SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
|
|
- Audra Stevens
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal Halfmann 1, Jacinth Naidoo 1, Lai Wang 4, Lin Li 4, She Chen 3, Patrick Harran 5, Xiaoguang Lei 2,3*, and Xiaodong Wang 1,3* 1 Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA. 2 School of Pharmaceutical Science and Technology, Tianjin University, Tianjin , China 3 National Institute of Biological Sciences (NIBS), Beijing , China 4 Joyant Pharmaceuticals, Dallas, TX 75207, USA 5 Department of Chemistry and Biochemistry, University of California, Los Angeles, CA 90095, USA (*) Corresponding author: wangxiaodong@nibs.ac.cn, leixiaoguang@nibs.ac.cn, and gelin.wang@utsouthwestern.edu, Tel: , Fax:
2 SUPPLEMENTARY RESULTS Supplementary Figure 1. Schematic of the screen design and procedure. 2
3 Supplementary Figure 2. Bioymifi efficiently kills a variety of cancer cells as singleagent. The dose-response curves for bioymifi or TR in the absence or presence of SM were plotted for HeLa, H460, U2OS, HT29, H1155, and Miapaca cell lines. Supplementary Figure 3. Full-length gel images of western blot depicted in the Figure 2 of main text. Supplementary Figure 4. DR5 sirnas specifically decrease the mrna levels of DR5 but not DR4. The DR5 and DR4 mrna levels in the knockdown cells were analyzed using quantitative RT-PCR. 3
4 Supplementary Figure 5. Sensitivity to bioymifi is similar in HCC15 parental cells and the DR5-overexpressing cells (15-13). The cells were treated with the indicated concentrations of bioymifi in the presence of SM for 48 hours. Supplementary Figure 6. Full-length gel images of western blot depicted in the Figure 3 of main text. 4
5 Supplementary Figure 7. (a) Both FADD and TRADD are required for TRAIL-induced apoptosis in MEFs. MEFs derived from WT, FADD -/-, or TRADD -/- mice were treated with 100ng/ml mouse TRAIL for 48 hours. The cell viability was measured by using the Cell Titer-Glo kit. (b-c) T98G cells were transfected with Luciferase and RIPK1 sirnas. After 48 hours, cell viability was measured, and the cell lysates were subjected to the western blot with RIPK1 and tubulin antibodies. Supplementary Figure 8. TRAIL mrna levels in the knockdown cells. T98G were transfected with three independent sirnas (TR-1, -2 or -3) for TRAIL. After 48 hours of transfection, RT-PCR was performed to assess the knockdown efficiency. 5
6 Supplementary Figure 9. A Coomassie-stained SDS-polyacrylamide (PAGE) gel showing purified recombinant proteins for His-tagged extracellular domain of DR4 (DR4-ECD) and DR5 (DR5-ECD). Supplementary Figure 10. A dilution series for bioymifi was produced from a 10mM DMSO stock into TBS buffer. After 1 hour incubation at room temperature, the solutions were centrifuged at 12,000rpm for 5 min. The absorbance for the supernatant of these samples was measured at 420 nm, which is the peak absorbance wavelength in TBS solution. 6
7 Supplementary Figure 11. Full-length gel images of western blot depicted in the Figure 5 and Figure 6 of main text. Supplementary Figure 12. Bioymifi stimulates high molecular weight complex formation. DR5-expressing cells were stimulated or not for 2 hours with 10 µμ bioymifi 7
8 in the absence or presence of SM. The cell lysates were fractionated on a Superdex-200 gel filtration column. Flag-DR5, FADD, and Caspase-8 were analyzed by western blotting. The size of the complex can be estimated by the molecular weight of the standard markers for size exclusion column indicated at the top of the figure. Supplementary Figure 13. Depletion of DR5 reduces the receptor clustering induced by bioymifi. (a) The DR5-expressing cells transfected with control or DR5 sirnas were treated with 10 µm bioymifi for 1 hour and then immunostained with a Flag antibody (red). The images were acquired using a DeltaVision microscope. The exposure time was 0.5 sec, and the images were processed using Image J software. Scale bar: 20 µm. (b) Cell lysates of Luciferase RNAi and DR5 RNAi cells were analyzed by western blot with Flag and actin antibodies. 8
9 Supplementary Figure 14. Bioymifi-induces aggregation is specific for DR5. (a) DR5-Flag-expressing cells were incubated for 1 hour with DMSO (control) or 5 µm bioymifi. The cells were immunostained with Flag, DR4, FAS, or TNFR1 antibodies. The images were taken using a Zeiss LSM 510 confocal microscope. Scale bar represents 10 µm. The percentage of the cells with clustering death receptor were quantified in (b) (n= 100). 9
10 Supplementary Table 1. SAR analysis identified an active compound, bioymifi, with a well-defined structure. Twenty-four chemical analogs of A2C2 were compared based on cell-killing efficacy. The dose-response curve was generated for each compound based on cell survival as measured using the Cell Titer-Glo Luminescent Cell Viability Assay. IC 50 values represent the concentration of compound that was required for 50% inhibition of cell viability. IC 50 values of cell viability were determined in T98G cells. 10
11 Supplementary Table 2. Kd (binding constant) and IC 50 values of the compounds used in the Figure 5c of main text. 11
Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationOnline Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationSupporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
More informationPurification of Lactate Dehydrogenase
Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationSupplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationA) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical
A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationThe Viability of Cancerous vs. Non-cancerous Cells
THE JOURNAL OF UNDERGRADUATE RESEARCH University of Kansas Fall 2009 The Viability of Cancerous vs. Non-cancerous Cells Lung cancer is a disease that affects a number of human beings in the world each
More informationTE5 KYSE510 TE7 KYSE70 KYSE140
TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study. Rpm Rpm Rpm Chip-seq H3K7ac
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationSupplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
More informationSupplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway
Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationSupplementary Materials for. Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer
Supplementary Materials for Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer Guizhi Zhu, Huimin Zhang,, Orit Jacobson, Zhantong Wang, Haojun Chen,, Xiangyu Yang, ǁ, Gang Niu,
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationaffects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de
Shedding of neurexin 3β ectodomain by ADAM10 releases a soluble fragment that affects the development of newborn neurons Erika Borcel* a, Magda Palczynska* a, Marine Krzisch b, Mitko Dimitrov a, Giorgio
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationSupplementary Information
Supplementary Information Live imaging reveals the dynamics and regulation of mitochondrial nucleoids during the cell cycle in Fucci2-HeLa cells Taeko Sasaki 1, Yoshikatsu Sato 2, Tetsuya Higashiyama 1,2,
More informationFRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationab GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression
ab117992 GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression This product is for research use only and is not for diagnostic use. intended www.abcam.com Table
More informationOne-Step Western TM Kit using TMB
Technical Manual No. 0203 Version 03272008 I Description.. 1 II Kit Contents.. 2 III Applications 3 IV Key Features.. 3 V Storage.. 3 VI One-Step Western TM Protocol. 3 VII Examples. 3 VIII Troubleshooting..
More informationSupplementary Information
Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,
More informationHUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT
HUMAN CTGF ELISA KIT Page 1 HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT PURCHASE INFORMATION: FOR THE QUANTITATIVE DETERMINATION OF HUMAN CTGF CONCENTRATIONS IN SERUM AND PLASMA ELISA NAME Catalog
More information- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.
+ NaCr NaCr + NaCr NaCr Peptides 10ng 50ng 250ng K α Pan (mouse) Pan (mouse) 10ng 50ng 250ng α Pan (rabbit) C 10ng 50ng 250ng α Pan (mouse) 0 1.25 2.5 5 10 20 40 (mm) NaCr 24h α Pan (rabbit) α K4me2 α
More informationSupplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells
Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,
More informationHeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
More informationTAG-LITE RECEPTOR LIGAND BINDING ASSAY
TAG - L I T E TAG-LITE RECEPTOR LIGAND BINDING ASSAY PROTOCOL ASSAY PRINCIPLE The Tag-lite Ligand Binding Assay is a homogeneous alternative to radio ligand binding assays for HTS and compound profiling.
