligands and receptors Apoptosis markers And many more... ELISPOT and FLUOROSPOT: a cell-based assay to assess
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationCollege of Resources and Environmental Sciences, Fujian Agriculture and Forestry University, Fuzhou , China
Electronic Supplementary Material (ESI) for Environmental Science: Nano. This journal is The Royal Society of Chemistry 2017 Effects of titanium oxide nanoparticles on tetracycline accumulation and toxicity
More informationE. coli Phagocytosis Assay Kit
E. coli Phagocytosis Assay Kit Item No. 601370 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationA Comparative Study of Upconverting Nanoparticles Versus Lentiviral GFP Transduction for Labeling Mesenchymal Stem Cells
A Comparative Study of Upconverting Nanoparticles Versus Lentiviral GFP Transduction for Labeling Mesenchymal Stem Cells Artem Kutikov, B.S., Liang Zhao, Gang Han, Ph.D., Jie Song, Ph.D.. University of
More informationElecrtonic Supplementary Information. Application of quantum dot barcodes prepared using biological self-assembly to multiplexed immunoassays
Elecrtonic Supplementary Information Application of quantum dot barcodes prepared using biological self-assembly to multiplexed immunoassays Sakandar Rauf, Andrew Glidle and Jonathan M Cooper Department
More informationKidney-specific transposon-mediated gene transfer in vivo
Woodard et al. Kidney-specific transposon-mediated gene transfer in vivo Lauren E. Woodard, 1,2,6 Jizhong Cheng, 6 Richard C. Welch, 2 Felisha M. Williams, 2 Wentian Luo, 2 Leslie S. Gewin, 1,2,4 and Matthew
More informationHOST DEFENSE SMALL GROUP PROBLEM SOLVING SESSION CLINICAL IMMUNOLOGIC ASSAYS-II
HOST DEFENSE SMALL GROUP PROBLEM SOLVING SESSION CLINICAL IMMUNOLOGIC ASSAYS-II Monday, March 24, 2008 2:00 PM 4:00 PM Small Group Classrooms LEARNING GOAL Understanding in vitro assessment of immunologic
More informationSupporting Information
Supporting Information Agemy et al. 10.1073/pnas.1114518108 SI Methods Cell Lines and Tumors. HUVEC (Lonza) were cultured using EBM- 2 medium with endothelial cell growth supplement (Lonza). Human astrocytoma
More informationSupplemental Material
Supplemental Material Supplemental Methods Hepatocyte ploidy analysis Kidney immunostaining Plasma and urine chemistry analysis Plasma and urine amino acid analysis Supplemental Figures Supplemental Figure
More informationSupplementary Fig. 5
Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency
More informationCHAPTER 4. DEVOLEPMENT OF IMMUNO-DOT BLOT ASSAY USING DUAL LABELED GOLD NANOPARTICLE PROBE TO DETECT Cryptosporidum parvum
51 CHAPTER 4 DEVOLEPMENT OF IMMUNO-DOT BLOT ASSAY USING DUAL LABELED GOLD NANOPARTICLE PROBE TO DETECT Cryptosporidum parvum 4.1 INDRODUCTION Cryptosporidium parvum is a significant diarrhoea causing parasitic
More informationIntestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan
More informationSupplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm
Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm that BsSMC was labeled with Cy3 NHS-Ester. In each panel,
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we
More informationSupplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)
More informationPARTIALLY PURIFIED LENTINAN FROM SHIITAKE MUSHROOM (LENTINUS EDODES) STILL RETAIN ANTITUMOUR ACTIVITY
-------The 3 rd ICMBMP October 1999 PARTIALLY PURIFIED LENTINAN FROM SHIITAKE MUSHROOM (LENTINUS EDODES) STILL RETAIN ANTITUMOUR ACTIVITY Ann-Teck Yap, Sudhir Kumar Chandramohan, Mah-Lee Ng Mary Department
More informationnanoprecipitation mpeg-pla 2 nd Emulsion mpeg-pla in DCM
THERAPEUTIC NANOTECHNOLOGY LAB MODULE Location: BioNano Lab, 3119 Micro and Nanotechnology Laboratory (MNTL) Instructor: Jianjun Cheng, Assistant Professor of Materials Science and Engineering Lab Assistants:
More informationSilencing TNF-α in macrophages and dentritic cells for arthritis treatment. Chunting Ye
Silencing TNF-α in macrophages and dentritic cells for arthritis treatment Chunting Ye Biomedical Sciences Department Paul L. Foster School of Medicine Texas Tech University Health Sciences Center Targeting
More informationab CFSE Fluorescent Cell Labeling Kit
ab113853 CFSE Fluorescent Cell Labeling Kit Instructions for Use For the durable fluorescent labeling of live cells for fluorescent microscopy and flow cytometry, population growth studies and within sample
