Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
|
|
|
- Clarissa Reynolds
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1), MDA-MB-231-D3H2LN (D3H2LN), BMD2a, and BMD2b cells were measured by NanoSight. Numbers shown on graphs are the average sizes of all EV types. (b) The conventional EV markers CD63 (500 ng/lane), CD9 (500 ng/lane), and Cytochrome C (3 µg/lane) were assessed by Western blot analysis. Lane 1: EVs from MDA-MB-231-D3H1; Lane 2: EVs from MDA-MB-231-D3H2LN; Lane 3: EVs from BMD2a; Lane 4: EVs from BMD2b. (c) Number of EV particles isolated from each cell line as measured by NanoSight. (d) The change in TEER after the addition of EVs. EVs from D3H1, D3H2LN, BMD2a, or BMD2b cells and negative control (N.C.) were added to the wells on day 4 after thawing of the in vitro BBB model. After 24 hrs, the TEER values were measured using an electrical resistance meter.
2 Supplementary Figure 2. Inhibition of EVs secretion decreased invasiveness of cancer cells through BBB. (a) Representative images of invading cells, including D3H1, D3H2LN, BMD2a, or BMD2b. Bar represents 100 µm. (b) The invasion rate of BMD2a cells treated with sirna against EV secretion-related proteins, such as nsmase2 and/or RAB27B and the transfection of control sirna (N.C.). Inhibiting the production of EVs minimally inhibited the invasiveness of these cell lines, as assessed by a Matrigel invasion assay. Error bars represent S.D., n = 3. (** P < 0.01) (c) Representative cellular morphologies of D3H1, D3H2LN, BMD2a, and BMD2b cells. Bar represents 100 µm. (d) The expression of RAB27B mrna in BMD2a cells after the transfection of control sirna (N.C.), RAB27B sirna, neutral sphingomyelinase 2 (nsmase2) sirna, or nsmase2 and RAB27B sirna (S+R). Error bars represent S.D., n = 3. (** P < 0.01) (e) The expression of nsmase2 mrna in BMD2a cells after the transfection of control sirna (N.C.), nsmase2 sirna, or nsmase2 sirna and RAB27B sirna (S+R). Error bars represent S.D., n = 3. (** P < 0.01) (f) The number of EVs from sirna-treated BMD2a cells. BMD2a cells were treated with sirna against EV secretion-related proteins, such as nsmase2 and/or RAB27B and the transfection of control sirna (N.C.). Error bars represent S.D., n = 3. (** P < 0.01) (g) In vitro BBB transmigration activity of the MD3H1, D3H2LN, BMD2a, and BMD2b cells. The number of transmigrated cells relative to the parental cell lines is plotted. Error bars represent S.D., n = 3. (* P < 0.05, ** P < 0.01) (h) Western blot analysis of nsmase2, and GAPDH. Proteins from BMD2a cells treated with N.C. sirna, nsmase2 sirna, and nsmase2 + Rab27b sirna.
3 Supplementary Figure 3. Schematic representation of the protocol for the in vivo brain metastasis experiment. PBS (negative control), D3H2LN, and BMD2a-derived EVs (5μg/mouse) were injected intravenously (i.v.) into C.B-17/Icr-scid/scid mice (Day 0). After 24 hrs, MDA-MB-231-D3H2LN breast cancer cell lines ( cells) were injected intracardially (i.c.) into C.B-17/Icr-scid/scid mice (Day 1). After 18 days, the brain metastasis of cancer cells was monitored by in vivo imaging system (IVIS). n = 9 mice per group.
4 Supplementary Figure 4. mirna array analysis of EVs (a) Heat map showing expression levels of the mirnas in EVs isolated from MDA-MB-231-D3H1 (D3H1), MDA-MB-231-D3H2LN (D3H2LN), BMD2a, or BMD2b cells. (b) The expression levels of mir-181c in D3H2LN, BMD2a, and BMD2b cells were measured by qrt-pcr. Error bars represent S.D., n = 3. (c) Expression level of mir-181c in total RNA from patients sera. 1: stage 1 (n = 10); 2: stage 2 (n = 22); 3: stage 3 (n = 9); 4: stage 4 (n = 6); 5: brain metastasis patients (n = 10). (* P < 0.05, ** P < 0.01) Associations between the mir-181c expression levels of serum from breast cancer patients were assessed by Mann-Whitney U test.
5 Supplementary Figure 5. mir-181c targeted PDPK1 (a) Heat map showing expression levels of the mrnas in brain blood vessel endothelial cells transfected N.C. mirna or mir-181c. (b) Heat map showing expression levels of the mrnas in brain blood vessel endothelial cells treated EVs from MDA-MB-231-D3H1 (D3H1), MDA-MB-231-D3H2LN (D3H2LN), BMD2a, or BMD2b cells. (c) Western blot analysis of PDPK1 and GAPDH. Proteins were from brain endothelial cells treated with PDPK1 sirna. (d) The expression levels of PDPK1 in brain endothelial cells after the transfection of PDPK1 sirna were measured by qrt-pcr. Error bars represent S.D., n = 3. (e) Schematics of the mir-181c binding site within the 3 UTR of the target mrna.
6 Supplementary Figure 6. Schematic model of BBB breakdown by EVs Schematic model shows that mir-181c regulates de-phosphorylation of cofilin through PDPK1 expression. PDPK1 was suppressed by extracellular vesicles carrying mir-181c that was incorporated into brain endothelial cells. Activated cofilin is increased because PDPK1 was suppressed. Actin filaments are disassembled with activated cofilin. Tight junction proteins and cadherin were delocalized because actin filaments were destroyed.
7 Supplementary Figure 7. Uncropped scans of blots shown in figure 4c. (a) ZO-1 (b) Occludin (c) Claudin-5 (d) N-cadherin (e) Actin (f) GAPDH
8 Supplementary Figure 8. Uncropped scans of blots shown in figure 5f. (a) ZO-1 (b) Occludin (c) Claudin-5 (d) N-cadherin (e) Actin (f) GAPDH
9 Supplementary Figure 9. Uncropped scans of blots shown in figure 6c and 6f. (a) Fig.6c, PDPK1 (b) Fig.6c, GAPDH (c) Fig.6f, PDPK1 (d) Fig.6f, GAPDH
10 Supplementary Figure 10. Uncropped scans of blots shown in figure 7b. (a) ZO-1 (b) Occludin (c) Claudin-5 (d) N-cadherin (e) Actin (f) GAPDH
11 Supplementary Figure 11. Uncropped scans of blots shown in figure 7e. (a) PDPK1 (b) Cofilin (c) P-Cofilin (d) GAPDH
12 Supplementary Figure 12. Uncropped scans of blots shown in figure 7f. (a) PDPK1 (b) Cofilin (c) P-Cofilin (d) GAPDH
13 Supplementary Figure 13. Uncropped scans of blots shown in supplementary figure 2h. (a) nsmase2 (b) GAPDH
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
mir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
SureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
APPLICATION NOTE Rev. 7/2017, v4.0 Fluorescent Nanodiamonds: Bio-applications. Physical and Fluorescence Properties
APPLICATION NOTE Rev. 7/2017, v4.0 Fluorescent Nanodiamonds: Bio-applications Fluorescent nanodiamonds (FNDs) offer a unique alternative to currently existing fluorescent biomarkers. With exceptional photo
Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
jetcrispr RNP transfection reagent PROTOCOL
jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been
Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis
Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined Hyperthermia for Enhanced Cancer Cell Apoptosis Birju P. Shah a, Nicholas Pasquale a, Gejing De b, Tao Tan b, Jianjie
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
HCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Label-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis
Introduction APPLICATION NOTE IncuCyte Live-Cell Analysis System Label-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis Susana L. Alcantara, Miniver Oliver, Kalpana Patel,
Contents. The Right Surface for Every Cell Extracellular Matrices and Biologically Coated Surfaces ECM Mimetic and Advanced Surfaces...
