SUPPLEMENTARY WEB MATERIAL

Size: px
Start display at page:

Download "SUPPLEMENTARY WEB MATERIAL"

Transcription

1 SUPPLEMENTARY WEB MATERIAL Rapid effector memory CD8+ T cell function requires an immediate-early glycolytic switch Patrick M. Gubser 1, Glenn R. Bantug 1, Leyla Razik, Marco Fischer, Sarah Dimeloe, Gideon Hoenger, Bojana Durovic, Annaïse Jauch & Christoph Hess 1 These authors contributed equally to this work 1

2 SUPPLEMENTARY FIGURES Supplementary Figure 1. Sorting strategy for CD8 + T cell populations. a, Representative dot plot of fresh isolated CD8 + T cells stained for CD45RA and CCR7. Four CD8 + T cell subpopulations are identified as follows: naïve (CCR7 + CD45RA + ), central memory (CM, CCR7 + CD45RA neg ), effector memory (EM, CCR7 neg CD45RA neg ) and CD45RA re-expressing EM (EMRA, CCR7 neg CD45RA + ). Values represent frequency of total gated events. b-c, Representative dot plots of naïve (b) and EM (c) CD8 + T cell subsets sorted by FACS (purity always greater than 95%). d, Representative dot plot of fresh isolated CD8 + T cells stained for CD45RA and CD62L (different donor than in (a)). As above, four CD8 + T cell subpopulations are identified as follows: naïve (CD62L + CD45RA + ), CM (CD62L + CD45RA neg ), EM (CD62L neg CD45RA neg ) and EMRA (CD62L neg CD45RA + ). Values represent frequency of total gated events. e-f, Representative dot plots of CM (e) and EM (f) CD8 + T cell subsets sorted by FACS (purity always greater than 95%). Values represent frequency of total gated events. 2

3 Supplementary Figure 2. Schematic diagram of OCR and ECAR profiles as generated by the Seahorse extracellular flux analyzer. a, Schematic OCR time course under basal conditions and following perturbation of mitochondrial respiration with oligomycin, DNP and rotenone. Using this perturbation profiling technique, four OCR rates are directly measured: the non-corrected basal OCR [OCR(basal-nc)], the rate following inhibition of ATP synthase [OCR(oligomycin)], the peak rate following mitochondrial uncoupling [OCR(peak-DNP)], and the rate following inhibition of mitochondrial respiration [OCR(rotenone)]. The following respiratory parameters (indicated by red double-ended arrows in the diagram) are calculated using the formulas below: (1) basal respiration = [OCR(basal-nc)] [OCR(rotenone)] (2) ATP coupled respiration = [OCR(basal-nc)] [OCR(oligomycin)] (3) leak respiration = [OCR(oligomycin)] [OCR(rotenone)] (4) maximal respiratory capacity = [OCR(peak-DNP)] [OCR(rotenone)] (5) spare respiratory capacity = [OCR(peak-DNP)] [OCR(basal-nc)] (6) non-mitochondrial respiration = OCR(rotenone) b, Schematic ECAR time course under basal conditions and following inhibition of mitochondrial respiration. Basal ECAR is the initial rate measured by the extracellular flux analyzer. The maximal ECAR is the rate following addition of rotenone. Red double-ended arrows in the diagram indicate the respective glycolytic parameters. 3

4 Supplementary Figure 3. Calculated respiratory parameters of naïve and EM CD8 + T cells. a-c, Key respiratory parameters were calculated following perturbation of mitochondrial function with oligomycin, DNP, and rotenone. Graphs show (a) ATPcoupled respiration, (b) leak respiration and (c) non-mitochondrial respiration of naïve and EM CD8 + T cells (n = 6 separate donors, paired two-tailed Student's t-test). Supplementary Figure 4. CD28 expression on naïve and EM CD8 + T cells. a, Representative histograms of naïve (red) and EM (blue) CD8 + T cells stained for cellsurface expression of CD28. b, Graph of CD28 mean fluorescence intensities from both subsets (n = 9). c, Bar graph showing frequencies of CD28 positive cells in both subpopulations (n = 7, ± s.d.). 4

