NIAID and Global Health Research Resources for Tuberculosis
|
|
- Griselda Chapman
- 5 years ago
- Views:
Transcription
1 NIAID and Global Health Research Resources for Tuberculosis Maria Y. Giovanni, Ph.D. Director, Office of Genomics and Advanced Technologies National Institute of Allergy & Infectious Diseases NIH/DHHS 2013
2 Slide Source: A. S. Fauci
3 Slide Source: A. S. Fauci
4 NIAID/DMID Genomics Program Sequencing Functional Genomics Proteomics Structural Genomics Systems Biology Genomic Sequencing Centers Functional Genomic Research Centers Clinical Proteomics Centers Structural Genomics Centers Systems Biology Centers Bioinformatics Resource Centers Bioinformatics Genomic Research Resources Genomic/Omics Data Sets, Databases, Bioinformatics Tools, Biomarkers, 3D Structures, Protein Clones, Predictive Models To address key questions in microbiology and infectious disease
5 NIAID Genomic Sequencing Centers for Infectious Diseases Sample Processing Method Develop High Throughput Sequencing Pipelines Metagenomics Transcriptomics Bioinformatics Tools Data Analysis Pipelines Genomics Bioinformatics Training
6 Chad Nussbaum Broad Institute
7
8
9 Knowledge from Data Challenge Rapidly expanding volume, complexity, and range of data Genome and Annotation RNA Sequencing Protein Expression Structure Isolates Subcellular Location Phenotype Exploit data to understand, prevent, diagnosis and treat infectious diseases
10
11 Building Bioinformatics Capacity for Infectious Diseases Community Provide integrated bioinformatics resources in support of basic and applied infectious diseases research. Data management, data sets, computational analysis tools, workspaces, web interfaces, and training
12 Collaborative Partnerships - Building resources with and for the community USG Agencies (USDA) B/M Gates Wellcome Trust NCBI TBDB ImmPort/IEDB Other Public Databases NIAID Research Programs Genome Seq Systems Biology Scientific community Data Users Data Producers
13 PATRIC Website (patricbrc.org) Bacterial Data Workflow Examples Personal Workspace Analysis Tools TB Site for TB data & Tools
14 Dynamic filtering by metadata values Metadata for Isolates
15 Protein Family Sorter Comparative Pathway Tool Disease View Genome Browser
16 NIAID Systems Approach to TB Combines genomic technology with computational methods to establish: Metabolic Network Model Regulatory Network Model
17 TB Regulatory Network Balázsi et al. (2008)
18 TB Regulatory Network 44 TB Transcription Factors 2008: 381 interactions 2012: 6429 interactions Transcription Factor Gene Sigma Factor ChIP Binding
19 NIAID Structural Genomics Centers for Infectious Diseases Goal: Provides the scientific community with 3D protein structures of targeted pathogenic proteins Features: Two Centers awarded in 2007: Northwestern University and Seattle Biomedical Research Institute Actively solicit requests for structure determination from the scientific community Protein targets are chosen by the Centers or proposed by external researchers Determine structures with important biological roles or those that show potential for vaccine or therapeutic development 1109 Structures deposited in the Protein Data Bank since 2007
20 Mycobacterium strains Strain Total Targets Total Structures M. abscessus M. avium M. bovis 29 0 M. leprae M. marinum M. paratuberculosis M. smegmatis M. thermoresistibile M. tuberculosis M. Ulcerans Total
21 Resources for Researchers Product Development Pathway Basic Research Hypothesis Development and Testing Discovery Preclinical Development IDE- and IND-Enabling Activities Research Tools and Biological Materials Clinical Evaluation Trials Diagnostics Vaccines Therapeutics Research Tools and Technologies In vitro & in vivo testing & screening Therapeutic Development Services Biological Lead identification research & resources optimization (organisms and reagents) Chemistry & manufacturing, formulation, Clinical incl. GMP trials Biopharmaceutical development, incl. Basic and omics research resources Support GMP for clinical Nonclinical development, planning, & evaluation Vaccine Development Bioinformatics Services programs Preclinical and clinical services Testing & manufacturing, incl. GMP Biocontainment facilities Nonclinical & product development, planning & evaluation Regulatory activities & documentation Funding opportunities Research tools and biological materials to facilitate product development