Contents The Right Surface for Every Cell... 1 Extracellular Matrices and Biologically Coated Surfaces... 2 Corning Matrigel Matrix... 2 Corning BioCoat Cultureware... 3 ECM Mimetic and Advanced Surfaces...
Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132
Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew
In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay. Josephine MY Ko and Maria Li Lung *
In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay Josephine MY Ko and Maria Li Lung * Clinical Oncology Department, The Univerisity of Hong Kong, Hong Kong, Hong Kong SAR *For
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
Endothelial Tube Formation Assay (In Vitro Angiogenesis)
Product Manual Endothelial Tube Formation Assay (In Vitro Angiogenesis) Catalog Number CBA-200 50 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Angiogenesis, or neovascularization,
64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
TransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
Galina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
Thermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol
Protocol Thermo Scientific Transfection Reagents sirna Transfection Protocol The following is a general protocol for use of Thermo Scientific transfection reagents to deliver sirna into cultured mammalian
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer
Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
Real-time PCR. TaqMan Protein Assays. Unlock the power of real-time PCR for protein analysis
Real-time PCR TaqMan Protein Assays Unlock the power of real-time PCR for protein analysis I can use my real-time PCR instrument to quantitate protein? Do protein levels correlate with related mrna levels
sirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
BIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS In Vivo RNA-LANCER II Manual Catalog #:3410-01 BIOO Scientific Corp. 2011 FOR REFERENCE PURPOSES. This manual is for Reference Purposes Only. DO NOT use this protocol to run
Product: Arrest-In TM Transfection Reagent for RNAi
Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and
A Genome wide RNAi Screen. in Human Cells. Eric E. Zhang,1,2,5 Andrew C. Liu,1,3,5 Tsuyoshi Hirota,1,2,5 Loren J. Miraglia,1 Genevieve Welch,1
A Genome wide RNAi Screen for Modifiers of the Circadian Clock in Human Cells Eric E. Zhang,1,2,5 Andrew C. Liu,1,3,5 Tsuyoshi Hirota,1,2,5 Loren J. Miraglia,1 Genevieve Welch,1 Pagkapol Y. Pongsawakul,2
Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
Cytomics in Action: Cytokine Network Cytometry
Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University
Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo
YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,
Investigation of Cell Migration using a High Density Cell Exclusion Assay and Automated Microplate Imager
A p p l i c a t i o n N o t e Investigation of Cell Migration using a High Density Cell Exclusion Assay and Automated Microplate Imager Peter J. Brescia and Peter Banks, Applications Department, BioTek
Tissue Collection: RNA Stabilization Solution Cat #7020 (100 ml), #7024 (250 ml), #7021 (500 ml), #7022 (50 x 1.5 ml), #7023 (20 x 5 ml)
RNAlater Tissue Collection: RNA Stabilization Solution Cat #7020 (100 ml), #7024 (250 ml), #7021 (500 ml), #7022 (50 x 1.5 ml), #7023 (20 x 5 ml) A. Product Description RNAlater is an aqueous, nontoxic,
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
Flow Cytometry - The Essentials
Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.
Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
Supporting Information
Supporting Information Horie et al. 10.1073/pnas.1008499107 SI Materials and Methods ell ulture and Reagents. THP-1 cells were obtained from the American Type ell ollection. THP-1 cells were transformed
MATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (minigel. Reagents Provided in Kit
Lot # XXXXX ITCH/AIP4 Ubiquitin Ligase Kit Cat. # K-270 MATERIAL DATA SHEET The mammalian Itchy homolog, or ITCH, (also known as Atrophin-1-interacting protein 4 or AIP4) is a HECT domain class ubiquitin
CellPlayer HUVEC NucLight Green
Essen BioScience Catalog Number: 456 Storage Liquid Nitrogen Note: Cells can be thawed and cultured immediately upon receipt or stored in liquid nitrogen for long-term storage. Storage at -8 C is not recommended.
