Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
|
|
|
- Cameron Oliver
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp) (a), Gna13-deletion (~800bp) (b) and Cre (~650bp) (c). (d) Gα13 protein levels in WT and Gna13 f/f Cstk-Cre (f/f;ctsk-cre) bone marrow cells; D#, # days under the treatment of RANKL and M-CSF. (e,f) TRAP staining of femurs from two-month-old WT and Gna13 f/f Cstk-Cre female mice. (g) Quantification of osteoclast number in d. OcS/BS, osteoclast surface/bone surface. N.Oc/BS, osteoclast number/bone surface. Results were expressed as mean ± standard deviation (SD), N=6; **, p 0.01 (Student s T-test). scale bar in e, 200 m; scale bar in f, 20 m.
2 Supplementary Figure 2. Osteoclast number was increased in osteoclast-specific Gna13-deficient mice. (a) Trichrome staining of femurs from two-month-old female WT and Gna13 f/f Cstk-Cre (f/f;ctsk-cre) mice. (b) Histomorphometry quantification in a. ObS / BS, osteoblast surface / bone surface; N.Ob / BS, number of osteoblast / bone surface; Tb.N, trabecular bone number. (c) Quantification from -CT in Fig. 2i; N=4 Tb.Th, trabecular bone thickness; Tb.N, trabecular bone number; Tb.Sp, trabecular bone space; BV, bone volume; TV, tissue volume. (d) Calcein labeling in the 2-month-old female calvariae assessed using undecalcified frozen sections, and its quantification (MAR, mineral apposition rate); N=20. (g) Elisa to detect serum Alkaline Phosphatase (ALP) in 2-month old WT and Gna13 f/f Cstk-Cre female mice; N=4. Results were expressed as mean ± standard deviation (SD), N=3; *, p 0.05; **, p 0.01; ns, not significant (Student s T-test). scale bar in a, 200 m; scale bar in d, 20 m.
3 Supplementary Figure 3. Deletion of Gna13 expression promotes osteoclast formation, but not survival and acidification. (a) TRAP staining to detect osteoclast formation of WT and Gna13 f/f LysM-Cre (f/f;lysm-cre) bone marrow monocytes (BMMs) under the treatment of M-CSF and different doses of RANKL for 3 days (D3). (b) Quantification of TRAP+ MNC per well in a; N=4 (c) TUENL staining of D6 WT and Gna13 f/f LysM-Cre osteoclasts. (d) TUENL staining of D5 WT and Gna13 f/f LysM-Cre osteoclasts, serum and cytokine starved for 6, 12 and 24 hours (hr). (e,f) quantification of apoptosis rate in c (e) and d (f); N=4 (g) Acidification of osteoclasts by acridine orange staining. (h) TRAP staining of extensive cultured WT and Gna13 f/f LysM-Cre osteoclasts. (i) Quantification of survival rated in h; N=4. (j) qrt-pcr to detect gna13, RANK and c-fms expression in D1 WT and Gna13 f/f LysM-Cre pre-osteoclasts; N=4. (k) qrt-pcr to detect gna13, RANK and c-fms expression in D4 WT and Gna13 f/f Ctsk-Cre osteoclasts; N=4. Results were expressed as mean ± standard deviation (SD); *, p 0.05; **, p 0.01; ***, p 0.001; ****, p (Student s T-test). scale bar in a,g,h 200 m; scale bar in c,d, 100 m.
4 Supplementary Figure 4. Confocal microscopy of bone resorption pits resorbed by WT and Gna13 f/f LysM-Cre osteoclasts. scale bars: x, 0.13 m; y, 0.13 m; z, 0.45 m
5 Supplementary Figure 5. p38, JNK and Erk phosphorylation is similar in WT and mutant cells. (a) Western blot analysis to detect phosphorylation signaling induced by RANKL and M-CSF in WT and Gna13 f/f LysM-Cre (f/f;lysm-cre) BMMs. (b) Quantification of a by ImageJ. Results were expressed as mean ± standard deviation (SD), N 3.
