Impacts / Baseline data Project title: A dual recombinant vaccine for brucellosis and immunocontraception in feral swine

Size: px
Start display at page:

Download "Impacts / Baseline data Project title: A dual recombinant vaccine for brucellosis and immunocontraception in feral swine"

Transcription

1 Impacts / data Project title: A dual recombinant vaccine for brucellosis and immunocontraception in feral swine Please use the table below to guide you on reporting your impacts or baseline data from your 2012/2013 SIPMC funded project. Append a brief narrative to explain any details needed to help us report these outcomes. Plan 1) What is the overall for your Overall Objective: To develop and perform preliminary testing of the dual recombinant immunocontraceptive vaccine VTRS2-mGnRHb in the mouse model. VTRS2-mGnRHb is intended to control both the disease brucellosis and population growth in feral swine. Objectives for this project include: In vitro characterization of the VTRS2-mGnRH Assessment of clearance characteristics of VTRS2-mGnRHb in the mouse model and protection against virulent Brucella suis challenge. These assessments were performed using funds from a cooperative research agreement with USDA- APHIS separate from the SRIPM enhancement funds however they are crucial to preliminary characterization of the candidate vaccine and therefore results of that effort are included herein. Assessment of the contraceptive effect of the immunogenic gonadotropin releasing hormone multimer mgnrh expressed by VTRS2-mGnRHb in the mouse model (NOTE: experiment is ongoing, start was delayed due to in vitro and in silico analysis results leading to changes in the molecular structure of the mgnrh construct, the additional required genetic engineering steps delayed the beginning of animal trials) 2) What are the measurement indicators to help you achieve your? In vitro and in silico analysis of strain VTRS2-mGnRH was performed. Measurements included analysis of growth-characteristics in culture, assessment of antibiotic susceptibility, and assessment of mgnrh expression by Western blotting. Initial testing of a live vaccine in vivo involves assessment of the clearance characteristics of the and the ability of the vaccine to protect against virulent B. suis challenge. To assess clearance, 10 female BALB/c mice were inoculated with approximately 5 x 10 5 CFU intraperitoneally (IP) of the candidate immunocontraceptive vaccine VTRS2-mGnRHb. An additional 20 mice received a virulent dose of wild-type B. suis 1330 as an infection control. At weeks 4 and 6 post-inoculation, 5 mice per group were assessed for clearance of bacteria from their spleens. To assess protection against virulent Brucella challenge by the vaccine, 20 mice were given either VTRS2-mGnRHb (~5 x 10 5 CFU) (n=10) or sterile saline IP. 8 weeks post-inoculation mice, were either boosted with ~5 x 10 4 CFU VTRS2-

2 mgnrhb (n=5) or sterile saline or challenged with ~5 x 10 4 CFU of virulent B. suis The boosted mice were challenged 2 weeks post-booster. All mice were euthanatized 2 weeks post-challenge and clearance of bacteria from spleens assessed. To assess the contraceptive effect of VTRS2-mGnRHb in the mouse model a 2x2 experiment is in process to assess litter size and mating behavior in and un male and female BALB/c mice. Male mice were IP with ~5 x 10 5 CFU VTRS2mGnRHb (n=3) or received sterile phosphate-buffered saline at 6 weeks of age. Likewise, 18 female mice received vaccine and 18 received saline. At 6-weeks postvaccination, all mice will receive a booster (5x10 4 CFU). 2 weeks post-booster 3 un females will be housed with each male ( and un) and checked daily for the presence of a sperm plug as evidence of mating. Females will be individually housed 2 days prior to expected date of parturition (19-21d post-mating) and pups counted. A second round of mating will measure the effect of vaccination on the female mice. 3 females will be placed with each male ( and un) and mating and counting of pups will be performed as above (see table for summary of breeding evaluations). By using two rounds of breeding in addition to the effect on males and females individually, the effect of using both males and females can be measured without requiring additional negative control animals. This is a variation from the original experimental design. Expected date of completion: In addition to counting pups, at the end of the experiment all animals will be euthanized, gonads and secondary sex organs will be submitted to the USDA-APHIS National Wildlife Disease Center, Fort Collins, CO, for histopathological analysis. 2x2 Breedings Vaccinated Males (Group N, n=3) Un Males (Group M, n=3) Un Females (n= 9+9) Group G 1-3 n=3 (3 females/male) Group E 1-3 n=3 (3 females/male) Vaccinated Females (n= 9+9) Group H 1-3 n= 3 (3 females/male) Group F 1-3 n=3 (3 females/male)