22 Examples of Resources/Services Delivered Organisms Reagents e.g., proteins, antibodies, irradiated cells Assays e.g.,anthrax toxin neutralization assay Animal models e.g., plague antibiotic & vaccine models In vitro and in vivo screening for antimicrobial activity e.g., licensed H1N1 treatment Candidate therapeutics e.g., optimization, synthesis, formulation, medicinal chemistry, product development plans; cgmp manufacture
23 NIAID Diagnostic Program Emerging Technologies Early Stage Development Later Stage Development Sample Processing Targets Platform Dev Clinical Validation Assay Dev Integration Platform
24 Changing Landscape in Diagnostics High throughput next generation Sequencing Technologies AFB (acid fast bacilli) smear 454 GS FLX Illumina HiSeq 2000
25 Sample-to-Answer Multiplex Diagnostic Platforms
26 NanoString ncounter System Pejman Naraghi-Arani, LNLL Deb Hung, Broad Institute
27 Cepheid Gene Xpert System Sample in, answer out system Capable of detecting pathogen nucleic acid from a swab and in sputum, blood, urine samples David Alland, UMDNJ
NIAID Resources to Facilitate Medical Countermeasure Development
NIAID Resources to Facilitate Medical Countermeasure Development Paula Bryant, Ph.D. Senior Scientific Officer Concept Acceleration Program Biodefense, Research Resources, and Translational Research (OBRRTR)
More informationMicrobial Metabolism Systems Microbiology
1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological
More informationResources for the Microbiology and Infectious Diseases Research Community
Resources for the Microbiology and Infectious Diseases Research Community Martin John Rogers, PhD Program Officer, Parasitology and International Programs Division of Microbiology and Infectious Diseases
More informationPROVIDING ADAPTED TECHNOLOGICAL INNOVATION SOLUTIONS
PROGRAM MICROBIOTA OPPORTUNITIES PROVIDING ADAPTED TECHNOLOGICAL INNOVATION SOLUTIONS TO FULLY EXPLORE MICROBIOTA OPPORTUNITIES BIOASTER programs undertake your most challenging projects through: specialised
More informationCapabilities & Services
Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro
More informationAntibody Discovery at Evotec
Antibody Discovery at Evotec - Overview - Evotec Antibodies Adding value to our partners research Innovative and flexible solutions from target ID to pre-clinical candidate The people A wide therapeutic
More informationAIT - Austrian Institute of Technology
BIOMARKER DISCOVERY, BIOINFORMATICS, AND BIOSENSOR DEVELOPMENT Technology Experience AIT Austrian Institute of Technology Low-Emission Transport AIT - Austrian Institute of Technology Energy Health & Bioresources
More informationMICROBIOTA: FROM MICROBIOME TO FUNCTIONS. Atelier «Outils et modèles d étude du microbiote Intestinal» LYONBIOPÔLE/CENS 17 Novembere 2014
MICROBIOTA: FROM MICROBIOME TO FUNCTIONS Atelier «Outils et modèles d étude du microbiote Intestinal» LYONBIOPÔLE/CENS 17 Novembere 2014 Artem Khlebnikov Microbiota The new frontier of biomedicine 2000,
More informationCourse Agenda. Day One
Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an
More information+ + + MALARIA HIV/AIDS TUBERCULOSIS LEISHMANIASIS CHAGAS DISEASE DENGUE EBOLA ZIKA
At the Center for Infectious Disease Research, we use systems biology approaches and cutting-edge technologies to accelerate the development of life-saving drugs, diagnostics and treatments for the world
More informationHow Targets Are Chosen. Chris Wayman 12 th April 2012
How Targets Are Chosen Chris Wayman 12 th April 2012 A few questions How many ideas does it take to make a medicine? 10 20 20-50 50-100 A few questions How long does it take to bring a product from bench
More informationUniversity of Athens - Medical School. pmedgr. The Greek Research Infrastructure for Personalized Medicine
University of Athens - Medical School pmedgr The Greek Research Infrastructure for Personalized Medicine - George Kollias - Professor of Experimental Physiology, Medical School, University of Athens President
More informationGovernment Bioscience Grant (GBG) Report October 2016 BROAD AGENCY ANNOUNCEMENTS CANCER
www.g2gconsulting.com Government Bioscience Grant (GBG) Report October 2016 Title (Agency) Opp. Number Description Deadline Funding Level Eligibility Link BROAD AGENCY ANNOUNCEMENTS 1. Advanced Research
More informationMaria Y. Giovanni, Ph.D
Maria Y. Giovanni, Ph.D NIAID Associate Director for Genomics and Bioinformatics Director, Office of Genomics and Advanced Technologies July 7-8, 2014 Slide Source: A. S. Fauci Slide Source: A. S. Fauci