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationOptimization of a LanthaScreen Kinase assay for BRAF V599E
Optimization of a LanthaScreen Kinase assay for BRAF V599E Overview This protocol describes how to develop a LanthaScreen kinase assay designed to detect and characterize inhibitors of BRAF V599E using
More informationSmall-Molecule Drug Target Identification/Deconvolution Technologies
Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily
More informationTag-lite Tachykinin NK1 labeled Cells, ready-to-use (transformed & labeled), 200 tests* (Part# C1TT1NK1)
TAG - L I T E Tag-lite Tachykinin NK1 Receptor Ligand Binding Assay protocol Tachykinin NK1 labeled cells for: 200 tests Part#: C1TT1NK1 Lot#: 03-1 March 2016 (See expiration date on package label) Store
More informationDifferent Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,
More informationNotes to accompany the slidecast on theory of SDS PAGE and Western blotting
S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
More informationSupplementary Information
Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationSOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency
Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko
More information* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)
I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary
More information42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
More informationJournal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationAward Number: W81XWH TITLE: Direct inhibition of Skp2 for the Treatment of Advanced Prostate Cancer. PRINCIPAL INVESTIGATOR: Hyun-Suk Lim
AD Award Number: W81XWH-11-1-0286 TITLE: Direct inhibition of Skp2 for the Treatment of Advanced Prostate Cancer PRINCIPAL INVESTIGATOR: Hyun-Suk Lim CONTRACTING ORGANIZATION: Indiana University Indianapolis,
More informationKhaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression
Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2
More informationSciences, Budapest, H-1117 Magyar tudósok körútja 2, PO Box 286, HUNGARY
Title: Interactions of retinoids with the ABC transporters P-glycoprotein and Breast Cancer Resistance Protein Running title: Interactions of retinoids with ABCB1 and ABCG2 Authors: Szabolcs Tarapcsák
More informationNanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41565-017-0012-z In the format provided by the authors and unedited. Nanoparticle orientation to control RNA loading and ligand display on extracellular
More informationBLOCK-iT Transfection Optimization Kit
BLOCK-iT Transfection Optimization Kit Catalog no. 13750-047 Version B 27 June 2007 25-0718 User Manual ii Table of Contents Table of Contents...iii Kit Contents and Storage... v Accessory Products...vi
More informationXfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
More informationDolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system
Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION
More informationSupplemental Materials and Methods
Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells (2 10 6 ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM),
More informationThe microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
More informationPD-1 Pathway Recombinant Protein Collection
Pathway Recombinant Protein Collection www.acrobiosystems.com Content I. Introduction II. Biotinylated Pathway Proteins IIa. ELISA IIb. FAC Sorting IIc. Biopanning III. HPLC-verified Proteins IV. Full-length
More informationApplication Note AN001
Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3
More informationTransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
More informationHUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT
HUMAN CTGF ELISA KIT PAGE 1 HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT PURCHASE INFORMATION: ELISA NAME HUMAN CTGF ELISA FOR THE QUANTITATIVE DETERMINATION OF HUMAN CTGF CONCENTRATIONS IN SERUM
More informationReagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo
Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine
More informationKinase Reaction and Alkylation Protocol
Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More informationSize Exclusion BioHPLC Columns
Size Exclusion BioHPLC Columns Size Exclusion Product Families Particle Porosity Functionalities Particle Pore Size Application Sizes Agilent Bio SEC- Silica Fully porous N/A um 00A, 0A, 00A High efficiency
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/157/ra4/dc1 Supplementary Materials for Genome-Wide RNAi Screen Reveals Disease-Associated Genes That Are Common to Hedgehog and Wnt Signaling Leni S. Jacob,
More informationINSECT CELL/BACULOVIRUS PRODUCTION
INSECT CELL/BACULOVIRUS PRODUCTION PEF # GENE NAME TRANSFER VECTOR BEVS MOLECULAR WEIGHT 2015-XXXX XXXX pbac1 flashbacultra TM 36.0 kda EXPRESSION METHOD OVERVIEW: Insect cells Spodoptera frugiperda (Sf9)
More informationSupporting Information
Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2017 Supporting Information Supramolecular Conjugated Polymer Materials for Organelle
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationA General Protocol for GST Pull-down Lili Jing *
A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationSupplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat
Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected
More informationGene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'
Supplementary Table 1: Real-time PCR primer sequences for ΔEGFR, wtegfr, IL-6, LIF and GAPDH. Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' wtegfr
More informationRat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More informationphab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation
phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:
More informationFlow Cytometry - The Essentials
Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.
More informationhfab Rhodamine Housekeeping Antibodies
hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationab GAPDH SimpleStep ELISA Kit
ab176642 GAPDH SimpleStep ELISA Kit Instructions for Use For the semi-quantitative measurement of GAPDH in Human and mouse cell lysates. This product is for research use only and is not intended for diagnostic
More information(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationFluo-8 Medium Removal Calcium Assay Kit
ab112128 Fluo-8 Medium Removal Calcium Assay Kit Instructions for Use For detecting calcium in cells by using our proprietary fluorescence probe This product is for research use only and is not intended
More informationChemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
More informationApplications involving the ViroCyt Virus Counter in the production of various recombinant proteins
Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins Chris Kemp Kempbio, Inc. Frederick, MD USA chris.kemp@kempbioinc.com Presentation Summary Kempbio, Inc.
More informationab Hypoxic Response Human Flow Cytometry Kit
ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting
More informationMonitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics
Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Proteomics and studying dynamic interactions AP-MS Proteomics
More information