3 Methodology and Results: (measured indicators vs goals for each ) Objective: In vitro and in silico assessment of VTRS2-mGnRH No enhanced growth characteristics of strain VTRS2-mGnRHb in culture vs the wild-type Colony forming units (CFU) and Klett Units (light transmission) over time in TSA broth cultures No increased growth in the (no specific value) CFU and Klett Units between and wild-type 0, 8, 24, 48, 72, and 120 hours post-inoculation of culture No statistically significant difference observed between wild-type and in culture GS Outputs Increased growth in culture would suggest increased vigor and possible virulence of the candidate vaccine strain, decreased growth could suggest attenuation which is desirable Demonstrate likelihood of expression of the immunogenic mgnrh multimer in Brucella by in silico analysis No indication that the mutations in the increased vigor of the bacteria; this does not rule out that the is attenuated and agrees with previous experiments; results encourage further characterization The mgnrh DNA fragment was sequenced (Virginia Bioinformatics Institute) and the SIXFRAME program (seqtool.sdsc.edu) was used to predict translated peptide sequence; codon agreement with Brucella trna was performed using the JAVA Codon Adaptation Tool (JCAT, JCAT.de) was evidence of the DNA sequence being cloned in frame as is required for expression and for appropriate codon usage in the mgnrh multimer for expression in Brucella (See Indicators) Sequence was cloned in frame however codons were not optimized for use in Brucella in the original mgnrh fragment; mgnrhb was created (synthesized by GenScript) using codons optimized for Brucella with the same translation as the original mgnrh provided by USDA-APHIS GS Difficulty demonstrating expression in the original construct led to the in silico analysis, troubleshooting led to changes made in the project In silico analysis led to changes in the DNA sequence of mgnrh to adapt the construct to Brucella, the resulting mgnrhb was then analyzed for expression by Western blot

4 Output Demonstrate expression of mgnrhb in the VTRS2-mGnRHb Developed Western blot Western blotting of lysed protein samples of VTRS2- mgnrhb; VTRS2 pns4 (empty plasmid) was used as negative control Demonstrate a protein band at approximately 18kDa using anti-gnrh and/or anti-his antibodies Development of Western blot on radiology film, light emission from antibody binding indicates presence of peptide GS, HA Expression was demonstrated for mgnrhb, the original mgnrh transcript was not translated by Brucella Proof of expression precludes testing in animals Demonstration of protein expression allowed the project to enter the animal-testing phases; the change in DNA sequence caused a delay in animal experiments but greatly increased their chance of success Objective: Assessment of Clearance of VTRS2-mGnRHb in the mouse model Clearance of the between 4 and 6 weeks postinoculation CFU of bacteria collected from homogenized spleens from inoculated mice indicator ~5 x 10 5 CFU <2 log CFU in spleens after 6 weeks Serial dilution of mouse spleens and plating of diluted homogenate onto TSA plates at 4 and 6 weeks postinoculation GS, NS, HA, ED 99.99% bacterial load of mice that received VTRS2-mGnRH vs the wild-type B. suis 1330; 1.39 (± 0.21) LOG CFU remained after 6 weeks, the lower limit of detection is 1.30 (s) Clearance between 4 and 6 weeks postinoculation is ideal for a live bacterial vaccine By week 6 post-inoculation % of the inocula had cleared from the mice. This is in the target window for clearance of a live, beyond 6 weeks is undesirable as it demonstrates lack of attenuation, shorter than 4 weeks does not allow for enough exposure to the host immune system. These data precluded beginning challenge trials. Anti-mGnRH ELISA was also performed on inoculated mouse sera, there was a statistically significant difference in IgG antibody response in mice receiving VTRS2-mGnRH vs controls (P=.05) Objective: Assessment of protection against virulent Brucella challenge by VTRS2-mGnRHb in the mouse model ly lower bacterial burden in spleens of vs un mice following infectious challenge What was the indicator CFU of spleen homogenates in vs un mice ---- splenic CFU vs controls, ideal = >1 LOG reduction Spenic CFU were obtained by serial dilution of spleen homogenates NS, GS, HA In animals that did not receive a booster vaccination 0.5 LOG reduction (0.5 Units of Protection, determined