6 Supplementary Figure 6. Analysis of the titer and expression of Gα13 overexpression lentivirus. (a) 293T was transfected with different volumes of Gα13 overexpressing lentivirus (containing 10% GFP expressing retrovirus), and GFP was observed 48 hours post-transfection. (b) Expression of Gα13 constitutive active form (Gα13CA) in 293T was confirmed by western blot. (c) Osteoclast precursors was transfected with GFP and Gα13CA overexpression lentivirus (the latter one contained 10% GFP expressing virus), and GFP was observed in mature cells. (d) WT and Gna13-deficient D1 pre-osteoclasts were transfected with GFP and Gα13CA overexpressing retrovirus and Gα13 expression was detected on Day 3 by western blot. (e) Quantification of d by ImageJ. Results were expressed as mean ± standard deviation (SD), N 3; **, p 0.01; ***, p (Student s T-test). Scale bar, 100 m
7 Supplementary Figure 7. Overexpression of Gα13CA does not affect p38 and Erk phosphorylation. (a) Western blot analysis to detect p38 and Erk phosphorylation induced by RANKL and M-CSF in WT and Gna13 f/f LysM-Cre (f/f;lysm-cre) osteoclasts (overexpressing GFP or Gα13CA). (b) Western blot analysis to detect RANKL induced p38 and Erk phosphorylation in RAW264.7 cells transfected with control retrovirus and retrovirus expressing Gα13CA. Quantification data were co-presented on the right panel. Results were expressed as mean ± standard deviation (SD), N 3; ns, not significant (two-way ANOVA analysis).
8 Supplementary Figure 8. Analysis of the effective infection of AAV in the knee joint. Upper panels, injection of PBS injection in knee Joint as control; Lower panels, injection of AAV-YFP in knee Joint, YFP expresses in the articular surface and Synovial cavity. Scale bar, 20 m
9 Supplementary Figure 9. Analysis of the effective infection of AAV in the 2-month female mouse calvarial bone in the ovariectomized (OVX) model. (a) Co-immunofluorescent staining using anti-yfp and anti-ctsk antibody using frozen sections of calvarial bones. (b) Co-immunofluorescent staining using anti-gα13 and anti-ctsk antibody of calvarial bones. Scale bars, 100 m.
10 Supplementary Figure 10. Uncropped images for western blots
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
Activating transcription factor 4 regulates osteoclast differentiation in mice
Research article Activating transcription factor 4 regulates osteoclast differentiation in mice Huiling Cao, 1,2 Shibing Yu, 1 Zhi Yao, 2 Deborah L. Galson, 1 Yu Jiang, 3 Xiaoyan Zhang, 1,4 Jie Fan, 5
Galea GL et al, J Biol Chem Supplementary Figure 1
Galea GL et al, J Biol Chem Supplementary Figure 1 Supplementary Figure 1: Characterisation of long bone osteoblastic cells derived from mouse long bone diaphyses. A) clbobs treated with or without differentiation
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
1,500 1,000. LPS + alum. * * Casp1 p10. Casp1 p45
a NLRP3 Non-stimulation R46 BAY SI TAT LPS R46 BAY SI TAT 1,5 1, c 15 1 5 5 Pro-IL-18 Pro-IL-1 LPS + alum d e f IL-1 p17 Pro-IL-1 1 75 5 5 Casp1 p1 NLRP3 LPS + alum Supplementary Figure 1 Inhiition of
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
Specificity of RGS10A as a key component in the RANKL signaling mechanism for osteoclast differentiation
3362 Research Article Specificity of RGS10A as a key component in the RANKL signaling mechanism for osteoclast differentiation Shuying Yang, Wei Chen, Philip Stashenko and Yi-Ping Li* Department of Cytokine
Human antigen R-regulated CCL20 contributes to osteolytic breast cancer bone metastasis
1 Human antigen R-regulated CCL20 contributes to osteolytic breast cancer bone metastasis Sun Kyoung Lee 1,2, Kwang-Kyun Park 1,2, Hyun-Jeong Kim 1, Junhee Park 3, Seung Hwa Son 4, Ki Rim Kim 5 & Won-Yoon
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating
Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
Supporting Information
Supporting Information Kawane et al. 10.1073/pnas.1010603107 SI Materials and Methods Mice. The DNase II / IFN-IR / and DNase II flox/ Mx1-Cre T mice were described previously (1). To delete the DNase
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2774 Figure S1 TRF2 dosage modulates the tumorigenicity of mouse and human tumor cells. (a) Left: immunoblotting with antibodies directed against the Myc tag of the transduced TRF2 forms
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation
Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
Supplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
pgbkt7 Anti- Myc AH109 strain (KDa) 50
pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture
CCL20/CCR6 Signaling Regulates Bone Mass Accrual in Mice
ORIGINAL ARTICLE JBMR CCL20/CCR6 Signaling Regulates Bone Mass Accrual in Mice Michele Doucet, Swaathi Jayaraman, Emily Swenson, Brittany Tusing, Kristy L Weber, and Scott L Kominsky Department of Orthopaedic
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into
PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
Supporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
JBC Papers in Press. Published on January 20, 2014 as Manuscript M
JBC Papers in Press. Published on January 20, 2014 as Manuscript M113.494542 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.m113.494542 Siglec-15 monoclonal antibodies as osteoclast inhibitors
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
THE RATES OF bone formation and resorption are tightly
0013-7227/04/$15.00/0 Endocrinology 145(1):426 436 Printed in U.S.A. Copyright 2004 by The Endocrine Society doi: 10.1210/en.2003-0319 Osteoprotegerin Expression and Secretion Are Regulated by Calcium
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means
Exam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
HCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
over time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
Supplementary Data, Romain et al., ATVB/2012/300516R2
Supplementary Data, Romain et al., ATV/212/3516R2 Methods online Mice All experiments were conducted on male mice between 8 and 12 weeks of age. Mice with genetic overexpression of SOCS3 or cell-specific
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
GUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGA GAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA
Precursor mmu-mir-8- GUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGA GAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA Precursor mmu-mir-8- GACCAGUUGCCGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAA
Title: Semen Astragali Complanati- and Rhizoma Cibotii-Enhanced Bone Formation in Osteoporosis Rats
Author's response to reviews Title: Semen Astragali Complanati- and Rhizoma Cibotii-Enhanced Bone Formation in Osteoporosis Rats Authors: Meijie Liu (liumeijie811@163.com) Gary G Xiao (gxiaous@yahoo.com)
TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES. Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec.
TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec. 15, 2013 Outline Overview of transfection TransfeX Primary/hTERT
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Inactivation of LKB1 in mutant mice. (a) Schematic illustration of the conditional LKB1 allele (grey squares depict exons, and black triangles loxp sequences), and the recombined
RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
Modulation of the anti-tumor immune response by complement. Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K.
Modulation of the anti-tumor immune response by complement Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K. Ricklin- Lichtsteiner, Anna Koutoulaki, Craig Gerard, George Coukos & John
A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells
Plant Cell, Tissue and Organ Culture (PCTOC) A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Anna Týcová a,b, Rajen J. J. Piernikarczyk c, Michael
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,
Yoshida et al. Extra-hepatic PDGFB, Delivered by Platelets, Promotes Activation of Hepatic Stellate Cells and Biliary Fibrosis in Mice
Yoshida et al. Extra-hepatic PDGFB, Delivered by Platelets, Promotes Activation of Hepatic Stellate Cells and Biliary Fibrosis in Mice SUPPLEMENTARY MATERIAL PDGF receptor β is upregulated across experimental
Issues in production of viral gene transfer vectors. Stefan Kochanek Department of Gene Therapy Ulm University
Issues in production of viral gene transfer vectors Stefan Kochanek Department of Gene Therapy Ulm University Only few positive results in gene therapy so far - many early phase, few late phase clinical
Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients
Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,
To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
Cytomics in Action: Cytokine Network Cytometry
Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University
SUPPLEMENTAL INFORMATION
UTX/KDM6A demethylase activity is required for satellite cell-mediated muscle regeneration Hervé Faralli 1,2, Chaochen Wang 3, Kiran Nakka 1,2, Soji Sebastian 1,, Aissa Benyoucef 1,2, Lenan Zhuang 3, Alphonse
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
Quantitative analysis of recombination in YFP and CFP gene of FRET biosensor induced by lentiviral or retroviral gene transfer.