Cultrex BME Cell Invasion Assay
Cultrex BME Cell Invasion Assay Catalog Number 3455-096-K 96-well assay for investigating chemotaxis, cell migration, and/or cell invasion for adhesive cell types. This package insert must be read in its
Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
Certified. TransIT Broad Spectrum Transfection Reagents. TransIT-X2. TransIT -LT1. TransIT TransIT -mrna
Broad Spectrum Reagents For more than two decades Mirus Bio has been dedicated to developing reagents that feature high efficiency, low toxicity transfections. The products included in this piece are our
BLOCK-iT Transfection Optimization Kit
BLOCK-iT Transfection Optimization Kit Catalog no. 13750-047 Version B 27 June 2007 25-0718 User Manual ii Table of Contents Table of Contents...iii Kit Contents and Storage... v Accessory Products...vi
; 2 To whom correspondence may be addressed. Tel.: ; Fax:
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 30, pp. 26616 26627, July 29, 2011 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Heparin Impairs Angiogenesis
LabBOOK VIROMER BLUE VIROMER GREEN. sirna /mirna transfection
LabBOOK VIROMER BLUE VIROMER GREEN sirna /mirna transfection Contact General information Bettina Weber (Biologist) +49 345 55 59 625 bettina.weber@lipocalyx.de Dr. Sandra Lagauzère (Biologist) +49 345
Stem Cell Services. Driving Innovation for Stem Cell Researchers
Driving Innovation for Stem Cell Researchers Stem Cell Services Partner with us and have access to the most advanced and comprehensive stem cell services available today. 675 W. Kendall St. Cambridge,
Regulation of cellular differentiation by tissue specific transcription factor
Regulation of cellular differentiation by tissue specific transcription factor T. Endoh, M. Mie, Y. Yanagida, M. Aizawa, E. Kobatake Department of Biological Information, Graduate School of Bioscience
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna
Catalog #: Various Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna General Product Details and User Information Refer to page
Mouse ICAM-1 / CD54 ELISA Pair Set
Mouse ICAM-1 / CD54 ELISA Pair Set Catalog Number : SEK50440 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General
INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL
INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna/mirna transfection reagent that ensures efficient gene silencing and reproducible transfection in
ExoGlow -NTA Fluorescent Labeling Kit
ExoGlow -NTA Fluorescent Labeling Kit Cat # EXONTA100A-1 User Manual Store kit at +4 0 C Version 1 5/16/2017 A limited-use label license covers this product. By use of this product, you accept the terms
THE DELIVERY EXPERTS. INTERFERin in vitro sirna transfection reagent PROTOCOL
THE DELIVERY EXPERTS INTERFERin in vitro sirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna transfection reagent that ensures efficient gene silencing and reproducible transfection
Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
TransIT -BrCa Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5500 INTRODUCTION TransIT -BrCa Transfection Reagent is specifically optimized to provide exceptional transfection efficiency
Application Information Bulletin: Set-Up of the CytoFLEX Set-Up of the CytoFLEX* for Extracellular Vesicle Measurement
Application Information Bulletin: Set-Up of the CytoFLEX Set-Up of the CytoFLEX* for Extracellular Vesicle Measurement Andreas Spittler, MD, Associate Professor for Pathophysiology, Medical University
DEPArray Technology. Sorting and Recovery of Rare Cells
DEPArray Technology Sorting and Recovery of Rare Cells Delivering pure, single, viable cells The DEPArray system from Silicon Biosystems is the only automated instrument that can identify, quantify, and
CellPlayer CytoLight Green (Lenti, CMV, no selection)
CellPlayer CytoLight Green (Lenti, CMV, no selection) Essen BioScience Catalog Number: 4513 Background Third generation lentiviral-based vectors are commonly used to transfer genetic information to cells
Products. Established in 2006 in the heart of. Angio Proteomie wishes to be your
2015 2016 Established in 2006 in the heart of Longwood Medical Center of Harvard Medical School (Boston, MA 02215, US), Angio Proteomie, has since being dedicated in offering TOP QUALITY Research Reagents
Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
Introduction. Figure 1. Oris Cell Migration Assay Principle
Optimizing Performance of the Membrane-free, Oris Cell Migration Assay for High Throughput Screening using the BioTek Synergy HT Multi-Mode Microplate Reader Keren I. Hulkower, Renee L. Herber, and Scott
ab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
Cell Migration, Chemotaxis and Invasion Assay Using Staining
Cell Migration, Chemotaxis and Invasion Assay Using Staining Protocol Hillary Sherman and Mark Rothenberg Corning Life Sciences 836 North St. Bldg. 300, Suite 3401 Tewksbury, MA 01876 Introduction Cell
GUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGA GAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA
Precursor mmu-mir-8- GUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGA GAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA Precursor mmu-mir-8- GACCAGUUGCCGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAA
Center Drive, University of Michigan Health System, Ann Arbor, MI
Leukotriene B 4 -induced reduction of SOCS1 is required for murine macrophage MyD88 expression and NFκB activation Carlos H. Serezani 1,3, Casey Lewis 1, Sonia Jancar 2 and Marc Peters-Golden 1,3 1 Division
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
Galea GL et al, J Biol Chem Supplementary Figure 1
Galea GL et al, J Biol Chem Supplementary Figure 1 Supplementary Figure 1: Characterisation of long bone osteoblastic cells derived from mouse long bone diaphyses. A) clbobs treated with or without differentiation
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
Catalog # Product Size PRIME-XV Hematopoietic Cell Basal XSFM 500 ml (liquid) Additional package sizes are available at request
PRIME-XV HEMATOPOIETIC CELL BASAL XSFM PRIME-XV Hematopoietic Cell Basal XSFM is an optimized xeno- and serum free media recommended for use in the expansion of human hematopoietic cells, including hematopoietic
TransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
CellPlayer NucLight Red (Lenti, EF-1 alpha, puro)
Essen BioScience Catalog Number: 4476 Background Third generation lentiviral-based vectors are commonly used to transfer genetic information to cells for gene therapy and/or research purposes. The Essen
Plant/Fungi Total RNA Purification Kit Product # 25800, 31350, 25850
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Plant/Fungi Total RNA Purification Kit Product # 25800, 31350,
Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications
PRODUCT FAMILY BULLETIN Tropix Chemiluminescent Kits and Reagents Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications Introduction to Chemiluminescence Chemiluminescence is the conversion
MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology
Technical note MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Abstract We introduce a new assay that enables
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3
Contents amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Background Information 4 Cell culture 4 Supporting Data 5-8 Equipment
Syringe Pumps. Please contact us for help in selecting the best pump for your application and a free quote.
Syringe Pumps Microfluidic Pumps! We are proud to offer select Harvard Apparatus syringe pumps for use with SynVivo biochips. These high quality pumps have been extensively tested and offer a feature rich
Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications
Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and
Fibronectin is a prototypic extracellular matrix (ECM) protein
A fibronectin fragment inhibits tumor growth, angiogenesis, and metastasis Ming Yi and Erkki Ruoslahti* Cancer Research Center, The Burnham Institute, 10901 North Torrey Pines Road, La Jolla, CA 92037;
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
in vivo-jetpei DNA & sirna delivery reagent
in vivo-jetpei DNA & sirna Delivery Protocol Company Information... 2 Product Information... 3 In vivo Delivery Protocol... 5 1. Reagents required... 5 2. Recommended amount of nucleic acid and injection