5 (s) Ideally protection should be greater than 1 LOG however a significant difference between and control animals is demonstration of protection by subtraction of mean of Log 10 converted CFU of un from mice) (P=0.018); surprisingly in animals receiving a booster there was no difference in clearance. This is thought to have happened due to the initial challenge dose being higher than predicted or as a result of a long period of time elapsing between original vaccination and challenge (8 weeks was used to allow for sufficient clearance). Protection was not as high as predicted however it was demonstrated sufficiently enough to warrant initiation of breeding experiments (in progress). Additionally, these trials are being repeated using a shorter time between vaccination and challenge/booster (in progress, experiment ends ) Objective: Assessment of contraceptive effect of VTRS2-mGnRHb in the mouse model breeding behavior or litter size; gonadal changes and reduction of secondary sex organs in animals number of females bred/male, number of pups/female (fecundity), and histopathological analysis of gonads and secondary sex characteristics in mice vs controls indicator What was the target value? breeding values in mice vs controls Experiment in progress, output will be number of females bred/male, number of pups/female (fecundity), and histopathological analysis of gonads and secondary sex characteristics. NS, GS (s) EXPERIMENT IN PROGRESS Final report will be submitted at the end of August, 2014 after completion of data collection and analysis. Successful breeding activity or litter size, combined with documented protection against Brucella challenge will merit further exploration of VTRS2-mGnRHb in the pig. Summary: Feral pigs are a major nuisance species in the United States, in particular in the Southern region, and have the potential to spread disease to both humans and livestock in addition to causing environmental and property damage. Further control methods are needed and the goal of these studies is to determine whether the novel vaccine VTRS2-mGnRHb has potential as a viable alternative to currently available methods of control in the United States. Preliminary assessment of the candidate vaccine described herein allows for cost-effective determination whether further evaluation in pigs is warranted. This study has demonstrated protection against virulent Brucella challenge in the mouse model and the immunocontraceptive effect of the vaccine is currently being assessed in breeding trials which are expected to conclude in August 2014 at which time this report will be updated.

BACTERIAL CONJUGATION. To demonstrate the technical procedure to monitor the conjugational transfer of genetic material from one cell to another.

BACTERIAL CONJUGATION. To demonstrate the technical procedure to monitor the conjugational transfer of genetic material from one cell to another. BACTERIAL CONJUGATION I. OBJECTIVES To demonstrate the technical procedure to monitor the conjugational transfer of genetic material from one cell to another. To learn about the various genetic elements

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Solutions for Your Research

Solutions for Your Research Solutions for Your Research Custom Antibody Services Polyclonal Monoclonal The service we offer is very complete starting from rabbits, mice and rats. The different formats provided by Primm depend on

More information

Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons)

Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons) Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics BIT 220 End of Chapter 22 (Snustad/Simmons) Nucleic Acids as Therapeutic Agents Many diseases (cancer, inflammatory diseases) from

More information

CONTRACTING ORGANIZATION: Albert Einstein College of Medicine Bronx, NY 10461

CONTRACTING ORGANIZATION: Albert Einstein College of Medicine Bronx, NY 10461 AD Award Number: W81XWH-08-1-0011 TITLE: Defining B. Anthracis Protective Antigen Antigenic Domains PRINCIPAL INVESTIGATOR: Arturo Casadevall, M.D., Ph.D. CONTRACTING ORGANIZATION: Albert Einstein College

More information

2 nd year Medical Students - JU Bacterial genetics. Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S.

2 nd year Medical Students - JU Bacterial genetics. Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S. 2 nd year Medical Students - JU Bacterial genetics Dr. Hamed Al Zoubi Associate Professor of Medical Microbiology. MBBS / J.U.S.T MSc, PhD/ UK Bacterial genetics ILOs: bacterial genome and replication

More information

Biosc10 schedule reminders

Biosc10 schedule reminders Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,

More information

Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]

Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1] 1 Molecular evidence E Ulmus procera, form a genetically isolated clone. English Elms developed from a variety of elm brought to Britain from Rome in the first century A.D. Although English Elm trees make

More information

ICH Considerations. Oncolytic Viruses September 17, 2009

ICH Considerations. Oncolytic Viruses September 17, 2009 INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH Considerations Oncolytic Viruses September 17, 2009 1. Introduction Oncolytic viruses

More information

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Veterinary Use CVMP/IWP/07/98-FINAL COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES

More information

AN EXAMINATION OF THE EFFECTS OF SIMVASTATIN ON INNATE IMMUNE RESPONSES TO S. AUREUS A RESEARCH PAPER BY TRACI STANKIEWICZ

AN EXAMINATION OF THE EFFECTS OF SIMVASTATIN ON INNATE IMMUNE RESPONSES TO S. AUREUS A RESEARCH PAPER BY TRACI STANKIEWICZ AN EXAMINATION OF THE EFFECTS OF SIMVASTATIN ON INNATE IMMUNE RESPONSES TO S. AUREUS A RESEARCH PAPER BY TRACI STANKIEWICZ SUBMITTED TO THE GRADUATE SCHOOL IN PARTIAL FULFILLMENT OF THE REQUIRMENTS SET

More information

Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology

Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing

More information

1. Immunization. What is Immunization? 12/9/2016. Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology

1. Immunization. What is Immunization? 12/9/2016. Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

CASE STUDY 4 Swine Erysipelas vaccine In vitro ELISA assay to replace in vivo immunization-challenge test. P-J Serreyn

CASE STUDY 4 Swine Erysipelas vaccine In vitro ELISA assay to replace in vivo immunization-challenge test. P-J Serreyn CASE STUDY 4 Swine Erysipelas vaccine In vitro ELISA assay to replace in vivo immunization-challenge test P-J Serreyn Introduction History and background Situation & Methods in EU Companies Authorities

More information

A) (5 points) As the starting step isolate genomic DNA from

A) (5 points) As the starting step isolate genomic DNA from GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB

More information

Signature-Tagged Mutagenesis to Identify Virulence Genes in Salmonella choleraesuis

Signature-Tagged Mutagenesis to Identify Virulence Genes in Salmonella choleraesuis Abstract Signature-Tagged Mutagenesis to Identify Virulence Genes in Salmonella choleraesuis Carol A. Lichtensteiger 1 and Eric R. Vimr 2 Department of Veterinary Pathobiology 1,2 and Veterinary Diagnostic

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Recombinant, Insect Cell-Derived RSV Nanoparticle Vaccine

Recombinant, Insect Cell-Derived RSV Nanoparticle Vaccine Recombinant, Insect Cell-Derived RSV Nanoparticle Vaccine Gregory Glenn Chief Medical Officer MVADS-Copenhagen 4 July 2012 1 Agenda for RSV Discussion Overview of Insect Cell Technology Respiratory Syncytial

More information

LAMPIRE Hybridoma Project Initiation Form

LAMPIRE Hybridoma Project Initiation Form 1. General Information Company / Institution: Investigator Name: Contact Name: Phone: Fax: 2. Billing / Shipping Information Accounts Payable contact: Company: Dept./Bldg./Room#: Address: Project Name

More information

The Potential for Vaccines in Controlling Bacterial Kidney Disease

The Potential for Vaccines in Controlling Bacterial Kidney Disease The Potential for Vaccines in Controlling Bacterial Kidney Disease Linda D. Rhodes*, Cindra K. Rathbone +, Stephen C. Corbett #, Lee W. Harrell*, Mark S. Strom* *Northwest Fisheries Science Center, NOAA

More information

The process of new DNA to another organism. The goal is to add one or more that are not already found in that organism.

The process of new DNA to another organism. The goal is to add one or more that are not already found in that organism. Genetic Engineering Notes The process of new DNA to another organism. The goal is to add one or more that are not already found in that organism. Selective Breeding Carefully choosing which plants and

More information

1 R21 AI A1 2 VMD HALFORD, W

1 R21 AI A1 2 VMD HALFORD, W 1 R21 AI081072-01A1 2 VMD 1R21AI081072-01A1 ILLIAM RESUME AND SUMMARY OF DISCUSSION: The proposed study is to develop safe and effective live attenuated vaccines against herpes simplex virus 2 by using

More information

ICH CONSIDERATIONS Oncolytic Viruses

ICH CONSIDERATIONS Oncolytic Viruses European Medicines Agency Pre-authorisation Evaluation of Medicines for Human Use 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 ICH CONSIDERATIONS Oncolytic Viruses 20 November 2008 EMEA/CHMP/GTWP/607698/2008

More information

CHAPTERS 16 & 17: DNA Technology

CHAPTERS 16 & 17: DNA Technology CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make

More information

21.4 Recombinant DNA technology Calculation worksheet. AQA Biology. Calculating the efficiency of DNA transfer during genetic engineering

21.4 Recombinant DNA technology Calculation worksheet. AQA Biology. Calculating the efficiency of DNA transfer during genetic engineering Calculating the efficiency of DNA transfer during genetic engineering Specification references 3.8.4.1 MS 0.1, MS 0.3 Learning outcomes After completing this worksheet you should be able to: manipulate

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

13-1 Changing the Living World

13-1 Changing the Living World 13-1 Changing the Living World In the past, variation was limited to the variations already in nature or random variations that resulted from mutations. Now, scientists can change DNA and swap genes from

More information

PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence

PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence Parul Singh 1,2, Rameshwaram Nagender Rao 1, Jala Ram Chandra Reddy 3, R.B.N. Prasad 3, Sandeep

More information

number Done by Corrected by Doctor Hamed Al Zoubi

number Done by Corrected by Doctor Hamed Al Zoubi number 3 Done by Neda a Baniata Corrected by Waseem Abu Obeida Doctor Hamed Al Zoubi Note: it is important to refer to slides. Bacterial genetics *The main concepts we will talk about in this lecture:

More information

BACTERIAL GENETICS. How does the DNA in the bacterial cell replicate

BACTERIAL GENETICS. How does the DNA in the bacterial cell replicate BACTERIAL GENETICS Bacterial genetics is the study of gene structure and function in bacteria. Genetics itself is concerned with determining the number, location, and character of the genes of an organism.

More information

Hybridization - the act or process of mating organisms of varieties or species to create a hybrid. Insecticide crops

Hybridization - the act or process of mating organisms of varieties or species to create a hybrid. Insecticide crops Genetic Engineering Genetic engineering is the alteration of genetic code by means, and is therefore different from traditional selective breeding. Only allowing desired characteristics to reproduce. Scorpion

More information

Rawan Almujaibel Anas Abu-Humaidan

Rawan Almujaibel Anas Abu-Humaidan 8 Rawan Almujaibel...... Anas Abu-Humaidan In the previous lecture the Dr. talked about DNA structure and their 4 types of nitrogen bases. Then he talked about bacterial DNA (chromosomes) and their replication

More information

Page 3. 18) The diagram below illustrates some key steps of a procedure in one area of biotechnology.

Page 3. 18) The diagram below illustrates some key steps of a procedure in one area of biotechnology. Name: 1117 1 Page 1 1) A small amount of DNA was taken from a fossil of a mammoth found frozen in glacial ice. Genetic technology can be used to produce a large quantity of identical DNA from this mammoth's

More information

Overview: The DNA Toolbox

Overview: The DNA Toolbox Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant

More information

462 BCH. Biotechnology & Genetic engineering. (Practical)

462 BCH. Biotechnology & Genetic engineering. (Practical) 462 BCH Biotechnology & Genetic engineering (Practical) Nora Aljebrin Office: Building 5, 3 rd floor, 5T304 E.mail: naljebrin@ksu.edu.sa All lectures and lab sheets are available on my website: Fac.ksu.edu.sa\naljebrin

More information

Module 6 Microbial Genetics. Chapter 8

Module 6 Microbial Genetics. Chapter 8 Module 6 Microbial Genetics Chapter 8 Structure and function of the genetic material Genetics science of o Study of what genes are, how they determine the characteristics of an organism, how they carry

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

chapter eight: microbial genetics

chapter eight: microbial genetics chapter eight: microbial genetics Revised 9/15/2016 the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material

More information

Virulence factors: name them and explain what they do, how do you calculate how virulent something is

Virulence factors: name them and explain what they do, how do you calculate how virulent something is General Microbiology Final Exam Study Guide Spring 2017 Ginny L. Please bring various colored writing utensils! Fair warning, I am not a TA or teacher and I have not seen your final exam, this is to cover

More information

NaNoplasmid TM. Platform SIZE MATTERS SMALLER IS BETTER

NaNoplasmid TM. Platform SIZE MATTERS SMALLER IS BETTER Nanoplasmid TM Platform NaNoplasmid TM The Nanoplasmid is a dramatically improved Key Cassette (

More information

DNA Function. DNA Heredity and Protein Synthesis

DNA Function. DNA Heredity and Protein Synthesis DNA Function DNA Heredity and Protein Synthesis 1 Review DNA made of Nucleotide bases Proteins made of Amino acids Describe how DNA is involved in protein synthesis DNA base sequence codes for amino acid

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

Lecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know

Lecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know Lecture 1. Basic Definitions and Nucleic Acids Basic Definitions you should already know apple DNA: Deoxyribonucleic Acid apple RNA: Ribonucleic Acid apple mrna: messenger RNA: contains the genetic information(coding

More information

Monoclonal Antibody Generation. Ivo Lorenz Tri-Institutional Therapeutics Discovery Institute

Monoclonal Antibody Generation. Ivo Lorenz Tri-Institutional Therapeutics Discovery Institute Monoclonal Antibody Generation Ivo Lorenz Tri-Institutional Therapeutics Discovery Institute Common Antibody Formats Heavy chain VL VH Light chain Fab CL CH1 VH VL Linker CH2 VH VL Fc CH3 IgG Immunoglobulin

More information

Western-GUARANTEED Antibody Service FAQ

Western-GUARANTEED Antibody Service FAQ Western-GUARANTEED Antibody Service FAQ Content Q 1: When do I need a Western GUARANTEED Peptide Antibody Package?...2 Q 2: Can GenScript provide a Western blot guaranteed antibody?...2 Q 3: Does GenScript

More information

Name Class Date. a. identify similarities and

Name Class Date. a. identify similarities and Chapter 13 enetic Engineering Chapter Test A Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. Selective breeding produces a. more offspring.

More information

Guided Notes Unit 5: Molecular Genetics

Guided Notes Unit 5: Molecular Genetics Name: Date: Block: Chapter 8: From DNA to Protein I. Concept 8.4: Transcription a. Central Dogma of Molecular Biology i. Information flows in one direction: ii. How? Guided Notes Unit 5: Molecular Genetics

More information

Spostiamo ora la nostra attenzione sui batteri, e batteriofagi

Spostiamo ora la nostra attenzione sui batteri, e batteriofagi Spostiamo ora la nostra attenzione sui batteri, e batteriofagi Bacteria Mutate Spontaneously and Grow at an Exponential Rate. Useful for genetics studies, development of genetic engineering Teoria dell'adattamento

More information

Primer Sequence b Amino acids a. agccatgggtttaatatctaaagaagagttaataaaactcgcatatagc. ccggatccacttaatctagcaaattcgcttgtgttgaattcatctttacc

Primer Sequence b Amino acids a. agccatgggtttaatatctaaagaagagttaataaaactcgcatatagc. ccggatccacttaatctagcaaattcgcttgtgttgaattcatctttacc Table S1. Oligonucleotides used for cloning toxin domains of C. difficile VPI10463 Toxin and fragment Primer Sequence b Amino acids a Toxin A fragment 1 TxAfrag1Fw TxAfrag1Rv agccatgggtttaatatctaaagaagagttaataaaactcgcatatagc

More information

BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?

BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT? BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?

More information

DNA Cloning with Cloning Vectors

DNA Cloning with Cloning Vectors Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning

More information

1 R01 AI VMD HALFORD, W

1 R01 AI VMD HALFORD, W 1 R01 AI104935-01 2 VMD 1R01AI104935-01 ILLIAM CRITIQUE 1: Significance: 5 Investigator(s): 2 Innovation: 5 Approach: 8 Environment: 2 Overall Impact: This application proposes to develop a recombinant

More information

Pr oject Summar y. Development of a diagnostic assay for chronic wasting disease. Principal Investigator: Richard Rubenstein

Pr oject Summar y. Development of a diagnostic assay for chronic wasting disease. Principal Investigator: Richard Rubenstein Pr oject Summar y Development of a diagnostic assay for chronic wasting disease Principal Investigator: Richard Rubenstein New York State Institute for Basic Research Study Completed May 2003 Funded by

More information

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology

More information

19 Biopharming Edible Vaccines As y o u r e a d in Activity 1, A Genetically Modified Solution? scientists

19 Biopharming Edible Vaccines As y o u r e a d in Activity 1, A Genetically Modified Solution? scientists 19 Biopharming Edible Vaccines As y o u r e a d in Activity 1, A Genetically Modified Solution? scientists have been using genetically modified E. coli for more than 30 years to manufacture proteins for

More information

Regents Biology REVIEW 5: GENETICS

Regents Biology REVIEW 5: GENETICS Period Date REVIEW 5: GENETICS 1. Chromosomes: a. Humans have chromosomes, or homologous pairs. Homologous: b. Chromosome pairs carry genes for the same traits. Most organisms have two copies of the gene

More information

E. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement:

E. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement: AP Biology - Problem Drill 10: Molecular and Human Genetics Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. Which of the following

More information

10. BIOTECHNOLOGY (Code No. 045)

10. BIOTECHNOLOGY (Code No. 045) 10. BIOTECHNOLOGY (Code No. 045) An unprecedented growth of human knowledge in the field of Biological Sciences coupled with equally significant developments in the field of technology have brought significant