Supplementary Information: Quantitative analysis of recombination in and gene of FRET biosensor induced by lentiviral or retroviral gene transfer. Akira T. Komatsubara, Michiyuki Matsuda,, and Kazuhiro
Bone undergoes continuous remodeling in the body
STEM CELLS AND DEVELOPMENT Volume 23, Number 19, 2014 Ó Mary Ann Liebert, Inc. DOI: 10.1089/scd.2014.0122 SHIP1 Regulates MSC Numbers and Their Osteolineage Commitment by Limiting Induction of the PI3K/Akt/b-Catenin/Id2
Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
Usp14 EPD0582_2_G09. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins
Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins Chris Kemp Kempbio, Inc. Frederick, MD USA chris.kemp@kempbioinc.com Presentation Summary Kempbio, Inc.
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
Wnt16 smact merge VK/AB
A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day
PTH Effects Bone Healing and Vasculogenesis in Calvaria Bone Allograft Model
PTH Effects Bone Healing and Vasculogenesis in Calvaria Bone Allograft Model Dmitriy Sheyn, PhD 1, Doron Cohn-Yakubovich, BSc 2, Ilan Kallai, MSc 2, Susan Su, MD 1, Xiaoyu Da, MSc 1, Gadi Pelled, DMD,
Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.
Supplementary information Supplementary figures Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Figure S2. Induction of Nur77 in
Supplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
Supplementary Figures Montero et al._supplementary Figure 1
Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres
Ludwika Kreja Æ Astrid Liedert Æ Carla Schmidt Æ Lutz Claes Æ Anita Ignatius. Erratum to: J Mol Hist DOI /s
J Mol Hist (2007) 38:507 512 DOI 10.1007/s10735-007-9133-2 ERRATUM Influence of receptor activator of nuclear factor (NF)-kB ligand (RANKL), macrophage-colony stimulating factor (M-CSF) and fetal calf
Supplementary Information
Supplementary Information Extended Loop Region of Hcp1 is Critical for the Assembly and Function of Type VI Secretion System in Burkholderia pseudomallei Yan Ting Lim, Chacko Jobichen, Jocelyn Wong, Direk
Murine TGFβ-antagonist (RAP-1332) Inhibits Fibrosis in a Murine Model of Myelofibrosis. Rajasekhar NVS Suragani, PhD
Murine TGFβ-antagonist (RAP-1332) Inhibits Fibrosis in a Murine Model of Myelofibrosis Rajasekhar NVS Suragani, PhD Polycythemia Vera (PV), Essential Thrombocythemia (ET) and Primary Myelofibrosis (PMF)
by Alexander Y. Rudensky (Sloan-Kettering Institute, New York). LSL-TβRI CA (TGFβR-
Materials and Methods Mice. Tgfbr2 fl/fl CD4-Cre (TGFβR-KO) mice were previously reported (3). Cre negative littermates were used as wild-type controls. DN-TGFβRII (TGFβR-DN) mice were provided by Ronald
Nanoparticle delivery of Cas9 ribonucleoprotein and donor DNA in vivo induces homology-directed DNA repair
SUPPLEMENTARY INFORMATION Articles DOI: 10.1038/s41551-017-0137-2 In the format provided by the authors and unedited. Nanoparticle delivery of Cas9 ribonucleoprotein and donor DNA in vivo induces homology-directed
Supplemental figure 1. Dys-regulated signal pathways in MSCs from TNF-Tg. mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics
Supplemental figure 1. Dys-regulated signal pathways in MSCs from TN-Tg mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics esources software. The top 53 and top 11 dys-regulated
Materials and Methods
Materials and Methods Construction of noxa / mice and genotyping The targeting vector (see Fig. S) was prepared from a C57BL/6 DNA λ phage library (Stratagene) by replacing a 2.7 kb region encompassing
Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.
1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
Supplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter