Supplemental Movie Legend.
|
|
|
- Aron Robertson
- 6 years ago
- Views:
Transcription
1 Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices, 1 μm apart) were compiled at each time-point and sequenced into a movie with IPLab (Scanalytics). The zero time-point represents the initiation of imaging, which was prior to the first contact between the T cell and the APC. The movie speed is 1x real time. Scale bar 5μm.
2 TBC1D15 AS16 Supplemental Figure 1. Control RabGAPs do not induce large vacuoles Transfection of two TBC-containing proteins (AS16, TBC1D15) under conditions identical to those used for (Fig 1A) does not induce large vacuoles. Bar 2µm.
3 A RFP EEA1-Alexa488 Merge RFP- EEA1-Alexa488 Merge B RFP LAMP2-Alexa488 Merge RFP- LAMP2-Alexa488 Merge C RFP Calnexin-Alexa488 Merge RFP- Calnexin-Alexa488 Merge D RFP TfR-Alexa488 Merge RFP- TfR-Alexa488 Merge Supplemental Figure 2. TfR but not markers of other compartments are located in -induced vacuoles. This figure provides additional one color images and controls for Fig 1c. Jurkat cells were transfected with mrfp or mrfp- and stained with (A) anti- EEA1, (B) anti-lamp2, (C) anti-calnexin, (D) anti-tfr respectively. Single color, merged confocal images showed the localization of EEA1, LAMP-2, Calnexin, TfR (Green). Bar 2µm.
4 TCR-zeta VAMP-3 STX-4 Fluorescence Intensity Supplemental Figure 3. TCRzeta, VAMP-3 and STX-4 are enriched in the vesicle membrane Localization of the -tagged constructs from Fig. 1D is shown in the grayscale panels. Graphs on right represent quantitative analysis of intensity along a line through a representative vacuole that is bounded by cytoplasm on both sides (at the location shown by green arrow on corresponding image). Bar 2µm Distance along measurement line
5 RFP-Rab35 TCR-zeta- Tubulin Merge Supplemental Figure 4. IntracellularRab35 localization includes a peri-centriolar compartment. Detection of MTOC by anti-alpha-tubulin Ab in Jurkat cells transfected with TCR-zeta- and mrfp-rab35. The single large amorphous colocalization of TCR and Rab35 is in immediate proximity to the MTOC. Arrow highlights a discrete vesicle close to that region with colocalized TCR-zeta and Rab35. Bar 2µm.
6 (µm) Merge TCR-zeta- RFP-Rab35WT Supplemental Figure 5. Z-series showing that Rab35 colocalizes with TCRz. Confocal images of Jurkat cells co-transfected with RFP- Rab35wt (red) and CD3-zeta- (green) constructs. From bottom (1.2 µm) to top (7.6 µm), five serial sections through cells co-transfected with Rab35wt and CD3-zeta- were analyzed. Colocalization is seen in the pericentrosomal region (arrow) and in isolated vesicles (arrowheads). Bar 2µm.
7 24h 72h positive cells Rab35 D positive cells Rab35 D MFI MFI CD11a CD3 CD43 Molecule ClassI TfR CD11a CD3 CD43 Molecule ClassI TfR MFI egative cells Rab35 D MFI egative cells Rab35 D CD11a CD3 CD43 Molecule ClassI TfR CD11a CD3 CD43 Molecule ClassI TfR Supplemental Figure 6. and Rab35 does not alter surface molecule expression in Jurkat. Jurkat cells transfected with empty vector (), -EPI64c () or -Rab35 D (rab35 D) were analyzed by FACS for surface expression of transmembrane proteins 24 and 72h post-transfection. Cells were gated based on expression and the analysis was done comparing MFI in -positive and -negative cells from the same tube and between constructs. otably the level of surface CD3 expression is not significantly altered by expression of or Rab35D
8 A B Rab35 S22 PMA Stimulated Unstimulated % CELL ADHESIO TO F - + Supplemental Figure 7. Overexpression of and Rab35 S22 does not impair T cell adhesion to F. Jurkat cells were transfected and analyzed for adhesion to fibronectin 14-18h after transfection. A) Fluorescence histograms the transfected cell populations. B) Comparison of adhesion of -positive vs -negative cells in the same culture of electroporated cells. For each construct adhesion was measured without stimulation or after 1 min PMA treatment. Methods: Adhesion was measured by flow cytometric comparison of the adherent cells with the total cells as generally as previously described (Ref 1). The only differences were that Jurkat was utilized instead of T cell blasts, 6 wells were pooled per sample instead of 4 and the samples were resuspended in a final volume of 275µl. Each sample was analyzed on the flow cytometer, acquiring at least 3, total events. Using the gates shown in the corresponding histograms, the percent of adhesion of the + population (solid bars) was calculated and compared with the percent of adhesion of the electroporated cells that lacked expression (white bars). Results shown are representative of 3 independent experiments 1 Chan AS, Mobley JL, Fields GB, Shimizu Y CD7-mediated regulation of integrin adhesiveness on human T cells involves tyrosine phosphorylation-dependent activation of phosphatidylinositol 3-kinase. J Immunol 159: (PMID: )
9 RFP CD3 RFP-Rab35-D CD3 Merge DIC Merge DIC Supplemental Figure 8. Example of analysis of surface CD3 localization in conjugates. Staining for surface TCR in representative fixed non-permeabilized conjugates between Jurkat cells (transfected with RFP or RFP-Rab35D) and Raji cells in the presence of superantigen SEE. Bar 2µm.
supplementary information
DOI: 10.1038/ncb1977 Figure S1 a. Immunofluorescence analysis of IFT20 localization in PBL costained with anti-β-tubulin antibodies. b. Immunofluorescence analysis of IFT20 localization in Jurkat cells,
Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,
J. Cell Sci. 128: doi: /jcs : Supplementary Material. Supplemental Figures. Journal of Cell Science Supplementary Material
Supplemental Figures Figure S1. Trio controls endothelial barrier function. (A) TagRFP-shTrio constructs were expressed in ECs. Western blot shows efficient Trio knockdown in TagRFP-expressing ECs. (B)
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Table S1. Definition of quantitative cellular features
THE JOURNAL OF CELL BIOLOGY
Supplemental Material THE JOURNAL OF CELL BIOLOGY Yeung et al., http://www.jcb.org/cgi/content/full/jcb.200903020/dc1 Figure S1. Assessment of the surface charge of maturing phagosomes. (A C and F H) RAW
No wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)
Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human
Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease
Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein mutant that causes type 1A Charcot-Marie-Tooth disease Taichi Hara, Yukiko Hashimoto, Tomoko Akuzawa, Rika Hirai,
Figure legends for supplement
Figure legends for supplement Supplemental Figure 1 Characterization of purified and recombinant proteins Relevant fractions related the final stage of the purification protocol(bingham et al., 1998; Toba
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.
α-cd3 + α-cd28: Time (min): + + + + + + + + + 0 5 15 30 60 120 180 240 300 360 360 n.s. Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of. Immunoblot of lysates from Jurkat cells
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
15h. 24h. Blander & Medzhitov supplementary Figure 1. Apoptotic cells. Apoptotic LPS blasts 30% 32% 32% + Exogenous LPS 0.1% 31% 21% 20% 48% 60% 53%
a None Apoptotic cells Apoptotic LPS blasts 30% 32% 32% Apoptotic cells + Exogenous LPS 6h 0.1% 31% 21% 20% 48% 60% 53% 15h 0% 7% 5% 4% 30% 32% 32% 24h CD11c 0% 8% 2% 2% CFSE Blander & Medzhitov supplementary
Antibody Titrations. Institut für HIV Forschung SOP #06-03 (Nov BS) Background. Reagents
Institut für HIV Forschung SOP #06-03 (Nov 2017 - BS) Antibody Titrations Reagents Reagent Vendor Catalogue # Stock Conc. FACS Tubes BD Falcon 352054 - Anti-CD28/CD49d Antibody BD Fastimmune 347690 - GolgiPlug
Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical
Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
MEFs were treated with the indicated concentrations of LLOMe for three hours, washed
Supplementary Materials and Methods Cell Fractionation MEFs were treated with the indicated concentrations of LLOMe for three hours, washed with ice-cold PBS, collected by centrifugation, and then homogenized
Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer
SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min
Supplemental Material
Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36
Supplementary Information
Supplementary Information Supplementary Figure 1: Over-expression of CD300f in NIH3T3 cells enhances their capacity to phagocytize AC. (a) NIH3T3 cells were stably transduced by EV, CD300f WT or CD300f
(B) Comparable expression of major integrin subunits and glycoproteins on the surface of resting WT and Lnk -/- platelets.
Supplemental Figure S1. Characteristics of Lnk -/- platelets. (A) Electron micrographs of resting platelets showing the normal intracellular structure of Lnk -/ platelets. Samples were fixed with 4% PFA
Supplemental Table 1 Primers used in study. Human. Mouse
Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc
Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
Supplementary Figure 1 a
3 min PMA 45 min PMA AnnexinV-FITC Supplementary Figure 1 5 min PMA 15 min PMA a 9 min PMA 12 min PMA 5 min FGF7 15 min FGF7 3 min FGF7 6 min FGF7 9 min FGF7 12 min FGF7 5 min control 3 min control 6 min
Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.
LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4
JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al.,
Supplemental material JCB Paul et al., http://www.jcb.org/cgi/content/full/jcb.201502040/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Mutant p53-expressing cells display limited retrograde actin flow at
Supplementary Table-1: List of genes that were identically matched between the ST2 and
Supplementary data Supplementary Table-1: List of genes that were identically matched between the ST2 and ST3. Supplementary Table-2: List of genes that were differentially expressed in GD2 + cells compared
Supplementary Figure 1. Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect
Supplementary Figure 1 Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect integrin extension (E + ) and mab24 (green) can specifically detect headpiece-opening
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Wang et al., http://www.jcb.org/cgi/content/full/jcb.201405026/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Generation and characterization of unc-40 alleles. (A and
JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,
Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained
Asymmetric endocytosis and remodeling of β1-integrin adhesions during growth cone chemorepulsion by MAG
Asymmetric endocytosis and remodeling of β1-integrin adhesions during growth cone chemorepulsion by MAG Jacob H. Hines, Mohammad Abu-Rub and John R. Henley Supplementary Figure 1. Validation of FM 5-95
Supplemental material and methods
Supplemental material and methods Antibodies: Primary antibodies used for these stainings were 174/2 1 (migg1 against PV-1), PAL-E 2 (migg2a; Abcam, Cambridge, UK), anti-nrp-1 (monoclonal migg2a or polyclonal
To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression
Supplemental figures Supplemental Figure. 1. Silencing expression of Celsr3 by shrna. To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression plasmids for the shrna
Figure S1 is related to Figure 1B, showing more details of outer segment of
Supplemental Information Supplementary Figure legends and Figures Figure S1. Electron microscopic images in Sema4A +/+ and Sema4A / retinas Figure S1 is related to Figure 1B, showing more details of outer
Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin
Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2
Fast, three-dimensional super-resolution imaging of live cells
Nature Methods Fast, three-dimensional super-resolution imaging of live cells Sara A Jones, Sang-Hee Shim, Jiang He & Xiaowei Zhuang Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3
Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry
Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry Kristie M. Grebe and Terry A. Potter* (Published 10 September
PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
Post-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
Supplementary Fig. 1: Ultrastructural localization of Hh, Ihog and Disp in wing discs. A) Thawed 200 nm thick cryosections of wing disc expressing
Supplementary Fig. 1: Ultrastructural localization of Hh, Ihog and Disp in wing discs. A) Thawed 200 nm thick cryosections of wing disc expressing Hh-GFP were immunostained with an anti-gfp antibody followed
3 The abbreviations used are: ECM, extracellular matrix; MMP, metalloproteinase;
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 50, pp. 43405 43416, December 16, 2011 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Phosphorylation
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Prashar et al., http://www.jcb.org/cgi/content/full/jcb.201304095/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. FBT phagocytosis in cells expressing PM-GFP. (A) T-PC
LysoTracker Red DND-99 (Invitrogen) was used as a marker of lysosome or acidic
information MATERIAL AND METHODS Lysosome staining LysoTracker Red DND-99 (Invitrogen) was used as a marker of lysosome or acidic compartments, according to the manufacturer s protocol. Plasmid independent
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward
Landes Bioscience www.landesbioscience.com Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward The level of HER2 expression is a predictor of antibody- HER2 trafficking behavior
Supplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Enrichment with anti-biotin antibody significantly increases detection of biotinylated peptides in complex samples. (A) Structure of NHS-biotin (B) Results of spike-in studies. Bar