More information

Elena BM Breidenstein, PhD 21 April 2018

Elena BM Breidenstein, PhD 21 April 2018 Discovery of a Novel Oral Antibiotic, DDS-01 (SMT-571), to Treat Multi-Drug Resistant Neisseria gonorrhoeae Enabled by a Proprietary Transposon Technology Elena BM Breidenstein, PhD 21 April 2018 Forward-Looking

More information

SCREENING AND PRESERVATION OF DNA LIBRARIES

SCREENING AND PRESERVATION OF DNA LIBRARIES MODULE 4 LECTURE 5 SCREENING AND PRESERVATION OF DNA LIBRARIES 4-5.1. Introduction Library screening is the process of identification of the clones carrying the gene of interest. Screening relies on a

More information

Answers to Questions: Teacher s Edition PreLab Activity: Student Learning Outcome & Pre-Lab Predictions For Laboratory Activity

Answers to Questions: Teacher s Edition PreLab Activity: Student Learning Outcome & Pre-Lab Predictions For Laboratory Activity : Teacher s Edition PreLab Activity: Student Learning Outcome & Pre-Lab Predictions For Laboratory Activity Student Learning Outcomes at the end of this laboratory, students will be able to: 1. Explain

More information

GENETICS - CLUTCH CH.5 GENETICS OF BACTERIA AND VIRUSES.

GENETICS - CLUTCH CH.5 GENETICS OF BACTERIA AND VIRUSES. !! www.clutchprep.com CONCEPT: WORKING WITH MICROORGANISMS Bacteria are easy to with in a laboratory setting They are fast dividing, take up little space, and are easily grown in a lab - Plating is when

More information

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes

More information

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and

More information

A cross between dissimilar individuals to bring together their best characteristics is called

A cross between dissimilar individuals to bring together their best characteristics is called Ch 13 Game review A cross between dissimilar individuals to bring together their best characteristics is called A Genetic engineering B Inbreeding C Hybridization D Sequencing Ans: C Used to insert new

More information

Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009

Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009 MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose

More information

Genetics: Analysis of Genes and Genomes, Ninth Edition. Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION

Genetics: Analysis of Genes and Genomes, Ninth Edition. Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION CHAPTER 1 STUDENT NOT STUDY FOR SALE GUIDE OR DISTRIBUTION TEST BANK Daniel Jones L. Hartl & Bartlett and Bruce Learning, J. Cochrane LLC Multiple Choice 1. NOT What FOR happens SALE if organisms OR DISTRIBUTION

More information

GENETIC ENGINEERING worksheet

GENETIC ENGINEERING worksheet Section A: Genetic Engineering Overview 1. What is genetic engineering? 2. Put the steps of genetic engineering in order. Recombinant product is isolated, purified and analyzed before marketing. The DNA

More information

Basic Concepts and History of Genetic Engineering. Mitesh Shrestha

Basic Concepts and History of Genetic Engineering. Mitesh Shrestha Basic Concepts and History of Genetic Engineering Mitesh Shrestha Genetic Engineering AKA gene manipulation, gene cloning, recombinant DNA technology, genetic modification, and the new genetics. A technique

More information

Lab 5/5a Transformation of E. coli with a Recombinant Plasmid

Lab 5/5a Transformation of E. coli with a Recombinant Plasmid Lab 5/5a Transformation of E. coli with a Recombinant Plasmid Lab 2 Pre Lab Readiness Familiarity and Proper use of micropipettes Remember the 1 st and 2 nd stops Aseptic Technique Antibiotic Resistance

More information

ICH Considerations Oncolytic Viruses ONCOLYTIC VIRUSES (EMEA/CHMP/ICH/607698/2008) TRANSMISSION TO CHMP November 2008

ICH Considerations Oncolytic Viruses ONCOLYTIC VIRUSES (EMEA/CHMP/ICH/607698/2008) TRANSMISSION TO CHMP November 2008 European Medicines Agency October 2009 EMEA/CHMP/ICH/607698/2008 ICH Considerations Oncolytic Viruses ONCOLYTIC VIRUSES (EMEA/CHMP/ICH/607698/2008) TRANSMISSION TO CHMP November 2008 TRANSMISSION TO INTERESTED

More information

Genetic Characterization of Production Cell Lines

Genetic Characterization of Production Cell Lines Genetic Characterization of Production Cell Lines Luhong He and Christopher Frye 2017 CMC Strategy Forum Outlines Overview Genetic characterization strategy and case studies Transgene characterization

More information

chapter eight: microbial genetics

chapter eight: microbial genetics chapter eight: microbial genetics the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material Hershey Chase, 1952

More information

12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule

12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 3. Led to many biotechnology applications- genetic engineering, DNA fingerprinting, cloning,

More information

Custom Antibody Services. Antibodies Designed Just for You. HuCAL Recombinant Monoclonal Antibody Generation Service

Custom Antibody Services. Antibodies Designed Just for You. HuCAL Recombinant Monoclonal Antibody Generation Service Custom Antibody Services Antibodies Designed Just for You HuCAL Recombinant Monoclonal Antibody Generation Service Antibodies Designed Just for You What if there was a technology that would allow you to

More information

NAME TA SEC Problem Set 5 FRIDAY October 29, 2004

NAME TA SEC Problem Set 5 FRIDAY October 29, 2004 MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 5 FRIDAY October 29,

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

Transduction of an Antibiotic Resistance Gene. Background

Transduction of an Antibiotic Resistance Gene. Background I Student Guide 21-1128 Name------------ Date Transduction of an Antibiotic Resistance Gene Background Transduction is a natural method of gene transfer that occurs in bacteria. The key player in transduction

More information

Genetics and Biotechnology. Section 1. Applied Genetics

Genetics and Biotechnology. Section 1. Applied Genetics Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

BIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.

BIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY. BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

The Human Genome Project

The Human Genome Project The Human Genome Project The Human Genome Project Began in 1990 The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease. The true payoff from the

More information

The Road to Licensure of a DNA Vaccine for Atlantic Salmon

The Road to Licensure of a DNA Vaccine for Atlantic Salmon The Road to Licensure of a DNA Vaccine for Atlantic Salmon Nathalie C. Simard, Manager, Vaccines Research Novartis Animal Health Canada Inc. Aqua Health Business November 24th, 2008 Presentation Overview

More information

A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response

A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response Ann E. Lin, Federico C. Beasley, Nadia Keller, Andrew Hollands, Rodolfo Urbano, Emily

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA 21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule

More information

Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin

Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin (A), D1-CD2 (B), and the D1-CD2 variant 3 (C) to Adomain

More information

Biology (Microbiology): Exam #3

Biology (Microbiology): Exam #3 NAME: PLEDGE: Biology 50-384 (Microbiology): Exam #3 1. You have isolated a series of mutants that have altered patterns of ß-galactosidase and lactose permease activity (i.e. they are different that the

More information

Bacterial Genetics. Stijn van der Veen

Bacterial Genetics. Stijn van der Veen Bacterial Genetics Stijn van der Veen Differentiating bacterial species Morphology (shape) Composition (cell envelope and other structures) Metabolism & growth characteristics Genetics Differentiating

More information

Picture Keyword Table of Contents (LE)

Picture Keyword Table of Contents (LE) Picture Keyword Table of Contents (LE) First Letter Keyword Page Number Count a abiotic 1 2 absorption 2 1 acid rain 2 1 active transport 3 5 adaptation 5 11 amino acid chains 12 1 amino acid sequences

More information

Solutions to Quiz II

Solutions to Quiz II MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1

More information

Short- and Long-Term Immune Responses of CD-1 Outbred Mice to the Scrub Typhus DNA Vaccine Candidate: p47kp

Short- and Long-Term Immune Responses of CD-1 Outbred Mice to the Scrub Typhus DNA Vaccine Candidate: p47kp Short- and Long-Term Immune Responses of CD-1 Outbred Mice to the Scrub Typhus DNA Vaccine Candidate: p47kp GUANG XU, a SUCHISMITA CHATTOPADHYAY, a JU JIANG, a TEIK-CHYE CHAN, a CHIEN-CHUNG CHAO, a WEI-MEI

More information

Page 70 Monday December 8, 2014

Page 70 Monday December 8, 2014 replication and Monday December 8, 0 Notebook check 8: Page 69, DNA Technology Introduction Worksheet. The process by which a foreign gene is replicated by insertion into a bacterium is called genetic

More information

Exercise 13 DETERMINATION OF MICROBIAL NUMBERS

Exercise 13 DETERMINATION OF MICROBIAL NUMBERS Exercise 13 DETERMINATION OF MICROBIAL NUMBERS Introduction When biologists discuss the growth of microorganisms (microbial growth), they are actually referring to population size rather than to the size

More information