Hybridization,Approaches,to,Rare,Sequence, Variant,Detection,in,Human,DNA

Transcription

1 Hybridization,Approaches,to,Rare,Sequence, Variant,Detection,in,Human,DNA David Yu Zhang Nov 2, 215 Rice University

2 Conflict,of,Interest,Disclosures Research Collaboration: Leadership: searna

3 Early detection of cancer can save lives but people hate getting biopsies. - Invasive - Requires Dx imaging - Risk of infection

4 Non-invasive early detection may be possible due to the existence of cell-free DNA (cfdna) - 2ng per ml of plasma, urine = 6 genomic equivalents - typically 14-16nt in plasma - typically 6nt in urine - observed in Stage I/II patients

5 Early detection of cancer requires: Multiplexing Mutation Sensitivity Multiplexing NGS Standard PCR Deep Sequencing? Digital PCR Mutation Sensitivity

6 Early detection of cancer requires: Multiplexing Mutation Sensitivity Multiplexing NGS Standard PCR Deep Sequencing? Digital PCR Prohibitively costly! oo many NGS reads being wasted on wildtype (healthy) DNA Mutation Sensitivity

7 Our,Approach Sample Deep sequencing results without deep sequencing Initial Prep. Purified DNA sample 1 Enriched for 2 genes of interest Enriched for gene variants Allele Enrichment NGS Sequencing Analyze Ultra sequence-selective hybrid capture probes to deplete 9-99% of the wildtype DNA, efficiently revealing all gene variants

8 Our,Results,hus,Far Competitive hybridization probes with target-mimic oligonucleotides Enabled features: - Position agnostic single nucleotide selectivity - 1-fold hybridization difference for SNVs, even A>G mutations that result in G- wobbles Intended arget A CACCACA ACCCACGC -.1% SNV detection from 2ng gdna with PCR, across 8 ºC of anneal/extend temperature arget-mimic GCACCACCACA ACC AACGAGGGAGAAG AGGGAGCAG Competitive Hybridization Probe A - On-the-fly sensitivity/specificity tuning without oligonucleotide resynthesis - Uniform capture yield for 31 oligos with %-1% G/C content all with plain vanilla DNA.

9 Standard,Hybridization Intended arget A CACCACA ACCCACGC Incorrect arget CACCACA ACCCACGC + + GGAGAAG AGGGAGCAG GGAGAAG AGGGAGCAG 25 o C 1% yield 25 o C 1% yield A CACCACA ACCCACGC GGAGAAG AGGGAGCAG CACCACA ACCCACGC GGAGAAG AGGGAGCAG

10 Standard,Hybridization Intended arget A CACCACA ACCCACGC Incorrect arget CACCACA ACCCACGC + + GGAGAAG AGGGAGCAG GGAGAAG AGGGAGCAG 53 ºC 5% yield 53 ºC 5% yield A CACCACA ACCCACGC GGAGAAG AGGGAGCAG CACCACA ACCCACGC GGAGAAG AGGGAGCAG Melting emperature: - Difficult to predict from sequence - Salinity, concentration, and ph dependent - Multiplexing is difficult - Requires precise temperature equipment

11 Competitive,Hybridization Intended arget A CACCACA ACCCACGC Incorrect arget CACCACA ACCCACGC 22bp vs 22bp ΔG o A GCACCACCACA ACC 21bp vs 22bp ΔG o +3 kcal/mol CACCACA AACCCACGC AACGAGGGAGAAG AGGGAGCAG A GCACCACCACA ACC 5% yield AACGAGGGAGAAG AGGGAGCAG oehold Probe 2% yield AACGAGGGAGAAG AGGGAGCAG CACCACA ACCCACGC GCACCACCACA AACC 5% Fold change = = 25 2% D. Y. Zhang, S. X. Chen & P. Yin. Nature Chemistry (212)

12 Competitive,Hybridization FQ FAM Intended (9 nt) + Probe (9+7nt) + Frequency 2% 1% N = 59 SNVs of 6 targets Fluorescence ime (min) Intended 54C> 65C>A 73C>G 35>C 12G>C % SNVs SNV fold change β Can we do better? Mutation fraction << 3% D. Y. Zhang, S. X. Chen, P. Yin, Nature Chemistry (212).

13 Competitive,Composition How do you quickly find As engineers, we build tools: a needle in a haystack? Magnet (target-specific probe) oo weak/lazy oo strong/hungry Magnet: False Neg. False Pos. Goat: False Pos. False Neg. Goat (W-specific sink)

14 he,magnet,and,the,goat Competitive Composition Detection Probe + arget (SNV) Gºrxn1 E 1 Sink + Wildtype (W) Gºrxn2 E 2 Noise Probe + E 3 Sink + E 4 t = 1 hr t = 48 hr ΔGº rxn1 (kcal/mol) ΔGº rxn2 (kcal/mol) ΔGº rxn2 (kcal/mol) J. S. Wang & D. Y. Zhang. Nature Chemistry 7: (215)

15 Experimental,Results Fluorescence (a.u.) 2 1 Probe only W (5 nm) + SNV (5 nm) W (5 nm) 15 3 ime (min) f A f C f B 5 nm VAF = 55 nm = 1% f A / VAF β = = 145 f B + f C f B Fluorescence (a.u.) Competitive Composition 1% VAF, β = 56 W (5 nm) + SNV (5 nm) W (5 nm) 15 3 ime (min) 1.1% VAF, β = % VAF, β = W (15 nm) + SNV (1.5 nm) 7.5 W (5 nm) + SNV (.5 nm) W (5 nm) W (15 nm) ime (min) ime (min) J. S. Wang & D. Y. Zhang. Nature Chemistry 7: (215)

16 Performance,Distribution Normalized Fold-change β DNA RNA D594G (A>G) V6E (>A) G719A (G>C) S768I (G>) 79M (C>) L858R (>G) L861Q (>A) S31F (C>) G12A (G>C) G12C (G>) G12D (G>A) L755S (>C) V842I (G>A) G12R (G>C) G12S (G>A) G12V (G>) G13C (G>) Q61H (A>C) K57N (G>) G12C (G>) G13D (G>A) G13V (G>) G12D (G>A) G12S (G>A) G13D (G>A) Q61L (A>) Q61R (A>G) E542K (G>A) Q61H (A>) Q61K (C>A) BRAF ERBB2 KRAS NRAS EGFR MAP2K1 E545K (G>A) Q37* (C>) P281L (C>) F354L (C>G) H147L (A>) H147R (A>G) R175H (G>A) R213* (C>) Y22C (A>G) SK11 PIK3CA R248W (C>) R273C (C>) R273H (G>A) R282W (C>) R248Q (G>A) P53 EGFR-L858R (U>G) KRAS-G12C (G>U) KRAS-G12R (G>C) NRAS-Q61H (A>U) PIK3CA-E545K (G>A) PIK3CA-H147R (A>G) J. S. Wang & D. Y. Zhang. Nature Chemistry 7: (215)

17 From,Human,Genomic,DNA NA18562 NA18537 NA18562 Amplicon (SMAD7-C) CCAGCCACAGCCCACCAAAAGAGGAAACAGGACCCCAGAGCCCCCAGACCCCAGGAAACA NA18537 Amplicon (SMAD7-) CCAGCCACAGCCCACCAAAAGAGGAAAAGGACCCCAGAGCCCCCAGACCCCAGGAAACA Mixed Genomic DNA Mixed Amplicons Probe and Sink Non-allelespecific PCR Measure Fluorescence Fluorescence (a.u.) SMAD7-C detection (9%, 91%) (1%, 99%) (%, 1%) ime (min) Fluorescence (a.u.) SMAD7- detection (91%, 9%) (99%, 1%) (1%, %) ime (min) J. S. Wang & D. Y. Zhang. Nature Chemistry 7: (215)