Supplementary Figure 1. Drawing of spinal cord open-book preparations and DiI tracing. Nature Neuroscience: doi: /nn.3893
Supplementary Figure 1 Drawing of spinal cord open-book preparations and DiI tracing. Supplementary Figure 2 In ovo electroporation of dominant-negative PlexinA1 in commissural neurons induces midline
DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000
Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking
Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Chi Wai Lee, Jianzhong Han, James R. Bamburg, Liang Han, Rachel Lynn, and James Q. Zheng Supplementary Figures
Figure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells
Supplementary Figures and Tables Figure S1. Figure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells were treated with donkey-anti rabbit antibody conjugated with Dylight488 or
Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells
SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes
Supplemental Fig. 1. Mcr alleles show defects in tracheal tube size and luminal protein accumulation. (A-F) Confocal projections of living stage 15
Supplemental Fig. 1. Mcr alleles show defects in tracheal tube size and luminal protein accumulation. (A-F) Confocal projections of living stage 15 embryos expressing GFP and Verm-RFP in tracheal cells
ab Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis
ab139418 Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis Instructions for Use To determine cell cycle status in tissue culture cell lines by measuring DNA content using a flow cytometer. This
ab Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis
ab139418 Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis Instructions for Use To determine cell cycle status in tissue culture cell lines by measuring DNA content using a flow cytometer. This
Detection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer. Application
Detection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer Application Gerd Luedke and Tobias Preckel Abstract This Application Note describes how the
The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force. Supporting Information
Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force Benjamin M. Gaub and Daniel J. Müller Supporting Information Supporting Information Note
Supplementary Materials and Methods
Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK
Aoki et al.,
JCB: SUPPLEMENTAL MATERIAL Aoki et al., http://www.jcb.org/cgi/content/full/jcb.200609017/dc1 Supplemental materials and methods Calculation of the raw number of translocated proteins First, the average
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating
Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Engineering Nanomedical Systems. Assessing the efficacy of nanomedical therapies
BME 626 October 9, 2014 Engineering Nanomedical Systems Lecture 12 Assessing the efficacy of nanomedical therapies James F. Leary, Ph.D. SVM Endowed Professor of Nanomedicine Professor of Basic Medical
Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
Supplemental Data. Hachez et al. Plant Cell (2014) /tpc Suppl. Figure 1A
Suppl. Figure 1A Suppl. Figure 1B Supplemental Figure 1: Results of the commercial screening of interactants using split ubiquitin technique. (A) Isolated preys (192) using the bait construct pbt3-n- as
Visualizing mechanical tension across membrane receptors with a fluorescent sensor
Nature Methods Visualizing mechanical tension across membrane receptors with a fluorescent sensor Daniel R. Stabley, Carol Jurchenko, Stephen S. Marshall, Khalid S. Salaita Supplementary Figure 1 Fabrication
Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells
Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Ruud Hulspas 1 UNIT 6.29 1 Cytonome/ST, Boston, Massachusetts ABSTRACT Nonspecific antibody binding is best
Panx2 expression modulates neuronal differentiation SUPPLEMENTAL DATA. Figure Legends
Panx2 expression modulates neuronal differentiation SUPPLEMENTAL DATA Figure Legends Suppl. Fig. S1. Antigenic determinants of the Panx2 antibodies employed in this study. (A) Schematic of mouse Panx2
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,
Sarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
Supplementary Figures
Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained
This is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Prospéri et al.,
Supplemental material JCB Prospéri et al., http://www.jcb.org/cgi/content/full/jcb.201501018/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Myo1b Tail interacts with YFP-EphB2 coated beads and genistein inhibits
Actin cap associated focal adhesions and their distinct role in cellular mechanosensing
Actin cap associated focal adhesions and their distinct role in cellular mechanosensing Dong-Hwee Kim 1,2, Shyam B. Khatau 1,2, Yunfeng Feng 1,3, Sam Walcott 1,4, Sean X. Sun 1,2,4, Gregory D. Longmore
Understanding Flow Cytometry
Understanding Flow Cytometry The Basic Concepts Maree Bagnara Products Sales Specialist/Account Manager Flow Cytometry PN775136 1 Successful Flow Cytometry data is driven by.. Understanding the Biology
by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
Nature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices.