More informationColorimetric detection of influenza A (H1N1) virus based on peptide functionalized polydiacetylene (PEP-PDA) nanosensor
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Electronic Supporting Information Colorimetric detection of influenza A (H1N1) virus based
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationThe Duality of Iron Oxide Nanoparticles in Cancer Therapy: Amplification of Heating
Supporting Information The Duality of Iron Oxide Nanoparticles in Cancer Therapy: Amplification of Heating Efficiency by Magnetic Hyperthermia and Photothermal Bimodal Treatment Ana Espinosa, Riccardo
More informationYoshida et al. Extra-hepatic PDGFB, Delivered by Platelets, Promotes Activation of Hepatic Stellate Cells and Biliary Fibrosis in Mice
Yoshida et al. Extra-hepatic PDGFB, Delivered by Platelets, Promotes Activation of Hepatic Stellate Cells and Biliary Fibrosis in Mice SUPPLEMENTARY MATERIAL PDGF receptor β is upregulated across experimental
More informationA CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish
Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae
More informationfrom α- to β-cleavage
Supplementary Information Specific antibody binding to the APP 672-699 region shifts APP processing from α- to β-cleavage Song Li 1,6,8, Juan Deng 1,7,8, Huayan Hou 1,8, Jun Tian 1, Brian Giunta 2,3, Yanjiang
More informationNature Immunology: doi: /ni.3101
Supplementary Figure 1 Generation of Plvap / mice. (a) Schematic presentation of the targeting construct as well as the wild-type and targeted Plvap alleles]. PuroR, puromycin resistance. The location
More informationDepartment of Chemistry, University of California, Davis, California 95616, USA 2
Enhance Solar Water Splitting Performance by Utilizing Near Infrared Radiation with Composite Films of Hematite and Rare Earth Doped Upconversion Materials Ming Zhang, 1 Yongjing Lin, 2 Thomas J. Mullen,
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationBIO 315 Lab Exam I. Section #: Name:
Section #: Name: Also provide this information on the computer grid sheet given to you. (Section # in special code box) BIO 315 Lab Exam I 1. In labeling the parts of a standard compound light microscope
More informationFlow Cytometry - The Essentials
Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.
More informationTnf (Rat) ELISA Kit. Catalog Number KA assays Version: 02. Intended for research use only.
Tnf (Rat) ELISA Kit Catalog Number KA3115 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationAspartate Aminotransferase Activity Assay Kit (Fluorometric)
ab138878 Aspartate Aminotransferase Activity Assay Kit (Fluorometric) Instructions for Use For measurement of Aminotransferase activity (AST) in various biological samples. This product is for research
More informationA modular platform for targeted RNAi therapeutics
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s4156501700435 In the format provided by the authors and unedited. A modular platform for targeted RNAi therapeutics Ranit Kedmi 1, Nuphar Veiga
More informationBEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION
BEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION The lab mouse is the most commonly used mammalian model system for genetic research. Scientists from a wide
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More informationSupporting information
Supporting information Simple and Integrated Spintip-based Technology Applied for Deep Proteome Profiling Wendong Chen,, Shuai Wang, Subash Adhikari, Zuhui Deng, Lingjue Wang, Lan Chen, Mi Ke, Pengyuan
More informationEnhanced Sensitivity Carbon Nanotubes as Targeted Photoacoustic Molecular Imaging Agents
Enhanced Sensitivity Carbon Nanotubes as Targeted Photoacoustic Molecular Imaging Agents Adam de la Zerda 1,2,*, Zhuang Liu 3,*, Cristina Zavaleta 1, Sunil Bodapati 1, Robert Teed 1, Srikant Vaithilingam
More informationEuropass Curriculum Vitae
Europass Curriculum Vitae Personal information Surname / First name Dal Collo Giada 7, Via Canova, 36010, Velo d Astico (VI), Address Italy Mobile +39 3481525172 E-mail giada.dalcollo@gmail.com Nationality
More informationBiomedical Applications of Molecular Spectroscopy
Biomedical Applications of Molecular Spectroscopy Mike Kayat B&W Tek, Inc 19 Shea Way Newark, DE 19713 United States of America +1 302 368 7824 mikek@bwtek.com 1 Overview Molecular spectroscopy is a large
More information