More informationNIAID Strategic Plan for Biodefense Research February 2002
NIAID Strategic Plan for Biodefense Research February 2002 U. S. DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases NIAID Strategic
More informationSynthetic Biology: Complexity and Challenges
Synthetic Biology: Complexity and Challenges James Johnson Manager, GeneMill Facility University of Liverpool DNA SEQUENCING TRANSCRIPTOME PROFILING AND GENE REGULATION SEQUENCE CAPTURE MICROARRAYS DESIGN
More informationApplications of Next Generation Sequencing in Metagenomics Studies
Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno
More informationBayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms
Bayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms Genomics Bioinformatics HTS Combinatorial chemistry Protein drugs
More informationCIBIR: Center for Biomedical Research of La Rioja Eduardo Mirpuri, PhD. Biomedical Research Coordinator
FP7 Health Partnering event 10 June 2011, Brussels International session CIBIR: Center for Biomedical Research of La Rioja Eduardo Mirpuri, PhD. Biomedical Research Coordinator Translational Research CIBIR:
More informationSynthetic vaccine research and development. Comprehensive and innovative synthetic biology solutions and technologies
Synthetic vaccine research and development Comprehensive and innovative synthetic biology solutions and technologies From plan to product, Thermo Fisher Scientific supports your synthetic vaccine goals
More informationNIAID-funded Bacterial Bioinformatics Resource Center (BRC) designed to support infectious disease research
July 2018 } } NIAID-funded Bacterial Bioinformatics Resource Center (BRC) designed to support infectious disease research Special emphasis on 22 pathogenic genera Bacillus, Bartonella, Borrelia, Brucella,
More informationTBResist: A Global Consortium for Whole Genome Sequencing of Drug Resistant TB. IOM/IMCAS Meeting Beijing January 16-18, 2013
TBResist: A Global Consortium for Whole Genome Sequencing of Drug Resistant TB IOM/IMCAS Meeting Beijing January 16-18, 2013 Past and Future of TB Research I. Comas and S. Gagneux PLoS Pathog. 2009 October:
More informationIntroducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight
Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationAdvances in Biomedical Research at Comenius University Bratislava
Advances in Biomedical Research at Comenius University Bratislava Bratislava, Slovakia What is biomedicine? Biomedicine is a branch of medical science that applies biological and other natural-science
More informationPioneering Clinical Omics
Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationResearch Powered by Agilent s GeneSpring
Research Powered by Agilent s GeneSpring Agilent Technologies, Inc. Carolina Livi, Bioinformatics Segment Manager Research Powered by GeneSpring Topics GeneSpring (GS) platform New features in GS 13 What
More informationNext Generation Sequencing (NGS) Market Size, Growth and Trends ( )
Next Generation Sequencing (NGS) Market Size, Growth and Trends (2014-2020) July, 2017 4 th edition Information contained in this market report is believed to be reliable at the time of publication. DeciBio
More informationIntroduction of Development Center for Biotechnology TAIWAN
Introduction of Development Center for Biotechnology TAIWAN DCB Nonprofit Organization Founded in 1984 Funded Mainly by Ministry of Economic Affairs (MOEA), National Science Council and the Industry 394
More informationDNA. Clinical Trials. Research RNA. Custom. Reports CLIA CAP GCP. Tumor Genomic Profiling Services for Clinical Trials
Tumor Genomic Profiling Services for Clinical Trials Custom Reports DNA RNA Focused Gene Sets Clinical Trials Accuracy and Content Enhanced NGS Sequencing Extended Panel, Exomes, Transcriptomes Research
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationAssessing quality-assured diagnoses made by TB laboratories
Assessing quality-assured diagnoses made by TB laboratories Quality-assured TB laboratory Objectives: at the end of the assessment reviewers should comment on the laboratory network and its structure;
More informationOur website:
Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate
More informationDISCOVERY AND VALIDATION OF TARGETS AND BIOMARKERS BY MASS SPECTROMETRY-BASED PROTEOMICS. September, 2011
DISCOVERY AND VALIDATION OF TARGETS AND BIOMARKERS BY MASS SPECTROMETRY-BASED PROTEOMICS September, 2011 1 CAPRION PROTEOMICS Leading proteomics-based service provider - Biomarker and target discovery
More informationFRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING. From wet lab to dry lab complete sample analysis
FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING From wet lab to dry lab complete sample analysis »Progress in science depends on new techniques, new discoveries
More informationGENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists
More informationWhat is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
More informationVision, aims and strategies. Department of Immunology, Genetics and Pathology Uppsala University
Vision, aims and strategies Department of Immunology, Genetics and Pathology Uppsala University April19,2011 SCOPEOFACTIVITIESATIGP Research at the Department focuses on translational medicine through
More informationElena BM Breidenstein, PhD 21 April 2018
Discovery of a Novel Oral Antibiotic, DDS-01 (SMT-571), to Treat Multi-Drug Resistant Neisseria gonorrhoeae Enabled by a Proprietary Transposon Technology Elena BM Breidenstein, PhD 21 April 2018 Forward-Looking
More informationProgress and Future Directions in Integrated Systems Toxicology. Mary McBride Agilent Technologies
Progress and Future Directions in Integrated Systems Toxicology Mary McBride Agilent Technologies 1 Toxicity testing tools of the late 20 th century Patchwork approach to testing dates back to the 1930
More informationFrom Bench to Bedside: Role of Informatics. Nagasuma Chandra Indian Institute of Science Bangalore
From Bench to Bedside: Role of Informatics Nagasuma Chandra Indian Institute of Science Bangalore Electrocardiogram Apparent disconnect among DATA pieces STUDYING THE SAME SYSTEM Echocardiogram Chest sounds
More informationThe Integrated Biomedical Sciences Graduate Program
The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to
More informationThe Institute of Microbiology of the Czech Academy of Sciences is looking for. four POSTDOCTORAL FELLOW positions in the fields of:
4 Postdoctoral Fellow positions in microbiology, molecular biology and ecology The Institute of Microbiology of the Czech Academy of Sciences, Prague, Czech Republic The Institute of Microbiology of the
More informationAdvancing Life Sciences
Advancing Life Sciences Sweden s largest center for life sciences A national resource SciLifeLab, Science for Life Laboratory, is a Swedish national center for molecular biosciences, with the mission to
More informationGrowing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend
Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend Dr. dr. Francisca Srioetami Tanoerahardjo, SpPK., MSi Essential Practical Molecular Diagnostics Seminar Hotel
More informationCareer Growth Areas in Physiology / Pharmacology
Career Growth Areas in Physiology / Pharmacology Magdalena Alonso-Galicia, PhD Pharmacology Department Forest Research Institute, Inc. Jersey City, NJ 1 Career Growth Areas in BioPharma n Pharmaceutical
More informationGENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists
More informationNGS Approaches to Epigenomics
I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic
More information36 th Annual JP Morgan Healthcare Conference. January 11 th, 2018
36 th Annual JP Morgan Healthcare Conference January 11 th, 2018 1 Forward-looking Statements This presentation and the accompanying oral commentary contain forward -looking statements that involve risks,
More informationChemoinformatic Tools for the Hit Discovery Process
Chemoinformatic Tools for the Hit Discovery Process GmbH Björn Windshügel May 29 2013 ESP in a Nutshell Established in 2007 Service provider for academics High-throughput screening High-content screening
More informationTrend in diagnostic biochip. Eiichiro Ichiishi, M.D., Ph.D. Department of Internal Medicine International University of Health and Welfare Hospital
Trend in diagnostic biochip development Eiichiro Ichiishi, M.D., Ph.D. Department of Internal Medicine International University of Health and Welfare Hospital Handling of the early stage is important for
More informationE2ES to Accelerate Next-Generation Genome Analysis in Clinical Research
www.hcltech.com E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research whitepaper April 2015 TABLE OF CONTENTS Introduction 3 Challenges associated with NGS data analysis 3 HCL s NGS Solution
More informationBasic Information. I.1 If your company performs biotechnology research and development, uses a. The Categories of Biotechnology Applications.
APPENDIX 2 SURVEY QUESTIONNAIRE Part I. Basic Information I.1 If your company performs biotechnology research and development, uses a biotechnology process in manufacturing, or produces research tools,
More informationNeue Technologien für die patientennahe personalisierte Diagnostik
Neue Technologien für die patientennahe personalisierte Diagnostik 2014 Dr. Soeren Schumacher, M.B.A. 27th of June 2014 1 A heterogeneous pool 27th of June 2014 2 A heterogeneous pool Personalized Medicine
More informationTransforming biological data into clinical benefits
Transforming biological data into clinical benefits Through: Development of new diagnostics Precession Medicine Pathway Analysis for better drug design Unique Bio Marker Discovery Tool (ANNs) granted US
More informationREIMAGINING DRUG DEVELOPMENT:
Biology Reconstructed REIMAGINING DRUG DEVELOPMENT: Accurate Disease Modeling To Drive Successful Therapies Julia Kirshner, CEO julia@zpredicta.com 1 SUCCESS RATES OF DRUG DEVELOPMENT ARE LOW, " PARTICULARLY
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationWeek 1: Discovery Biology Basic knowledge and tools used in Research and Development
Downing - Keio Summer School 2018 Healthcare and Biotechnology Course Outline page 1 Strand A: Healthcare and Biotechnology Course Outline This course aims to provide an overview of the current challenges
More informationCory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D.
Cory Brouwer, Ph.D. Dr. Cory R. Brouwer is Director of the Bioinformatics Services Division and Associate Professor of Bioinformatics and Genomics at UNC Charlotte. He and his team provide a wide range
More informationIncorporating New TB Diagnostics into RePORT
Incorporating New TB Diagnostics into RePORT Susan Dorman Johns Hopkins University School of Medicine REPORT MEETING, DURBAN, JULY 2016 MACS designed to: 1. Elucidate the natural history of the infection
More informationMedicinal Chemistry of Modern Antibiotics
Chemistry 259 Medicinal Chemistry of Modern Antibiotics Spring 2012 Lecture 5: Modern Target Discovery & MOA Thomas Hermann Department of Chemistry & Biochemistry University of California, San Diego Drug
More informationMedicinal Chemistry of Modern Antibiotics
Chemistry 259 Medicinal Chemistry of Modern Antibiotics Spring 2008 Lecture 5: Modern Target Discovery & MOA Thomas Hermann Department of Chemistry & Biochemistry University of California, San Diego Drug
More informationThe Power to Cure: Therapeutic Innovation in Academia
The Power to Cure: Therapeutic Innovation in Academia Leslie Molony, Ph.D. November 7, 2011 Sanford-Burnham Medical Research Institute: a Non Profit Basic Research Institute Santa Barbara Est. 2006 La
More informationMaximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y. Report Price Publication date
F o r a c l e a r e r m a r k e t p e r s p e c t i v e Early Stage Drug Safety Strategies & Risk Management Maximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y Report
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationBiodefense and Infectious Diseases Funding Opportunities
FreeMindGroup FreeMind Group @FreeMindGrp Biodefense and Infectious Diseases Funding Opportunities Jonathan Adalist Senior Director, Business Development FreeMind Group FreeMind Group, LLC FreeMind Group
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationwww.illumina.com/hiseq www.illumina.com FOR RESEARCH USE ONLY 2012 2014 Illumina, Inc. All rights reserved. Illumina, BaseSpace, cbot, CSPro, Genetic Energy, HiSeq, Nextera, TruSeq, the pumpkin orange
More informationNIH-RAID: A ROADMAP Program
NIH-RAID: A ROADMAP Program (Rapid Access to Interventional Development} A Program designed to facilitate the development of new therapeutics The NIH-RAID Pilot Program is intended to reduce some of the
More informationDeveloping an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through
More informationDiagnostics and Detection (CBA)
Diagnostics and Detection (CBA) Dr. Richard Schoske What We Do Vision Comprehensive integrated early warning to reduce the effects of biological and chemical threats. Mission Finding and fostering science
More informationThank you and good morning.
Thank you and good morning. 1 I have no conflicts of interest to disclose. 2 I m going to speak today about basic science research into group B strep virulence. GBS remains an important cause of neonatal
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationWELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)
WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow
More informationILLUMINA SEQUENCING SYSTEMS
ILLUMINA SEQUENCING SYSTEMS PROVEN QUALITY. TRUSTED SOLUTIONS. Every day, researchers are using Illumina next-generation sequencing (NGS) systems to better understand human health and disease, as well
More informationCodeLink Human Whole Genome Bioarray
CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it
More informationIntroduction to NGS. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Introduction to NGS Josef K Vogt Slides by: Simon Rasmussen 2017 Life science data deluge Massive unstructured data from several areas DNA, patient journals, proteomics, imaging,... Impacts Industry, Environment,
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
More informationJohne s Disease Beef Cattle Update. Kathy Simmons, DVM Chief Veterinarian National Cattlemen s Beef Association
Johne s Beef Cattle Update Kathy Simmons, DVM Chief Veterinarian National Cattlemen s Beef Association NCBA s Johne s Policies CH 5.1 (2013) Johne s Support after Termination of USDA-APHIS Johne s Program
More informationQuestionnaire on the use of High Throughput Sequencing, Bioinformatics and Computational Genomics (HTS-BCG) in the OIE Reference Centre network
Questionnaire on the use of High Throughput Sequencing, Bioinformatics and Computational Genomics (HTS-BCG) in the OIE Reference Centre network Massimo Palmarini MRC-University of Glasgow Centre for Virus
More information2014 APHL Next Generation Sequencing (NGS) Survey
APHL would like you to complete the Next Generation Sequencing (NGS) in Public Health Laboratories Survey. The purpose of this survey is to collect information on current capacities for NGS testing and
More informationComputational Challenges of Medical Genomics
Talk at the VSC User Workshop Neusiedl am See, 27 February 2012 [cbock@cemm.oeaw.ac.at] http://medical-epigenomics.org (lab) http://www.cemm.oeaw.ac.at (institute) Introducing myself to Vienna s scientific
More informationConference Calendar. healthtech.com. January High-Content Analysis January 8-11 San Francisco, CA
High-Content Analysis January 8-11 San Francisco, CA www.highcontentanalysis.com January 2013 PepTalk January 21-25 Palm Springs, CA www.chi-peptalk.com January 24-25 Pipeline 1: Formulation: Optimizing
More informationUK AMR Diagnostics Collaborative:
UK AMR Diagnostics Collaborative: Maximising the use of diagnostic technology to tackle AMR Fiona Carragher FRCPath @DepCSOFiona Deputy Chief Scientific Officer for England england.amrdiagnostics@nhs.net
More informationIBBL: Introduction to Biobanks and their services
IBBL: Introduction to Biobanks and their services HighTech meets Health, Oss (NL), 15 th June 2017 Monica Marchese, PhD Biomarker Validation Scientist AN ACCREDITED & CERTIFIED BIOBANK INFRASTRUCTURE FOR
More informationA new Model of Vaccine R&D Global Health Public Private Partnership : The Global Health Vaccine Center of Innovation (GHVCI)
A new Model of Vaccine R&D Global Health Public Private Partnership : The Global Health Vaccine Center of Innovation (GHVCI) Jean Lang avp R&D sanofi pasteur 9eme Rencontre Nationale des Directeurs de
More informationEvolution of Next Generation Sequencing Technology: Ready for Patient Management?
Evolution of Next Generation Sequencing Technology: Ready for Patient Management? Timothy Rodwell MD, PhD, MPH Senior Scientific Officer at FIND 3 rd December 2015, Union Meeting Cape Town Clinical Utility
More informationAntimicrobial Resistance Prediction Using Deep Convolutional Neural Networks on Whole Genome Sequencing Data
Antimicrobial Resistance Prediction Using Deep Convolutional Neural Networks on Whole Genome Sequencing Data PRIMES Research Report by: Andrew Zhang Mentor: Dr. Gil Alterovitz PRIMES Conference October
More informationProgrammatic Implementation of NGS for TB & Future Plans for the ReSeqTB Knowledgebase
Programmatic Implementation of NGS for TB & Future Plans for the ReSeqTB Knowledgebase Tim Rodwell, Rebecca Colman, Anita Suresh & Claudia Denkinger IUTLD, Guadalajara, Mexico, 11 th October 2017 A TB
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationShort Course Instructors
Short Course Instructors Andrew Allen, Ph.D., Professor of Biostatistics and Bioinformatics and Director of the new Duke Center of Statistical Genetics and Genomics, Duke University, has expertise in statistical
More informationDemocratizing Molecular Diagnostics: The GeneXpert MTB r test
Democratizing Molecular Diagnostics: The GeneXpert MTB r test David H. Persing, MD, PhD Executive Vice President Chief Medical and Technology Officer Cepheid Sunnyvale, CA Some Characteristics of an Ideal
More information