5 Supplementary Figure 5. Incubation of naïve and EM CD8 + T cells with isotype control mab and anti-cd28 mab did not induce glycolytic switch. ECAR of naïve ( ) and EM ( ) CD8 + T cells following in-seahorse stimulation with isotype control mab (2 µg/ml) and anti-cd28 (20 µg/ml) mab (means ± s.e.m.). Representative of 3 independent experiments (separate donors). Supplementary Figure 6. Long-term treatment with rapamycin diminishes activation induced, glycolytic switch in CD8 + T cells. a-b, Representative mean ECAR of activated CD8 + T cells. (a) Naïve and (b) EM CD8 + T cells were activated with anti- CD3 mab (1 µg/ml) and anti-cd28 mab (10 µg/ml), or left unstimulated for 3 days and then processed for Seahorse. After measuring basal ECAR, cells were in-seahorse restimulated with anti-cd3 and anti-cd28 mab (as above), followed by treatment with 25 mm 2-DG at approximately 300 minutes post-mab injection. Non-activated (, ), anti-cd3 and anti-cd28 mab activated (, ), and anti-cd3 and anti-cd28 mab plus 20 ng/ml rapamycin (, ). Open and closed symbols represent naïve and EM CD8 + T cells, respectively. Representative of 2 experiments (separate donors). 5

6 Supplementary Figure 7. Impact of Akt-inhibition on cytoplasmic GAPDH expression in non-activated and activated EM CD8 + T cells. Graphic summary of cytoplasmic GAPDH fluorescence intensity in CD8 + T cells under non-activating conditions incubated in presence and absence of 10 µm Akti 1-2, and following stimulation with anti-cd3 (2 µg/ml) and anti-cd28 (20 µg/ml) mab for 2 h in presence and absence of 10 µm Akti 1-2 (n = 3 separate donors, from all donors a total of n = 35 [non-activated], n = 57 [non-activated; Akti 1-2 treated], n = 62 [activated], n = 77 [activated; Akti 1-2 treated] EM CD8 + T cells were analyzed, error bars = s.e.m., Man- Whitney U-test). *P<0.001 Supplementary Figure 8. Relative contribution of TCR- and CD28-signaling to immediate-early IFN-γ production of EM CD8 + T cells. IFN-γ was quantified in the supernatant of EM CD8 + T cells incubated for 12 h under non-activating conditions, or with isotype for anti-cd3 (0.2 µg/ml) plus anti-cd28 mab (20 µg/ml); anti-cd3 mab alone (0.2 µg/ml); or anti-cd3 plus anti-cd28 mab (0.2 and 20 µg/ml) (n = 3 separate donors, error bars = s.e.m., paired two-tailed Student's t-test). *P<0.05 6

isolated from ctr and pictreated mice. Activation of effector CD4 +

isolated from ctr and pictreated mice. Activation of effector CD4 + Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via

More information

Performing Bioenergetic Analysis:

Performing Bioenergetic Analysis: icell Neurons Application Protocol Performing Bioenergetic Analysis: XF96 Extracellular Flux Analyzer Introduction Neurons are highly metabolic cells that heavily depend on mitochondrial function for cell

More information

Nature Biotechnology: doi: /nbt.4086

Nature Biotechnology: doi: /nbt.4086 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3

More information

Supplementary Figure 1. Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect

Supplementary Figure 1. Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect Supplementary Figure 1 Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect integrin extension (E + ) and mab24 (green) can specifically detect headpiece-opening

More information

Shirihai Lab Protocol for the study of oxygen consumption in isolated mitochondria

Shirihai Lab Protocol for the study of oxygen consumption in isolated mitochondria Shirihai Lab Protocol for the study of oxygen consumption in isolated mitochondria This protocol was written Dr. Marc Liesa. You may contact Dr. Liesa at Liesa@bu.edu This protocol has been established

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells

Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes

More information

Seahorse XF e Extracellular Flux Analyzers CELL METABOLISM REVEALED

Seahorse XF e Extracellular Flux Analyzers CELL METABOLISM REVEALED Seahorse XF e Extracellular Flux Analyzers CELL METABOLISM REVEALED I XF e... THE WORLD S MOST ADVANCED With an understanding of cell metabolism the process by which cells produce and consume GLYCOLYSIS