Supplementary Figure 1 Time course of OT-II T reg cell development in thymic slices. Time course of T reg cell development following addition of OT-II TCR transgenic Rag2 -/- mice (OT-II) thymocytes to
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
SUPPLEMENTARY INFORMATION
Supplementary Figure 1 sirna and shrna mediated depletion of ATP7A results in loss of melanosomal ATP7A staining. a-h, sirna mediated ATP7A depletion. Immunofluorescence microscopy (IFM) analysis of ATP7A
Technical Bulletin. Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer. Introduction
March 212 Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer Contents 1 Introduction 2 Annexin V 4 JC-1 5 Caspase-3 6 APO-BrdU and APO-Direct Introduction Apoptosis (programmed
Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE1 through. Akt/ROCK1 to stimulate cell motility.
Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE through Akt/ROCK to stimulate cell motility. Authors : Monet Michael, Poët Mallorie, Tauzin Sébastien 2,#, Fouqué Amélie 3, Cophignon
Journal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor
To assess the localization of Citrine fusion proteins, we performed antibody staining to
Trinh et al 1 SUPPLEMENTAL MATERIAL FlipTraps recapitulate endogenous protein localization To assess the localization of Citrine fusion proteins, we performed antibody staining to compare the expression
Direct Imaging of APP Proteolysis in Living Cells
Direct Imaging of APP Proteolysis in Living Cells Niccoló Parenti, Ambra Del Grosso, Claudia Antoni, Marco Cecchini, Renato Corradetti, Francesco S. Pavone, Martino Calamai Supplementary Information Supplementary
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
Integrated Omics Study Delineates the Dynamics of Lipid Droplets in Rhodococcus Opacus PD630
School of Natural Sciences and Mathematics 2013-10-22 Integrated Omics Study Delineates the Dynamics of Lipid Droplets in Rhodococcus Opacus PD630 UTD AUTHOR(S): Michael Qiwei Zhang 2013 The Authors This
Supplemental Figure 1
Supplemental Figure 1 A IL-12p7 (pg/ml) 7 6 4 3 2 1 Medium then TLR ligands MDP then TLR ligands Medium then TLR ligands + MDP MDP then TLR ligands + MDP B IL-12p4 (ng/ml) 1.2 1..8.6.4.2. Medium MDP Medium
Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,
Nature Publishing Group
s u p p l e m e n ta r y i n f o r m at i o n Figure S1 Ang1 induces translocation of Tie1 and Tie2 to TritonX-100 insoluble cell junctions connected to actin microfilaments. (a) Tie2 is present in cell-cell
Albumin. MMP-9 (tertiary granules) Lactoferrin. MPO (U/ml) ctrl PMN-sec
Figure S1: Antibody cross-linking of CD18 induces release of primary, secondary, and tertiary granules as well as secretory vesicles. Freshly isolated PMN were incubated with primary anti-cd18 mab IB4
Data Sheet ICOS/NFAT Reporter-Jurkat Recombinant Cell Line Catalog #: 79668
Data Sheet ICOS/NFAT Reporter-Jurkat Recombinant Cell Line Catalog #: 79668 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements