Supplementary Figure 1 Abortive ligation (adenylation) of the gapped 5'-dRP-containing BER

Size: px
Start display at page:

Download "Supplementary Figure 1 Abortive ligation (adenylation) of the gapped 5'-dRP-containing BER"

Transcription

1 Supplementary Figure 1 Abortive ligation (adenylation) of the gapped 5'-dRP-containing BER intermediate by human BER ligases. The ligation efficiency of DNA ligase I (a) and XRCC1/DNA ligase III complex (b). The migration positions of the DNA substrate (17 drp, Substrate 1 in Supplementary Table 1), ligation product and the adenylated DNA intermediate (17 drp +AMP) are indicated.

2 Supplementary Figure 2 The assessment of drp lyase activity of wild type and pol β mutants. (a) Uncropped image for the adenylated sugar phosphate removal by pol β from the gapped and nicked 5'-dRP and 5'-AMP-dRP-containing substrates. The final cropped image is presented in

3 Fig. 1. (b,c) The drp lyase assay for the adenylated sugar phosphate removal by the 3KΔ mutant of pol β from the gapped (b) and nicked (c) 5'-AMP-dRP-containing substrates. In both panels b and c, lane 1 is a minus enzyme control, and lane 2 is a reference reaction containing wild type pol β. The positions of the gapped (17 drp +AMP, Substrate 2 in Supplementary Table 1) and nicked (18 drp +AMP, Substrate 4 in Supplementary Table 1) DNA substrates and the pol β lyase products (17-mer in panel b, 18-mer in panel c) are indicated. The 3KΔ mutant was devoid of activity (lanes 3-6). (d,e) The drp lyase assay for the adenylated sugar phosphate removal by the K68A mutant of pol β from the gapped (d) and nicked (e) 5'-AMP-dRP-containing substrates. In both panels d and e, lane 1 is a minus enzyme control and lane 2 is a reference reaction containing wild type pol β. The positions of the gapped (17 drp +AMP, Substrate 2 in Supplementary Table 1) and nicked (18 drp +AMP, Substrate 4 in Supplementary Table 1) DNA substrates and the pol β lyase products (17-mer in panel d, 18-mer in panel e) after 5'-AMP-dRP removal by wild type pol β (lane 2), and K68A mutant (lanes 6-9) are indicated.

4 Supplementary Figure 3 The actions of APTX and pol β on different DNA substrates. The drp lyase and DNA deadenylation assays for the processing of the gapped and nicked 5'-AMP-dRP (a), the nicked 5'-AMP (b), and the gapped and nicked 5'-AMP-THF (c) containing DNA substrates. (a) Lane 1 and lane 4 are minus enzyme controls; lane 2 and lane 5 are the products of APTX 5'- AMP removal; lane 3 and lane 6 are the products of pol β lyase 5'-AMP-dRP removal. The positions of the gapped (17 drp +AMP, Substrate 2 in Supplementary Table 1) and nicked (18 drp +AMP, Substrate 4 in Supplementary Table 1) DNA substrates and the pol β lyase (17-mer or 18-mer) and APTX removal (17 drp or 18 drp ) products are indicated. (b) Lane 7 is a minus enzyme control, and lane 8 is the product of APTX 5'-AMP removal. The positions of the nicked DNA substrate (18+AMP, Substrate 5 in Supplementary Table 1), and APTX removal product (18-mer) are indicated. Pol β showed no activity with this substrate (lane 9). (c) Lane 10 and lane 13 are minus enzyme controls, and lane 11 and lane 14 are the products of APTX 5'-AMP removal. The positions for the gapped (17 THF +AMP, Substrate 6 in Supplementary Table 1) and nicked (18 THF +AMP, Substrate 7 in Supplementary Table 1) DNA substrates and APTX products (17 THF or 18 THF ) are indicated. Pol β showed no activity with these substrates (lanes 12 and 15).

5 Supplementary Figure 4 Transactions of pol β, APTX and FEN1 at the BER intermediates. (a,b,c) FEN1 excision assay for the nicked 5'-AMP-dRP (a), gapped 5'-AMP-dRP (b), the nicked 5'-AMP (c) containing DNA substrates (Supplementary Table 1). Lanes 1, 9 and 17 are minus enzyme controls, lanes 2 and 10 are reference reactions containing pol β. Lanes 3-8 in panel a, lanes in panel b, and lanes in panel c are FEN1 excision cleavage products. The positions of the DNA substrate for 18 drp +AMP (Substrate 4 in panel a), 17 drp +AMP (Substrate 2 in panel b), and 18+AMP (Substrate 5 in panel c) are indicated. The positions of the products for pol β lyase (18-mer in panel a, 17-mer in panel b), and FEN1 excision cleavage (17-, 16- or 15-mer in panel a; 16- or 15-mer in panel b; 17- or 16-mer in panel c) are indicated. Pol β showed no activity with Substrate 5 (lane 18). (d) The catalytic rates of pol β, FEN1, and APTX in the processing of 5'-AMP-dRP substrate. The rates of pol β ( ) FEN1 (u ), and APTX (n ) are as k obs of 0.05 s -1, 0.03 s -1, and 0.2 s -1, respectively. (e) A model proposing the fate of the adenylated BER

6 intermediate as mediated by pol β, FEN1, and APTX activities. The normal pol β lyase reaction illustrated at the top is biphasic and fast (>800 s -1 and 2 s -1 ).

7 Supplementary Figure 5 The fate of 5'-adenylated BER intermediate in the case of APTX and/or FEN1 deficiency. (a) The drp lyase, DNA adenylation and FEN1 excision assays with purified enzymes pol β, FEN1, and APTX. Lane 1 is a minus enzyme control, lane 2, 3, and 4 are reference reactions containing FEN1, pol β, and APTX, respectively. The migration position of the DNA substrate (17 drp +AMP, Substrate 2 in Supplementary Table 1) is indicated. (b-g) The drp lyase, DNA adenylation and FEN1 excision assays in the cell extracts prepared from the yeast strains (Supplementary Table 3). DNA substrate was not pretreated with UDG. The reaction products observed in the cell extracts from the wild-type (b, lanes 5-7), hnt3δ (c, lanes 8-10), rad27δ (d, lanes 11-13), hnt3δrad27δ (e, lanes 14-16), rad27δ::polb (f, lanes 17-19), hnt3δrad27δ::polb (g, lanes 20-22) yeast strains are indicated. In panels a-g, the positions of the products for FEN1 excision cleavage (16- or 15-mer), pol β lyase (17-mer), and APTX removal of AMP (17 drp ) are indicated. Three lanes in each set (in panels b-g) correspond to the time points 5, 15, or 30 min.

8 Supplementary Table 1 DNA substrates used in this study. FAM indicates the presence of a fluorescence tag. The abbreviations drp and THF represent a 5'-deoxyribose phosphate (5'-dRP) and synthetic abasic site analog (tetrahydrofuran), respectively. The presentations for DNA substrates 1-4 are designations after UDG treatment of the 36-mer double-stranded DNA substrates.

9 Supplementary Table 2 Data collection and refinement statistics.

10 Supplementary Table 3 Saccharomyces cerevisiae strains used in this study.

11 Supplementary Table 4 The sequences of oligonucleotides and primers used in this study. a F denotes THF, U represents a uracil base, and p stands for a phosphate group. The sequences of DNA oligonucleotides are shown in 5' to 3' orientation. b The downstream oligonucleotides include the 3'-FAM label. The downstream, upstream, and template oligonucleotides were used to construct the DNA substrates represented in Supplementary Table 1. For example, D Ugap (17-mer plus a uracil base) was used to construct either the gapped 5'-dRP-containing substrate (Substrate 1, Supplementary Table 1) or the gapped 5'-AMP-dRP-containing substrate (Substrate 2, Supplementary Table 1) after its annealing with the template b in the presence of the upstream b oligonucleotide. c Forward and reverse primers were used to construct the yeast strains used in this study. d Template, primer, and downstream oligonucleotides were used to construct the DNA substrate for crystallization of pol β-dna complex.

AP endonuclease 1 prevents trinucleotide repeat expansion via a novel mechanism during base excision repair

AP endonuclease 1 prevents trinucleotide repeat expansion via a novel mechanism during base excision repair Nucleic Acids Research Advance Access published May 18, 2015 Nucleic Acids Research, 2015 1 doi: 10.1093/nar/gkv530 AP endonuclease 1 prevents trinucleotide repeat expansion via a novel mechanism during

More information

CHAPTER 5. Reduced DNA gap repair in aging rat neuronal extracts and its restoration in vitro by DNA Polymerase p

CHAPTER 5. Reduced DNA gap repair in aging rat neuronal extracts and its restoration in vitro by DNA Polymerase p CHAPTER 5 Reduced DNA gap repair in aging rat neuronal extracts and its restoration in vitro by DNA Polymerase p Reduced DNA gap repair in aging rat neuronal extracts and its restoration in vitro by DNA

More information

Roles of DNA Base Excision Repair in Maintaining the Integrity of DNA Methylation

Roles of DNA Base Excision Repair in Maintaining the Integrity of DNA Methylation Florida International University FIU Digital Commons FIU Electronic Theses and Dissertations University Graduate School 11-15-2013 Roles of DNA Base Excision Repair in Maintaining the Integrity of DNA

More information

Supplementary Information for. Coordination of multiple enzyme activities by a single PCNA in archaeal Okazaki fragment.

Supplementary Information for. Coordination of multiple enzyme activities by a single PCNA in archaeal Okazaki fragment. Supplementary Information for Coordination of multiple enzyme activities by a single PCNA in archaeal Okazaki fragment maturation Thomas R. Beattie and Stephen D. Bell Sir William Dunn School of Pathology,

More information

Please write your name or student ID number on every page.

Please write your name or student ID number on every page. MCB 110 First Exam A TOTAL OF SIX PAGES NAME: Student ID Number: Question Maximum Points Your Points I 30 II 30 III 30 IV 38 V 22 150 Please write your name or student ID number on every page. This exam

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11988 Supplementary Figure 1. Digestion of model DNA substrates. a, Linearized plasmid DNA (pik31- PstI, lanes 1 and 2), supercoiled plasmid (pik31, lanes 3 and 4), singly nicked plasmid

More information

4. Analysing genes II Isolate mutants*

4. Analysing genes II Isolate mutants* .. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual

More information

MCB 110 Spring 2017 Exam 1 SIX PAGES

MCB 110 Spring 2017 Exam 1 SIX PAGES MCB 110 Spring 2017 Exam 1 SIX PAGES NAME: SID Number: Question Maximum Points Your Points I 28 II 32 III 32 IV 30 V 28 150 PLEASE WRITE your NAME or SID number on each page. This exam must be written

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Editorial Note: This manuscript has been previously reviewed at another journal that is not operating a transparent peer review scheme. This document only contains reviewer comments and rebuttal letters

More information

Optimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion

Optimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion SUPPLEMENTARY FIGURE 1. Optimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion mixture was incubated at 37 C for 0 to 120 minutes. The cutting was nearly complete

More information

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Genome-scale engineering of Saccharomyces cerevisiae with single nucleotide precision Zehua Bao, 1 Mohammad HamediRad, 2 Pu Xue, 2 Han Xiao, 1,7 Ipek Tasan, 3 Ran Chao, 2 Jing

More information

substrate with ri was incubated with endonuclease V enzymes (25 nm) in buffers with varying ph (7.5-

substrate with ri was incubated with endonuclease V enzymes (25 nm) in buffers with varying ph (7.5- Supplementary information Effect of ph, Mg 2+ and Mn 2+ concentrations on endonuclease V activity. (a) Single-stranded RNA substrate with ri was incubated with endonuclease V enzymes (25 nm) in buffers

More information

Please write your name or student ID number on every page.

Please write your name or student ID number on every page. MCB 110 First Exam A TOTAL OF SIX PAGES NAME: Student ID Number: Question Maximum Points Your Points I 36 II 35 III 27 IV 28 V 24 150 Please write your name or student ID number on every page. This exam

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I

More information

Mammalian Abasic Site Base Excision Repair

Mammalian Abasic Site Base Excision Repair THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 273, No. 33, Issue of August 14, pp. 21203 21209, 1998 Printed in U.S.A. Mammalian Abasic Site Base Excision Repair IDENTIFICATION OF THE REACTION SEQUENCE AND

More information

Supplementary Figure 1. Analysis of replication rates by Pol. Nature Structural & Molecular Biology: doi: /nsmb.3207

Supplementary Figure 1. Analysis of replication rates by Pol. Nature Structural & Molecular Biology: doi: /nsmb.3207 Supplementary Figure 1 Analysis of replication rates by Pol (a) Electrophoretic Mobility Shift Assay (EMSA) of Pol -DV binding to template-primer DNA (Fried, M. & Crothers, D.M. Equilibria and kinetics

More information

Methods (detailed). for all the experiments. Cells were grown in 50 ml YEA. The cells were harvested and

Methods (detailed). for all the experiments. Cells were grown in 50 ml YEA. The cells were harvested and Methods (detailed). Purification of yeast chromosomal DNA. Strain JZ105 (mat1m Δmat2,3::LEU2, ade6-210, leu1-32, ura4-d18, his2) was used for all the experiments. Cells were grown in 50 ml YEA. The cells

More information

RFC 38: Building Blocks - Standard Large DNA/Genome Construction. Jef Boeke, James DiCarlo. 7 October 2009

RFC 38: Building Blocks - Standard Large DNA/Genome Construction. Jef Boeke, James DiCarlo. 7 October 2009 RFC 38: Building Blocks - Standard Large DNA/Genome Construction Jef Boeke, James DiCarlo 7 October 2009 1. Purpose The physical assembly of standard parts is currently a non-standard process, which can

More information

* + * RecA * + + for RecA-dependent strand + + MIT Department of Biology 7.28, Spring Molecular Biology

* + * RecA * + + for RecA-dependent strand + + MIT Department of Biology 7.28, Spring Molecular Biology MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 1) Question 1. 1A. You are studying the function of in vitro along with a lab partner. You run several reactions to examine the requirements

More information

Supplemental Information

Supplemental Information Supplemental Information ATP-dependent unwinding of U4/U6 snrnas by the Brr2 helicase requires the C-terminus of Prp8 Corina Maeder 1,3, Alan K. Kutach 1,2,3, and Christine Guthrie 1 1 Department of Biochemistry

More information

Chapter 9 Preview - DNA

Chapter 9 Preview - DNA Chapter 9 Preview - DNA Multiple Choice Identify the choice that best completes the statement or answers the question. 1. In order to show that DNA in cell extracts is responsible for genetic transformation

More information

DNA Replication in Prokaryotes and Eukaryotes

DNA Replication in Prokaryotes and Eukaryotes DNA Replication in Prokaryotes and Eukaryotes 1. Overall mechanism 2. Roles of Polymerases & other proteins 3. More mechanism: Initiation and Termination 4. Mitochondrial DNA replication DNA replication

More information

III. Detailed Examination of the Mechanism of Replication A. Initiation B. Priming C. Elongation D. Proofreading and Termination

III. Detailed Examination of the Mechanism of Replication A. Initiation B. Priming C. Elongation D. Proofreading and Termination Outline for Replication I. General Features of Replication A. Semi-Conservative B. Starts at Origin C. Bidirectional D. Semi-Discontinuous II. Proteins and Enzymes of Replication III. Detailed Examination

More information

Site-directed Mutagenesis

Site-directed Mutagenesis Site-directed Mutagenesis Applications Subtilisin (Met à Ala mutation resistant to oxidation) Fluorescent proteins Protein structure-function Substrate trapping mutants Identify regulatory regions/sequences

More information

Regulation of ARE transcript 3 end processing by the. yeast Cth2 mrna decay factor

Regulation of ARE transcript 3 end processing by the. yeast Cth2 mrna decay factor Regulation of ARE transcript 3 end processing by the yeast Cth2 mrna decay factor Manoël Prouteau, Marie-Claire Daugeron and Bertrand Séraphin Supplementary Information Material and Methods Plasmid construction

More information

Vicinal abasic site Impair processing of Tg:G Mismatch and 8- Oxoguanine Lesions in Three-Component Bistranded Clustered DNA Damage

Vicinal abasic site Impair processing of Tg:G Mismatch and 8- Oxoguanine Lesions in Three-Component Bistranded Clustered DNA Damage Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 Vicinal abasic site Impair processing of Tg:G Mismatch and 8- Oxoguanine Lesions in Three-Component

More information

SUPPLEMENTAL MATERIAL. Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to

SUPPLEMENTAL MATERIAL. Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to SUPPLEMENTAL MATERIAL Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to 6. SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Overview of the mechanisms by which

More information

Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1

Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1 6774 6786 Nucleic Acids Research, 2012, Vol. 40, No. 14 Published online 7 May 2012 doi:10.1093/nar/gks388 Biochemical analyses indicate that binding and cleavage specificities define the ordered processing

More information

CircLigase II ssdna Ligase

CircLigase II ssdna Ligase Cat. Nos. CL9021K and CL9025K www.lucigen.com MA298E-CircLigase II ssdna Ligase 2/2018 1 1. Introduction CircLigase II ssdna Ligase is a thermostable ligase that catalyzes iintramolecular ligation (i.e.,

More information

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.

More information

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega

More information

A Guide to CRISPR/Cas9

A Guide to CRISPR/Cas9 Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse

More information

Lecture 22: Molecular techniques DNA cloning and DNA libraries

Lecture 22: Molecular techniques DNA cloning and DNA libraries Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived

More information

T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis Viollet et al. BMC Biotechnology 211, 11:72 http://www.biomedcentral.com/1472-6/11/72 RESEARCH ARTICLE Open Access T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis Sebastien

More information

DNA Replication II Biochemistry 302. Bob Kelm January 28, 2004

DNA Replication II Biochemistry 302. Bob Kelm January 28, 2004 DNA Replication II Biochemistry 302 Bob Kelm January 28, 2004 Conceptual model for proofreading based on kinetic considerations Fig. 24.44 stalling transient melting exonuclease site occupancy Following

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Proofreading, post-replication modification of DNA. Mitesh Shrestha

Proofreading, post-replication modification of DNA. Mitesh Shrestha Proofreading, post-replication modification of DNA Mitesh Shrestha Proofreading During DNA replication (copying), most DNA polymerases can check their work with each base that they add. This process is

More information

DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli

DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Supplementary Information DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Geraldine Fulcrand 1,2, Samantha Dages 1,2, Xiaoduo Zhi 1,2, Prem Chapagain

More information

Mechanisms of DNA Synthesis

Mechanisms of DNA Synthesis Mechanisms of DNA Synthesis Biochemistry 201 Advanced Molecular Biology January 19, 2000 Doug Brutlag Introduction Today's topic concerns the fundamental mechanism of DNA replication as exemplified by

More information

CircLigase II ssdna Ligase

CircLigase II ssdna Ligase Cat. Nos. CL9021K and CL9025K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 298 12/2012 1 EPILIT298

More information

CircLigase ssdna Ligase

CircLigase ssdna Ligase Cat. Nos. CL4111K and CL4115K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 222 10/2012 1 EPILIT222

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

PCR Amplifies Targeted Sequence

PCR Amplifies Targeted Sequence PCR Amplifies Targeted Sequence Target Sequence Supercoiled DNA Strand DNA Strand Double Helix DNA Strand Chromosome P C R PCR PCR = Polymerase Chain Reaction. A primer directed-extension reaction for

More information

CFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1

CFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1 A. B. 4.0 3.0 2.0 1.0 4.0 3.0 2.0 1.0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Probe: Neo R CFTR-null wt CFTR-null Figure S1 A. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 10kb 8kb CFTR-null wt B. Probe: CFTR

More information

PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ

PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ Supplementary Material Figure S1. PDIP46 is associated with Pol isolated by immunoaffinity chromatography.

More information

DNA SEQUENCING BY SANGER METHOD

DNA SEQUENCING BY SANGER METHOD DNA SEQUENCING BY SANGER METHOD First method described by Sanger and Coulson,1975 for DNA sequencing was called plus and minus. This method used E.coli DNA polymerase I and DNA ploymerase from bacteriophage

More information

CGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS

CGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS 5 CGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS 29 Supplementary Figure 1 Sequence of the DNA primer/template pair used in Figure 1bc. A 23nt primer is

More information

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes

More information

University of Groningen

University of Groningen University of Groningen Coupling dttp Hydrolysis with DNA Unwinding by the DNA Helicase of Bacteriophage T7 Satapathy, Ajit K.; Kulczyk, Arkadiusz W.; Ghosh, Sharmistha; van Oijen, Antonius; Richardson,

More information

Supplementary Information for:

Supplementary Information for: Supplementary Information for: A streamlined and high-throughput targeting approach for human germline and cancer genomes using Oligonucleotide-Selective Sequencing Samuel Myllykangas 1, Jason D. Buenrostro

More information

Chapter 11 DNA Replication and Recombination

Chapter 11 DNA Replication and Recombination Chapter 11 DNA Replication and Recombination Copyright Copyright 2009 Pearson 2009 Pearson Education, Education, Inc. Inc. 11.1 DNA is reproduced by Semiconservative Replication The complementarity of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1895 i Core histones CAF-1 v ii Reb1 CAF-1 Fen1 vi Mature Okazaki fragment iii PCNA Reb1 iv vii Mature Okazaki fragment Reb1 Mature Okazaki fragments Figure S1. Model for nucleosome-mediated

More information

Electronic Supplementary Information. Simultaneously sensitive detection of multiple DNA glycosylases from lung

Electronic Supplementary Information. Simultaneously sensitive detection of multiple DNA glycosylases from lung Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Simultaneously sensitive detection of multiple DNA

More information

MIDTERM I NAME: Student ID Number: I 32 II 33 III 24 IV 30 V

MIDTERM I NAME: Student ID Number: I 32 II 33 III 24 IV 30 V MIDTERM I NAME: Student ID Number: Question Maximum Points Your Points I 32 II 33 III 24 IV 30 V 31 150 Please write your name/student ID number on each of the following five pages. This exam must be written

More information

Chapter 16 DNA: The Genetic Material. The Nature of Genetic Material. Chemical Nature of Nucleic Acids. Chromosomes - DNA and protein

Chapter 16 DNA: The Genetic Material. The Nature of Genetic Material. Chemical Nature of Nucleic Acids. Chromosomes - DNA and protein Chapter 16 DNA: The Genetic Material The Nature of Genetic Material Chromosomes - DNA and protein Genes are subunits DNA = 4 similar nucleotides C(ytosine) A(denine) T(hymine) G(uanine) Proteins = 20 different

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange.

The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. RNA PROCESSING The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. Splicing can occur either before or after

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature18622 Supplementary Discussion Discussion of prior work on NCIN hypothesis. An early study reported incorporation of NAD + into initial products by E. coli RNAP

More information

MCB 110 SP 2005 Second Midterm

MCB 110 SP 2005 Second Midterm MCB110 SP 2005 Midterm II Page 1 ANSWER KEY MCB 110 SP 2005 Second Midterm Question Maximum Points Your Points I 40 II 40 III 36 IV 34 150 NOTE: This is my answer key (KC). The graders were given disgression

More information

Chapter 20 Biotechnology

Chapter 20 Biotechnology Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the

More information

An overhang-based DNA block shuffling method for creating a customized random library

An overhang-based DNA block shuffling method for creating a customized random library An overhang-based DNA block shuffling method for creating a customized random library Kosuke Fujishima, Chris Venter, Kendrick Wang, Raphael Ferreira and Lynn J. Rothschild Supplementary figures and text:

More information

Fundamentals of Real Time PCR

Fundamentals of Real Time PCR Fundamentals of Real Time PCR Mohamed Abdel Fattah Senior Technical Specialist Scientific Support - Molecular Biology Dept. AnalysisAB Co. Mobile: 012 27 906 74 E-mail: analysis@analysis-ab.com What is

More information

Construct Design and Cloning Guide for Cas9-triggered homologous recombination

Construct Design and Cloning Guide for Cas9-triggered homologous recombination Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner

More information

DNA REPLICATION. Anna Onofri Liceo «I.Versari»

DNA REPLICATION. Anna Onofri Liceo «I.Versari» DNA REPLICATION Anna Onofri Liceo «I.Versari» Learning objectives 1. Understand the basic rules governing DNA replication 2. Understand the function of key proteins involved in a generalised replication

More information

Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a

Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a HNH-state 1 in PDB 4OO8, in which the distance from the C atom of the HNH catalytic residue 840 to the

More information

Kinetic Mechanism of Human DNA Ligase I Reveals Magnesium-dependent Changes in the Rate-limiting Step That Compromise Ligation Efficiency*

Kinetic Mechanism of Human DNA Ligase I Reveals Magnesium-dependent Changes in the Rate-limiting Step That Compromise Ligation Efficiency* THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 26, pp. 23054 23062, July 1, 2011 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Kinetic Mechanism of

More information

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying

More information

Welcome to Class 18! Lecture 18: Outline and Objectives. Replication is semiconservative! Replication: DNA DNA! Introductory Biochemistry!

Welcome to Class 18! Lecture 18: Outline and Objectives. Replication is semiconservative! Replication: DNA DNA! Introductory Biochemistry! Lecture 18: Outline and Objectives Welcome to Class 18! Introductory Biochemistry! l DNA Replication! l DNA polymerase! l the enzymatic reaction! l proofreading and accuracy! l DNA synthesis! l origins

More information

(56) References cited:

(56) References cited: (19) TEPZZ 4488B_T (11) EP 2 4 488 B1 (12) EUROPEAN PATENT SPECIFICATION (4) Date of publication and mention of the grant of the patent: 07.06.17 Bulletin 17/23 (21) Application number: 1726. (1) Int Cl.:

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

The Leu22Pro tumor-associated variant of DNA polymerase beta is drp lyase deficient

The Leu22Pro tumor-associated variant of DNA polymerase beta is drp lyase deficient Published online 26 November 2007 Nucleic Acids Research, 2008, Vol. 36, No. 2 411 422 doi:10.1093/nar/gkm1053 The Leu22Pro tumor-associated variant of DNA polymerase beta is drp lyase deficient Shibani

More information

human Cdc45 Figure 1c. (c)

human Cdc45 Figure 1c. (c) 1 Details of the refined crystallographic model of human Cdc45 and comparison of its active-site region with that of bacterial RecJ. (a) Stereo view of a representative example of the final 2F o -F c electron

More information

MCB 110 First Midterm SIX PAGES

MCB 110 First Midterm SIX PAGES MCB 110 First Midterm SIX PAGES NAME: SID Number: Question Maximum Points Your Points I 27 II 32 III 35 IV 33 V 24 151 This exam must be written in PEN if you want the option of a regrade. DO NOT USE WHITE

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

BEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS

BEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS BEST QUALITY HIGHEST PURITY Recombinant ENZYMES & PROTEINS We offer a wide range of highest quality enzymes and proteins for molecular biology including DNA polymerases, reverse transcriptases, DNA ligases,

More information

Bacterial DNA replication

Bacterial DNA replication Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems

More information

DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA

DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures

More information

4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.

4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e. 1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.

More information

All This For Four Letters!?! DNA and Its Role in Heredity

All This For Four Letters!?! DNA and Its Role in Heredity All This For Four Letters!?! DNA and Its Role in Heredity What Is the Evidence that the Gene Is DNA? By the 1920s, it was known that chromosomes consisted of DNA and proteins. A new dye stained DNA and

More information

Thebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 2.3 Genomes and gene technologies Answers

Thebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 2.3 Genomes and gene technologies Answers Thebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 2.3 Genomes and gene technologies Answers Andy Todd 1 1. (i) plasmid cut by restriction enzyme; at specific sequence; same

More information

DNA polymerase proofreading: active site switching catalyzed by the bacteriophage T4 DNA polymerase

DNA polymerase proofreading: active site switching catalyzed by the bacteriophage T4 DNA polymerase 5452 5463 Nucleic Acids Research, 2007, Vol. 35, No. 16 Published online 15 August 2007 doi:10.1093/nar/gkm591 DNA polymerase proofreading: active site switching catalyzed by the bacteriophage T4 DNA polymerase

More information

Combinatorial Evolution of Enzymes and Synthetic pathways Using

Combinatorial Evolution of Enzymes and Synthetic pathways Using Supplementary data Combinatorial Evolution of Enzymes and Synthetic pathways Using One-Step PCR Peng Jin,, Zhen Kang,,, *, Junli Zhang,, Linpei Zhang,, Guocheng Du,, and Jian Chen, The Key Laboratory of

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

In vitro mutagenesis

In vitro mutagenesis Core course BMS361N Genetic Engineering In vitro mutagenesis Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University In vitro mutagenesis Many

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

Mycobacterium tuberculosis (Mtb) and Mycobacterium smegmatis (Msmeg) contain two ε (dnaq) exonuclease homologs.

Mycobacterium tuberculosis (Mtb) and Mycobacterium smegmatis (Msmeg) contain two ε (dnaq) exonuclease homologs. Supplementary Figure 1 Mycobacterium tuberculosis (Mtb) and Mycobacterium smegmatis (Msmeg) contain two ε (dnaq) exonuclease homologs. (a) Sequence alignment of the ε-exonuclease homologs from four different

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Schwarz UI, Ritchie MD, Bradford Y, et al. Genetic determinants

More information

Supplementary Information

Supplementary Information Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Information Ultrasensitive quantification of mature micrornas by real-time PCR based on ligation of ribonucleotide-modified DNA probe Jiangyan Zhang, Zhengping Li,* Hui Wang, Yucong

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

Influence of tlp5, che1p, tlp4a, and che4stas Promoters on Chemotaxis in Azospirillum brasilense

Influence of tlp5, che1p, tlp4a, and che4stas Promoters on Chemotaxis in Azospirillum brasilense University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2015 Influence of tlp5, che1p,

More information

Directe d Mutagenesis

Directe d Mutagenesis Directe d Mutagenesis A Practical Approac h M. J. McPHERSON 1. Mutagenesis facilitated by the removal or introduction of unique restriction sites 1 P. Carte r 1. Introduction to site-directed mutagenesis

More information

supplementary information

supplementary information DOI: 10.1038/ncb2007 Figure S1 Temperature sensitivity of DNA ligase I alleles. a, SSL204 (CDC9), SSL612 (cdc9-1) and SSL613 (cdc9-2) cells were spotted in ten-fold serial dilutions on YPD plates and incubated

More information

Sequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps

Sequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps Supporting information Sequencing of DNA lesions facilitated by site-specific excision via base excision repair DNA glycosylases yielding ligatable gaps Jan Riedl, Aaron M. Fleming, and Cynthia J. Burrows*

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction

More information

Supporting Information

Supporting Information Supporting Information Deng et al. 10.1073/pnas.1102117108 Fig. S1. Predicted structure of Arabidopsis bzip60 RNA. Lowest free energy form (ΔG = 309.72 (initially 343.10) of bzip60 mrna folded by M-Fold

More information

TwistAmp DNA Amplification Kits Assay Design Manual

TwistAmp DNA Amplification Kits Assay Design Manual TM Unwind DNA s possibilities TwistAmp DNA Amplification Kits Assay Design Manual Contents 1. Assay Considerations 3 1.1 Reaction temperature 3 1.2 Quantification and amplification onset 3 1.3 Preventing

More information

Information on barcode decoding

Information on barcode decoding Information on barcode decoding The Bioneer version 1.0 haploid deletion library (Bioneer catalog number M-1030H) was supplied as glycerol frozen stocks in thirty-one 96-well plates. According to the information

More information