18 AlleleJspecific,PCR Allele-specific Primer + ARMS Primer + Non-allele-specific Primer W-specific Blocker + + BDA Primer/Blocker arget W arget W Hybridization specificity + + Polymerase specificity Amplicon has wrong base identity at the allele Preserved base identity at the allele, compounded specificity in each PCR cycle L. R. Wu., J. H. Bae, A. Pinto, S. X. Chen & D. Y. Zhang. (manuscript in preparation, 215)

19 AlleleJspecific,PCR Fluorescence (a.u.) SMAD7 rs Bio-Rad iaq SybrGreen mix 2 nm primers 2 µm blocker emp Cycles: 95ºC 6ºC Fluorescence (a.u.) EGF rs (A vs. C) 1% arget.1% arget 99.9% W Cycle 5 1% W 2 ng human gdna 1% arget Cq = % arget (12 copies) 99.9% W Cq = Fluorescence (a.u.) Cycle % W Cq = 38.9 BRAF rs (C vs. G).1 ng gdna (6 copies) 1% arget 1% W Cycle

20 emperature,robust,pcr Fluor. (a.u.) 12 BDA 8 56 ºC 64 ºC 4 arget W Cycle ARMS 56 ºC 64 ºC Cycle BRAF rs BDA CDC73 rs BDA Cq 6 ARMS Cq 6 ARMS Extension emp. (ºC) Extension emp. (ºC)

21 Clinical,Sample 7 EGFR 79M Positive Patient FFPE DNA (2ng) 7 EGFR Wildtype Human Genomic DNA (2ng) 6 6 Fluorescence Reference Amplification Primer only Cq = 25.7 Fluorescence Reference Amplification Primer only Cq = Allele-specific Cq = Allele-specific Cq = Cycle Cycle NSCLC patient tissue biopsy, FFPE, with confirmed 79M mutation by NGS

22 Current,Probe,uning arget Sequence 5 3 Probe GAGAAAGGACGACGGG + AACCCAGACAGACCCAACC uning achievable C>_ Gº GAGAAAGGACGACGGG AACCCAGACAGACCCAACC Effective thermodynamic change (kcal / mol) Probe Yield Shortened Probe Selectivity More positive Gº More negative Surgery with a chainsaw

23 Stoichiometric,uning + oehold Probe + [Protector] / [Probe] = 3.32 [Protector] Stoichiometric tuning Sequence tuning log1 ([P]/[PC]) [P] = 31.6 [PC] L. R. Wu., J. S. Wang, E. M. Reiser, J. Z. Fang, I. Pekker, R. Boykin, P. J. Webster, J. Beechem & D. Y. Zhang. Nature Methods (215) Yield (%) log1 ([P]/[PC]) log1 ([]/[PC]) Fluorescence (a.u.) 4

24 Uniform,Capture,Efficiency 1% GC: GGCGCCCCCCGCCGGCCCCGCCGCCGCCGC w/o Human gdna w/ 1ng Human gdna GC Content (%) 6 4 GC Content (%) Hybrid-capture enrichment bias leads to poor NGS coverage of some sequences Yield (%) Yield (%) % GC: AAAAAAAAAAAAAAAAAAAA uning reduces high-to-low yield ratio by over 1-fold, uniform yield across all GC content % tested.

25 Multiplexed,Stoichiometric,uning, for,rna,detection,with,ncounter Fluorescent Barcode BCR-ABL Fusion RNA arget Protector ProbeA ProbeB 16 hr hyb Biotin Fusion oehold Probe Before fm IV RNA argets RNA arget Sequence Yields at 16 hr (N = 24) Counts Purify, deposit, image, and count Biotin After*

26 hanks,for,listening,:) Our team: Our funding: John Fang J. Sherry Wang Lucia Wu Angela Zhang Helen Yan Jin Bae Dave Zhang Chunyan Wang Ale Pinto Jinny Zhang Dmitriy Khodakov