More information

Seahorse XF e Extracellular Flux Analyzers. CELL METABOLISM re v EALEd

Seahorse XF e Extracellular Flux Analyzers. CELL METABOLISM re v EALEd Seahorse XF e Extracellular Flux Analyzers CELL METABOLISM re v EALEd X F e... t h E W o r l d S m o S t A d va n c E d With an understanding of cell metabolism the process by which cells produce and consume

More information

Supporting Information

Supporting Information (xe number cells) LSK (% gated) Supporting Information Youm et al../pnas. SI Materials and Methods Quantification of sjtrecs. CD + T subsets were isolated from splenocytes using mouse CD + T cells positive

More information

Supporting Information. Exploiting CD22 to Selectively Tolerize Autoantibody Producing B-cells in. Rheumatoid Arthritis

Supporting Information. Exploiting CD22 to Selectively Tolerize Autoantibody Producing B-cells in. Rheumatoid Arthritis Supporting Information Exploiting CD22 to Selectively Tolerize Autoantibody Producing B-cells in Rheumatoid Arthritis Kyle J. Bednar 1,2, Corwin M. Nycholat 3, Tadimeti S. Rao 1, James C. Paulson 2,3,

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from

More information

Supporting Information

Supporting Information Supporting Information Table S1. Overview of samples used for sequencing, and the number of sequences obtained from each sample. Visit 1 is day 0, Visit 2 is day 7, Visit 3 is day 28, and Visit 4 is day

More information

Supplementary Figure 1 Activated B cells are subdivided into three groups

Supplementary Figure 1 Activated B cells are subdivided into three groups Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation

More information

Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE1 through. Akt/ROCK1 to stimulate cell motility.

Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE1 through. Akt/ROCK1 to stimulate cell motility. Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE through Akt/ROCK to stimulate cell motility. Authors : Monet Michael, Poët Mallorie, Tauzin Sébastien 2,#, Fouqué Amélie 3, Cophignon

More information

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2

More information

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,

More information

User Manual XF cell mito stress test kit for research use only

User Manual XF cell mito stress test kit for research use only User Manual XF cell mito stress test kit for research use only XF96 Instructions www.seahorsebio.com Part #: 102308-400 Rev. A This page intentionally left blank Preface Copyright 2012 Seahorse Bioscience

More information

B. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.

B. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor. DMSO Staurosporine BGT226 A. B. C. BGT226 P-Akt 0 1 2 4 8 hrs. P-Akt 0 5 10 25 50 100 nm PS6 P-4E-BP1 -actin C-Caspase3 -actin PS6 P-4E-BP1 -actin Suppl. Fig. 1 and BGT226 inhibit phosphorylation of Akt

More information

No wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)

No wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%) Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human

More information

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN CD CD11 + CD + CD11 d g CD CD11 + CD + CD11 CD + CD11 + Events (% of max) Events (% of max) CD + CD11 Events (% of max) Spleen CLN MLN Irf fl/fl e Irf fl/fl h Irf fl/fl DC enriched CD CD11 Spleen DC enriched

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min

More information

Human retinoic acid regulated CD161 + regulatory T cells support wound repair in intestinal mucosa

Human retinoic acid regulated CD161 + regulatory T cells support wound repair in intestinal mucosa SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41590-018-0230-z In the format provided by the authors and unedited. Human retinoic acid regulated CD161 + regulatory T cells support wound repair

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin

More information

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low

More information

Supporting Information for. Bongseo Choi, 1, Hyojin Moon, 1, Sung Joon Hong, 1 Changsik Shin, 1 Yoonkyung Do, 1 Seongho Ryu, 2,* Sebyung Kang 1,*

Supporting Information for. Bongseo Choi, 1, Hyojin Moon, 1, Sung Joon Hong, 1 Changsik Shin, 1 Yoonkyung Do, 1 Seongho Ryu, 2,* Sebyung Kang 1,* Supporting Information for Effective Delivery of Antigen-Encapsulin Nanoparticle Fusions to Dendritic Cells Leads to Antigen-Specific Cytotoxic T Cell Activation and Tumor Rejection Bongseo Choi, 1, Hyojin

More information

Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative

Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative RT-PCR For CD8-1 transcript, forward primer CD8-1F 5 -TAGTAACCAGAGGCCGCAAGA-3 reverse primer CD8-1R 5 -TCTACTAAGGTGTCCCATAGCATGAT-3

More information

Nature Immunology: doi: /ni.3101

Nature Immunology: doi: /ni.3101 Supplementary Figure 1 Generation of Plvap / mice. (a) Schematic presentation of the targeting construct as well as the wild-type and targeted Plvap alleles]. PuroR, puromycin resistance. The location

More information

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells

More information

Supplementary figures

Supplementary figures Mucida et al. Supplementary material Supplementary figures Supplementary Figure 1. Oral administration of OVA suppresses Th2 differentiation, Germinal Center (GC) formation and immunoglobulin class switching

More information

Nature Medicine doi: /nm.3554

Nature Medicine doi: /nm.3554 SUPPLEMENTARY FIGURES LEGENDS Supplementary Figure 1: Generation, purification and characterization of recombinant mouse IL-35 (ril-35). High-Five insect cells expressing high levels of the bicistronic

More information

Supplementary Methods Antibodies for flow cytometry Cytotoxicity assay

Supplementary Methods Antibodies for flow cytometry Cytotoxicity assay Supplementary Methods Antibodies for flow cytometry HLA-Cw3 and CD2 expression: LCL 72.22 cell lines were stained with anti-hla-abc-apc (clone G46-2.6, BD) or migg-apc (clone MOPC-2, BD) antibody, or with

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune

More information

SOM 1 *** *** *** * * n.s GFP + (NK 10 4 ) Naive DNFB OXA. Donor sensitization: Naive OXA DNFB 1,200 6,000 4,000

SOM 1 *** *** *** * * n.s GFP + (NK 10 4 ) Naive DNFB OXA. Donor sensitization: Naive OXA DNFB 1,200 6,000 4,000 SOM 1 a n.s. 4. 3. GFP + (NK 1 4 ) 2. 1.. Naive DNFB OXA splenic NK hepatic NK b Donor sensitization: Naive OXA DNFB NK cells (% of CD45 + 1 5 ) 1,2 9 6 3 NK cells (% of CD45 + 1 5 ) 6, 4, 2, 24 48 72

More information

Supplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.

Supplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization. Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter

More information

Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation

Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation *Silvia Laura Locatelli, 1 Giuseppa Careddu, 1 Giuliano Giuseppe Stirparo, 1 Luca Castagna,

More information

Supplemental Table 1 Primers used in study. Human. Mouse

Supplemental Table 1 Primers used in study. Human. Mouse Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc

More information

supplementary information

supplementary information DOI: 10.1038/ncb1977 Figure S1 a. Immunofluorescence analysis of IFT20 localization in PBL costained with anti-β-tubulin antibodies. b. Immunofluorescence analysis of IFT20 localization in Jurkat cells,

More information

A 3D human triculture system modeling neurodegeneration and neuroinflammation in Alzheimer s disease

A 3D human triculture system modeling neurodegeneration and neuroinflammation in Alzheimer s disease SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0175-4 In the format provided by the authors and unedited. A 3D human triculture system modeling neurodegeneration and neuroinflammation

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices.

Nature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices. Supplementary Figure 1 Time course of OT-II T reg cell development in thymic slices. Time course of T reg cell development following addition of OT-II TCR transgenic Rag2 -/- mice (OT-II) thymocytes to

More information

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion

More information

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

More information

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence

More information

SI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers

SI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers SI Appendix Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for adoptive immunotherapy of cancers Yong Lu, Bangxing Hong, Haiyan Li, Yuhuan Zheng, Mingjun Zhang, Siqing Wang, Jianfei

More information

Albumin. MMP-9 (tertiary granules) Lactoferrin. MPO (U/ml) ctrl PMN-sec

Albumin. MMP-9 (tertiary granules) Lactoferrin. MPO (U/ml) ctrl PMN-sec Figure S1: Antibody cross-linking of CD18 induces release of primary, secondary, and tertiary granules as well as secretory vesicles. Freshly isolated PMN were incubated with primary anti-cd18 mab IB4

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/282/ra53/dc1 Supplementary Materials for Estrogen Alters the Splicing of Type 1 Corticotropin-Releasing Hormone Receptor in Breast Cancer Cells Suchita Lal,

More information

Interferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information

Interferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information Supplementary Information Interferon- -producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections Takayuki Matsumura, Manabu Ato, Tadayoshi Ikebe, Makoto

More information

Supplementary Figures Supplementary Figure 1

Supplementary Figures Supplementary Figure 1 Supplementary Figures Supplementary Figure 1 Supplementary Figure 1 COMSOL simulation demonstrating flow characteristics in hydrodynamic trap structures. (a) Flow field within the hydrodynamic traps before

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Microarray Data Analysis Gene expression data were obtained by hybridising a total of 24 samples from 6 experimental groups (n=4 per group) to Illumina HumanHT-12 Expression BeadChips.

More information

SUPPLEMENTARY DATA. Supplementary Figure 1.

SUPPLEMENTARY DATA. Supplementary Figure 1. Supplementary Figure 1. 31 P NMR spectra demonstrating full conversion of ATP into ADP with concurrent conversion of 2DOG into 2DOGP. (A) 0.85 mm ATP in a buffer containing 5 mm KH 2 PO 4, 120 mm KCl,

More information

Nature Immunology: doi: /ni.3694

Nature Immunology: doi: /ni.3694 Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular

More information

Table S1. Antibodies and recombinant proteins used in this study

Table S1. Antibodies and recombinant proteins used in this study Table S1. Antibodies and recombinant proteins used in this study Labeled Antibody Clone Cat. no. Streptavidin-PerCP BD Biosciences 554064 Biotin anti-mouse CD25 7D4 BD Biosciences 553070 PE anti-mouse

More information

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

(a) Immunoblotting to show the migration position of Flag-tagged MAVS Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1 Supplementary Figure 1 Scheme of isolating broadly neutralizing Abs against influenza viruses from human memory B cell repertoire. Representative fluorescence-labeled

More information

Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining Western blotting RT-PCR

Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining Western blotting RT-PCR Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining The capability of cells, either PBMC or purified T- cell lines, to inhibit parasite growth or merozoite

More information

Figure S1 is related to Figure 1B, showing more details of outer segment of

Figure S1 is related to Figure 1B, showing more details of outer segment of Supplemental Information Supplementary Figure legends and Figures Figure S1. Electron microscopic images in Sema4A +/+ and Sema4A / retinas Figure S1 is related to Figure 1B, showing more details of outer

More information

The presence of T cell epitopes is important for induction of antibody

The presence of T cell epitopes is important for induction of antibody The presence of T cell epitopes is important for induction of antibody responses against antigens directed to DEC25 + dendritic cells Kelly N. S. Amorim, Eline V. Rampazo, Renan Antonialli, Marcio M. Yamamoto,

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1: Over-expression of CD300f in NIH3T3 cells enhances their capacity to phagocytize AC. (a) NIH3T3 cells were stably transduced by EV, CD300f WT or CD300f

More information

Representative flow cytometry scatter plots of the sorting panels for each immune cell population measured by LC-MS/MS.

Representative flow cytometry scatter plots of the sorting panels for each immune cell population measured by LC-MS/MS. Supplementary Figure 1 Representative flow cytometry scatter plots of the sorting panels for each immune cell population measured by LC-MS/MS. Total CD4 T cells, Tregs, T H1, T H2 and T H17 were enriched

More information

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2 Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,

More information

Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16

Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16 Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding

More information

Distribution of human ILCs during chronic lung disease.

Distribution of human ILCs during chronic lung disease. Supplementary Figure 1 Distribution of human ILCs during chronic lung disease. Quantification of flow cytometric analysis of lung tissue from patients with COPD or IPF identifying (a) frequencies of total

More information

initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for

initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for Supplementary Figure 1: Summary of the exclusionary approach to surface marker selection for initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for protein

More information

THE TOXICOLOGY-METABOLISM LINK. Cell Metabolism Assays. for. Toxicology. Research

THE TOXICOLOGY-METABOLISM LINK. Cell Metabolism Assays. for. Toxicology. Research THE TOXICOLOGY-METABOLISM LINK Cell Metabolism Assays for Toxicology Research SCREENING FOR TOXIC & ADVERSE PHENOTYPES USING FUNCTIONAL METABOLISM ASSAYS SCREENING The drug discovery process is evolving

More information

Nature Medicine: doi: /nm.4356

Nature Medicine: doi: /nm.4356 SUPPLEMENTARY FIGURES Supplementary Figure 1: Characterization of IVT mrna encoding highly active bsab. (a) IVT mrna quality and purity analysis on an Agilent 2100 Bioanalyzer. Full-length mrna peaks are

More information

Supplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to

Supplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to Supplement Figure 1. Characterization of the 312.8 moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to platelets. The black line represents the 312.8 moab

More information

Supplementary Figure 1 Structural modeling and purification of V. cholerae ABH. (a) The migration of the purified rabh and catalytically inactive

Supplementary Figure 1 Structural modeling and purification of V. cholerae ABH. (a) The migration of the purified rabh and catalytically inactive Supplementary Figure 1 Structural modeling and purification of V. cholerae ABH. (a) The migration of the purified rabh and catalytically inactive variants rabhs, rabhd, and rabhh are shown on 12% SDS-PAGE

More information

Nanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity

Nanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity Nanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity Daisuke Muraoka, Naozumi Harada,, Tae Hayashi, Yoshiro Tahara,, Fumiyasu

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12138 Supplementary Figure 1. Knockdown of KRAS leads to a reduction in macropinocytosis. (a) KRAS knockdown in MIA PaCa-2 cells expressing KRASspecific shrnas

More information

Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum. Blood-stage Development

Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum. Blood-stage Development Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum Blood-stage Development Painter et al. 1 of 8 Supplementary Figure 1: Supplementary Figure

More information

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different

More information

Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot

Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot (vector: ~25 kda). (b) Silver staining was used to assess

More information

Corporate Tutorial IBA T-CATCH. Cell isolation in pipette tips. ISCT, Paris Lothar Germeroth

Corporate Tutorial IBA T-CATCH. Cell isolation in pipette tips. ISCT, Paris Lothar Germeroth Corporate Tutorial IBA T-CATCH Cell isolation in pipette tips ISCT, Paris 2014 Lothar Germeroth Workshop IBA Introduction of the Streptamer technology Staining with Streptamers off rate assay T-CATCH Cell

More information

ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity and percent identical sites.

ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity and percent identical sites. Identity Human Mouse Supplemental Figure 1. Amino acid sequence alignment of -MyHC. The alignment was created using the ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity

More information

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation

More information

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor

More information

Supplementary Infomation

Supplementary Infomation Supplementary Infomation Mycobacterium avium MAV2054 protein induces macrophage apoptosis through targeting to mitochondria and reduces intracellular growth of the bacteria. Kang-In Lee 1,2, Jake Whang

More information

Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.

Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1. LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4

More information

Agilent Seahorse XF Live-Cell Metabolism Solutions for STEM CELL RESEARCH

Agilent Seahorse XF Live-Cell Metabolism Solutions for STEM CELL RESEARCH Agilent Seahorse XF Live-Cell Metabolism Solutions for STEM CELL RESEARCH MONITOR CELL FATE TRANSITIONS Improve Differentiation and Reprogramming Outcomes Adult Fibroblast Cells Reprogramming (ips Cells)

More information

Supplemental Movie Legend.

Supplemental Movie Legend. Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,

More information

Supplemental Information. Plk1/Polo Phosphorylates Sas-4 at the Onset. of Mitosis for an Efficient Recruitment

Supplemental Information. Plk1/Polo Phosphorylates Sas-4 at the Onset. of Mitosis for an Efficient Recruitment Cell Reports, Volume 25 Supplemental Information Plk1/Polo Phosphorylates Sas-4 at the Onset of Mitosis for an Efficient Recruitment of Pericentriolar Material to Centrosomes Anand Ramani, Aruljothi Mariappan,

More information

Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations

Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations Figure S1 A B C Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations (A-B) Murine bone cells were cultured in either M-CSF (5,000 U/ml) or GM-CSF

More information

Supporting information. Supplementary figures.

Supporting information. Supplementary figures. Supporting information. Supplementary figures. Figure S1. Vacuolar parasite content is independent of the number of vacuoles per cell. The datasets employed for Fig. 1B were examined to determine the number

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Real-time deformability cytometry: contour detection and theoretical modeling.

Nature Methods: doi: /nmeth Supplementary Figure 1. Real-time deformability cytometry: contour detection and theoretical modeling. Supplementary Figure 1 Real-time deformability cytometry: contour detection and theoretical modeling. (a) Image of cell deformed in constriction; contour (red) according to image analysis algorithm. Scale

More information

Multivalent bi-specific nanobioconjugate engager for targeted cancer immunotherapy

Multivalent bi-specific nanobioconjugate engager for targeted cancer immunotherapy In the format provided by the authors and unedited. DOI: 10.1038/NNANO.2017.69 Multivalent bi-specific nanobioconjugate engager for targeted cancer immunotherapy Hengfeng Yuan, Wen Jiang,* Christina A.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06721 SUPPLEMENTARY INFORMATION. Supplemental Figure Legends Supplemental Figure 1 The distribution of hatx-1[82q] in Cos7 cells. Cos7 cells are co-transfected with hatx-1[82q]-gfp (green)

More information

Genome-wide CRISPR screen reveals novel host factors required for Staphylococcus aureus α-hemolysin-mediated toxicity

Genome-wide CRISPR screen reveals novel host factors required for Staphylococcus aureus α-hemolysin-mediated toxicity Genome-wide CRISPR screen reveals novel host factors required for Staphylococcus aureus α-hemolysin-mediated toxicity Sebastian Virreira Winter, Arturo Zychlinsky and Bart W. Bardoel Department of Cellular

More information

Supplementary Figure 1. Serial deletion mutants of BLITz.

Supplementary Figure 1. Serial deletion mutants of BLITz. Supplementary Figure 1 Serial deletion mutants of BLITz. (a) Design of TEVseq insertion into J -helix. C-terminal end of J -helix was serially deleted and replaced by TEVseq. TEV cleavage site is labeled

More information

Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size

Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size comparison of the P6 control and PKO mice. (b) H&E staining of hind-limb muscles from control and PKO mice at P6.

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 Validation of the monoclonal antibody to mouse ACKR1 and expression of ACKR1 by BM hematopoietic cells. (a to d) Comparison of immunostaining of BM cells by anti-mouse ACKR1 antibodies:

More information

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860 Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;

More information

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494 Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting

More information

IGF-1 promotes the development and cytotoxic activity of human NK cells regulated

IGF-1 promotes the development and cytotoxic activity of human NK cells regulated Supplementary Information for IGF-1 promotes the development and cytotoxic activity of human NK cells regulated by mir-483-3p Fang Ni 1, 2, Rui Sun 1, Binqing Fu 1, Fuyan Wang 1, Chuang Guo 1, Zhigang

More information

Antibody Titrations. Institut für HIV Forschung SOP #06-03 (Nov BS) Background. Reagents

Antibody Titrations. Institut für HIV Forschung SOP #06-03 (Nov BS) Background. Reagents Institut für HIV Forschung SOP #06-03 (Nov 2017 - BS) Antibody Titrations Reagents Reagent Vendor Catalogue # Stock Conc. FACS Tubes BD Falcon 352054 - Anti-CD28/CD49d Antibody BD Fastimmune 347690 - GolgiPlug

More information

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,

More information

Promotion of regulatory T cell induction by immunomodulatory herbal medicine

Promotion of regulatory T cell induction by immunomodulatory herbal medicine Promotion of regulatory T cell induction by immunomodulatory herbal medicine licorice and its two constituents Ao Guo 1,, Dongming He,, Hong-Bo Xu 3, Chang-An, Geng 3, Jian Zhao * 1 School of Life Sciences,

More information