Metabolic and Process Engineering of Clostridia for Biofuel Production

Transcription

1 Metabolic and Process Engineering of Clostridia for Biofuel Production DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Wenyan Jiang Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2014 Dissertation Committee: Professor Shang-Tian Yang, Advisor Professor Jeffrey J. Chalmers Professor Robert J. Lee Professor F. Robert Tabita

2 Copyright by Wenyan Jiang 2014

3 Abstract Recently, with the concerns of unstable crude oil supply, rapid increase in gasoline prices and severe climate changes, higher alcohols (alcohols with more than two carbons) have gained interests for their potentials in replacing petroleum as new generation transportation fuels. Among all these candidates, n-butanol as a four carbon solvent has received the most attention because it shares very similar characteristics with gasoline and can be naturally produced by solventogenic Clostridia via Acetone-Butanol-Ethanol (ABE) fermentation. However, butanol production by these native producers suffers from low titer and yield due to inefficient substrate conversion and butanol cytotoxicity upon cell growth and metabolism. Also, the necessity of generating byproducts during fermentation significantly reduces butanol titer and product selectivity, and therefore, increases the cost for butanol recovery through distillation. In order to commercialize biobutanol as economically as petroleum-based processes, a more optimized overall fermentation strategy is highly desirable. Therefore, the goal of this study was to establish cost-effective fermentation processes for higher alcohols production through various approaches, including inexpensive feedstock utilization, process optimization employing external driving forces, and new strain development. First, the stability of hyper-butanol-producing strain Clostridium ii

4 acetobutylicum JB200 was validated by long-term repeated batch fermentation with cells immobilized in a fibrous bed bioreactor using sucrose as substrate. Its stable fermentation performance using low-cost sugarcane juice with a high butanol titer (16 20 g/l), yield (~0.21 g/g sucrose) and productivity (~0.32 g/l h) indicated that JB200 is a promising strain for industrial application. Then, the effect of extra driving forces provided by artificial electron carrier addition on butanol production by metabolically engineered Clostridium tyrobutyricum strain CtΔack-adhE2 was studied. The results suggested that artificial electron carriers can remarkably increase butanol titer and yield, while reduce the generation of byproducts. In addition, metabolic engineering of acidogenic C. tyrobutyricum were conducted to examine its feasibility as an isopropanol producer. A final isopropanol titer of 4.28 g/l in free-cell fermentation was achieved and an in vivo fluorescence based gene expression reporter system was developed to facilitate future gene manipulation in C. tyrobutyricum and other anaerobic microorganisms. This project demonstrated that by applying low-cost substrates, extra driving power as well as strains with high fermentation performance, the input-output ratio of butanol production via fermentation can be further enhanced to compete with petroleum-based processes. Meanwhile, for isopropanol production, more studies of solvent-producing gene regulation, speed-limiting-step enzyme activities, and redox balance in C. tyrobutyricum are still required. iii

5 Dedication This dissertation is dedicated to my family. iv

6 Acknowledgments I owe a debt of gratitude to my advisor, Dr. Shang-Tian Yang, for his guidance, patience and continuous encouragement during my five-year graduate study. Dr. Yang not only set a good example for me as an outstanding scientific researcher, but also an admirable person. Without his persistent help this dissertation would not have been possible. I would also like to thank my committee members, Dr. Jeffery Chalmers, Dr. Robert Lee and Dr. Fred Tabita for their valuable suggestions and recommendations to my work. In addition, a special thank you to Dr. Jingbo Zhao and Dr. Mingrui Yu who taught me essential lab techniques and shared their own precious experience with me at the beginning of my research. I would also like to acknowledge my friend Shibi, my current and previous labmates for their technical support. Financial supports from Molecular, Cellular and Developmental Biology graduate program, National Science Foundation STTR program, Ohio Department of Development Third Frontier Advanced Energy Program, and Advanced Research Projects Agency- Energy are greatly appreciated. v

7 Vita June Ningbo Senior High Sept June B.S. Biological Science, Jilin University Sept May Research associate, The Ohio State University Publications Jiang, W., Zhao, J., Wang Z., Yang, S.T., Stable high-titer n-butanol production from sucrose and sugarcane juice by Clostridium acetobutylicum JB200 in repeated batch fermentations. Bioresour. Technol. 163, Yu, M., Du, Y., Jiang, W., Yang, S.T., Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosythesis in Clostridium tyrobutyricum. Appl. Microbiol. Biotechnol. 93(2): Du, Y., Jiang, W., Yu, M., Tang, I.C., Yang, S.T., Metabolic process engineering of Clostridium tyrobutyricum Δack-adhE2 for enhanced n-butanol production from glucose: Effects of methyl viologen on NADH availability, flux distribution and fermentation kinetics. Metab. Eng. In review. Fields of Study Major Field: Molecular, Cellular and Developmental Biology vi

8 Table of Contents Abstract... ii Dedication... iv Acknowledgments... v Vita... vi Publications... vi Fields of Study... vi List of Tables... xii List of Figures... xiv Chapter 1 : Introduction Background Outline of tasks... 3 Reference... 6 Chapter 2 : Literature review Biofuels and biobutanol C3-C4 alcohol production via fermentation... 9 vii

9 2.2.1 Strain development for n-butanol production Process development for n-butanol production N-butanol production from alternative feedstocks In situ product separation References Chapter 3 : Stable high-titer n-butanol production from sucrose and sugarcane juice by Clostridium acetobutylicum JB200 in repeated batch fermentations Abstract Introduction Materials and methods Culture and media Free-cell fermentation Immobilized-cell fermentation in fibrous bed bioreactor Scanning electron microscopy Analytical methods Results and discussion Free-cell fermentation kinetics Batch fermentation in the FBB Repeated batch fermentations viii

10 3.3.4 Culture stability and butanol tolerance of JB Comparison to other studies Conclusions References Chapter 4 : Effects of external driving forces on redox balance and butanol production of engineered Clostridium tyrobutyricum mutant Abstract Introduction Materials and methods Strains and culture conditions Free cell fermentation in bioreactor with ORP and gas measurement Analytical methods Results and discussion Effects of methyl viologen on redox potential and butanol production Effects of benzyl viologen on redox potential and butanol production Conclusions Reference Chapter 5 : Metabolic and process engineering of Clostridium tyrobutyricum for isopropanol production ix

11 Abstract Introduction Materials and methods Bacterial strain and media Plasmids construction Plasmid transformation and confirmation Fermentation in serum bottles Free cell fermentation in bioreactor Enzyme activity assay Analytical methods Results and discussion Plasmid construction and transformation confirmation Isopropanol production by wild-type and Ct ack with pmtl82121-caa Effects of C. tyrobutyricum thiolase promoter on isopropanol production Effects of pta, ptb gene knockout on isopropanol production Effects of corn steep liquor and xylose on isopropanol production Effects of artificial electron carrier on isopropanol production Conclusions Reference x

12 Chapter 6 : Development of an in vivo fluorescence based gene expression reporter system for Clostridium tyrobutyricum Abstractc Introduction Materials and methods Bacterial strain and media Plasmids construction Plasmid transformation and confirmation Real-time monitoring Results and discussion Conclusions Reference Chapter 7: Conclusions and recommendations Conclusions Recommendations Bibliography Appendix A: Thl-bs2 gene sequence Appendix B: In-Fusion HD Cloning Kit User Manual xi

13 List of Tables Table 2.1 Comparison of chemical and physical properties of gasoline and biofuels Table 2.2 Summary of ABE production by solventogenic Clostridia from various feedstocks Table 2.3 Summary of the integrated butanol fermentation and in situ butanol removal techniques Table 3.1 Kinetics of ABE fermentation of sucrose and sugarcane thick juice by JB Table 3.2 Solvents production from sucrose and agricultural residues by various Clostridia strains Table 3.3 Comparison of biobutanol production in ABE fermentation from corn starch (glucose) and sugarcane juice (sucrose) Table 4.1 Standard oxidation-reduction potentials of redox couples associated with cell metabolism Table 4.2 Comparison of product titers, yields and productivities under different fermentation conditions Table 5.1 Strains and plasmids used in this study Table 5.2 Comparison of cell specific growth rate and final product titers from various C. tyrobutyricum mutants in serum bottle fermentation using glucose xii

14 Table 5.3 Comparison of cell specific growth rate and product titers of Ct ack(pcaa) in batch fermentation using different media Table 5.4 Effect of methyl viologen concentration on fermentation kinetics of CtΔack (pcaa) mutant in CGM medium with glucose as a substrate Table 6.1 Strains and plasmids used in this study xiii

15 List of Figures Figure 2.1 Combined transcriptome and metabolic flux analysis of C. acetobutylicum.. 46 Figure 2.2 Schematic diagram of the fibrous-bed bioreactor (FBB) and scanning electron microscopic pictures of cells immobilized in fibrous matrices Figure 2.3 In situ solvent recovery strategies Figure 3.1 Experimental set-up of the fibrous bed bioreactor (FBB) system Figure 3.2 Kinetics of free-cell batch fermentations of C. acetobutylicum JB200 with different carbon sources Figure 3.3 Growth kinetics of C. acetobutylicum JB200 on glucose and sucrose, respectively, as substrate Figure 3.4 Kinetics of immobilized-cell batch fermentations of C. acetobutylicum JB200 in the FBB with different carbon sources Figure 3.5 Repeated batch fermentations of C. acetobutylicum JB200 in the FBB with different carbon sources in 19 consecutive batches showing stable fermentation performance Figure 3.6 Kinetics of repeated batch fermentations of C. acetobutylicum JB200 in the FBB Figure 4.1 Redox balance achieved between extracellular redox potential and intercellular metabolism via various approaches xiv

16 Figure 4.2 Metabolic pathway in Clostridium tyrobutyricum Figure 4.3 Experimental set-up for free cell fermentation by Ct ack-adhe2 with ORP detection and gas measurement Figure 4.4 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using glucose as the substrate Figure 4.5 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using glucose as the substrate supplemented with 500 µm MV Figure 4.6 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using xylose as the substrate Figure 4.7 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using xylose as the substrate supplemented with 0.5 g/l cysteine and 10 µm BV Figure 4.8 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using xylose as the substrate supplemented with 10 µm BV Figure 4.9 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using xylose as the substrate supplemented with 1.5 g/l cysteine and 10 µm BV Figure 4.10 Comparison of product distribution, yields and productivities under different fermentation conditions Figure 5.1 Metabolic pathways in Clostridium tyrobutyricum xv

17 Figure 5.2 Construction of plasmids pmtl82151-caa and pmtl82151-pcaa Figure 5.3 Agarose gel pictures of plasmid confirmation Figure 5.4 Fermentation kinetics of CtWT-caa (A) and Ct ack-caa (B) in serum bottles Figure 5.5 Fermentation kinetics of CtWT-pcaa (A), Ct ack-pcaa (B), Ct pta-pcaa (C) and Ct ptb-pcaa (D) in serum bottles. (continued) Figure 5.6 Comparison of ADH enzyme activity in Ct ack-caa and Ct ack-pcaa Figure 5.7 Free cell fermentation of Ct ack-pcaa using CGM (A) and CSL (B) medium in bioreactor with ph controlled at Figure 5.8 Free cell fermentation of Ct ack-pcaa using CGM medium with xylose in bioreactor with ph controlled at Figure 5.9 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-pcaa in serum bottles. (continued) Figure 5.10 Free cell fermentation kinetics of CtΔack-pcaa in bioreactor with 150 µm MV Figure 6.1 Schematic plot for plasmid construction of Ptyr-bs2 and Pace-bs Figure 6.2 Confirmation of plasmid construction and transformation of Ptyr-bs2 and Pace-bs Figure 6.3 Figure 6.3 Fluorescence microscope analysis of Ct-pMTL82151, Ct-PaceBs2 and Ct-PtyrBs Figure 6.4 Promoter strength assay. The liner regression equations represent the correlation of cell density and fluorescence intensity for Ct-pMTL82151, Ct- PaceBs2 and Ct-PtyrBs2 during the exponential phase xvi

18 Chapter 1 : Introduction 1.1 Background Butanol production via fermentation used to be the second largest industrial fermentation process in the world (Jones and Woods, 1986). However, with the rapid developments in the petrochemical industry and the remarkable increase in sugar and starch prices during mid-twentieth century, this bioprocess was gradually replaced by petrochemical routes (Lee et al., 2008). Recently, the roller coaster rise and fall in crude oil prices and the concerns of sustainable development has brought biobutanol back into people s vision. Compared to the first-generation biofuel ethanol, butanol is more gasoline-like, as it has a higher energy content and lower volatility (Zhao et al., 2013). It is moderate in hygroscopicity and thus will not cause severe corrosion in existing oil pipelines as ethanol. Meanwhile, butanol can be directly used as a transportation fuel in current internal combustion engine without any mechanical modifications. With all these superiorities, butanol and other higher alcohols like isopropanol and isobutanol are believed to be good candidates to replace ethanol as liquid fuels or gasoline additives (Maingeuet and Liao, 2010). Butanol is naturally produced by certain solventogenic Clostridium species via acetone-butanol-ethanol (ABE) fermentation. In contrast to petrochemical processes, this biological method is more environmentally friendly and less restricted by raw material supply. Nowadays, ABE fermentation plants have been operating in China and Brazil using 1

19 corn, molasses or cassava as feedstocks (Green, 2011; Ni and Sun, 2009). Many large oil and chemical companies in the US including Chevron and DuPont have also exhibited interests in producing butanol through biological processes to break off current tight crude oil dependence and meet the projected energy demands. However, conventional ABE fermentation is not economically competitive with petrochemical routes. First, current biobutanol production utilizes food crops like sugarcane and cereal grains as feedstocks. The capital input for these substrates takes about 50%-70% of the overall production cost under current fermentation conditions (Green et al., 2011). Meanwhile, the collection and pretreatment techniques for more abundant feedstock like lignocellulosic biomass are not mature and economical enough to have industrial application. Second, conventional ABE fermentation suffers from low butanol titer, yield and productivity. Typically, solventogenic Clostridia produce ABE at a ratio of 3:6:1 to balance material and electrons, leading to the accumulation of acetone and ethanol in fermentation broth. The production of low-value byproducts including butyric acid, acetic acid, hydrogen, carbon dioxide, acetone and ethanol not only compromises butanol yield, but also increases energy consumption and cost for downstream product separation. In addition, the cytotoxicity of butanol on producing cells also contributes to low butanol titer and yield in ABE fermentation. As a solvent, butanol can penetrate into cell membrane bilayer, alter cell membrane fluidity, and disrupt cross-membrane proton gradient and membrane-bound ATPase activity (Sikkema et al., 1995). As a result, butanol producing Clostridia usually cannot survive at a butanol concentration higher than 15 g/l and hence, butanol production cannot surpass this level (Yu et al., 2011). Third, due to the low butanol 2

20 titer and its high boiling temperature, a large amount of energy is necessary to recover butanol from culture broth through current distillation strategy. It is estimated that about 15%-20% of the overall cost in industrial ABE fermentation process is attributed to steam generation, in which about 65% is distributed to distillation (Zhao et al., 2013). 1.2 Outline of tasks Therefore, the main objective of this project was to develop bacterial mutants and fermentation processes for stable and cost-effective higher alcohol production from inexpensive industrial byproducts. The major tasks and achievements in this work are discussed in Chapters 3-6 and summarized below: Chapter 3: Stable high-titer n-butanol production from sucrose and sugarcane juice by Clostridium acetobutylicum JB200 in repeated batch fermentations Clostridium acetobutylicum JB200, a mutant obtained from evolutionary mutagenesis, had high butanol tolerance and was capable of producing high-titer (>20 g/l) n-butanol from glucose. Although JB200 is a favorable host for industrial bio-butanol production, its fermentation performance with sucrose and sugarcane juice as substrates has not been well studied. In this chapter, the long-term n-butanol production from sucrose by JB200 was evaluated with cells immobilized in a fibrous-bed bioreactor (FBB), showing stable performance with high titer, yield and productivity for 16 consecutive batches over 800 h. Sugarcane thick juice as low-cost substrate was then tested in 3 consecutive batches, which gave similar n-butanol production, demonstrating that JB200 is a robust and promising strain for industrial ABE fermentation. 3

21 Chapter 4: Effects of external driving forces on redox balance and butanol production of engineered Clostridium tyrobutyricum mutant Clostrdium tyrobutyricum is an acidogenic strain which consumes hexose and pentose to produce butyric acid, acetic acid, CO2 and H2. In a previous study, we have constructed a mutant CtΔack-adhE2 by overexpressing adhe2 gene in Clostridium tyrobutyricum acetate knockout strain, which was able to produce ~10 g/l butanol as the main solvent product with no acetone and little ethanol. In this study, in order to further boost butanol production in CtΔack-adhE2, extra NADH driving forces provided by artificial electron carriers like methyl viologen (MV) and benzyl viologen (BV) were provided to direct more electrons and carbon towards butanol synthesis. Compared to the batches without MV and BV, significant increases in butanol titer and yield and decreases in acids and H2 generation were observed with MV or BV addition. Changes in oxidation / reduction potential (ORP) in experimental and control fermentation batches were also studied to disclose possible effect of artificial electron carriers on cell redox balance. Chapter 5: Metabolic and process engineering of Clostridium tyrobutyricum for isopropanol production Isopropanol is one of the most widely used solvents in the world. It is also one of the secondary alcohols that can be used as a direct or partial replacement for gasoline. In this work, the feasibility of engineering Clostridium tyrobutyricum to produce isopropanol was studied. Plasmids with isopropanol synthetic pathway genes were constructed and transformed into various C. tyrobutyricum strains. The abilities of isopropanol production of obtained mutants were compared. The effects of artificial electron carriers (MV and BV) 4

22 on isopropanol production were also tested. By adding MV to provide extra driving force, C. tyrobutyricum acetate kinase knockout strain with heterologous isopropanol producing genes was able to generate 4.28 g/l isopropanol in batch fermentation. Chapter 6: Development of an in vivo fluorescence-based gene expression reporter system for Clostridium tyrobutyricum Clostridium tyrobutyricum mutant strain CtΔack-adhE2 is able to produce butanol with high titer, yield and tolerance, indicating C. tyrobutyricum might be a good host for solvent production. However, the regulations of metabolic pathways in C. tyrobutyricum are not well studied due to the absence of complete genetic information and limited genetic engineering tools. In this study, a flavin mononucleotide (FMN) dependent fluorescent protein Bs2 based gene expression reporter system was developed to explore the in vivo strength and optimum functional time for various promoters in C. tyrobutyricum. Unlike green fluorescent protein and its derivatives, Bs2 can emit green light in the absence of oxygen, which makes it extremely suitable for promoter screening and transformation confirmation in organisms grown anaerobically. The expression levels of Bs2 under thiolase promoters from C. aectobutylicum and C. tyrobutyricum were measured and compared based on fluorescent intensity. The capacities of the two promoters in driving gene transcription in C. tyrobutyricum were distinguished, confirming that this reporter system is a convenient, effective and reliable tool for promoter strength assay. 5

23 Reference Green, E.M., Fermentative production of butanol-the industrial perspective. Curr. Opin. Biotechnol. 22, Jones, D.T., Woods, D.R., Acetone-butanol fermentation revisited. Microbiol. Rev. 50, Lee, S.Y., Park, J.H., Jang, S.H., Nielsen, L.K., Kim, J., Jung, K.S., Fermentative butanol production by Clostridia. Biotechnol. Bioeng. 101, Mainguet, S.E. Liao, J.C., Bioengineering of microorganisms for C3 to C5 alcohols production, Biotechnol. J. 5, Ni, Y., Sun, Z., Recent progress on industrial fermentative production of acetonebutanol-ethanol by Clostridium acetobutylicum in China. Appl. Microbiol. Biotechnol. 83, Sikkema, J., de Bont, J. A., Poolman, B., Mechanisms of membrane toxicity of hydrocarbons. Microbiol. Rev. 59, Yu, M., Zhang, Y., Tang, I., Yang, S.T., Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab. Eng. 13, Zhao, J., Lu, C., Chen, C.C., Yang, S.T., Biological production of butanol and higher alcohols. Bioprocessing Technologies in Biorefinery for Sustainable Production of Fuels, Chemicals, and Polymers, Wiley, Chapter 13, pp

24 Chapter 2 : Literature review 2.1 Biofuels and biobutanol Nowadays, transportation and many industrial procedures are highly dependent on petroleum based liquid fuels. These fuels are originally generated from remains of organisms during millions of years of fossilization on the earth. As a result, these energy resources are limited and vary significantly with geographic locations. In recent years, a dramatic rise in oil and petrol prices have been observed, resulting from deletion of sources, global unrest and rapid development in China and India., It is also proposed that the tremendous amount of CO2 formed from combustion of these fuels contributes remarkably to greenhouse effects as well as abnormal climate changes (Bose, 2010). All these concerns have put emphasis on developing new methods for green and renewable fuels. As a result, the idea of utilizing biomass-derived sugars to produce transportation biofuels via fermentation has gained its popularity. With the impetus provided by modern bioscience and biotechnology, bioethanol from engineered yeast and E. coli is the first one meet industrial manufacture requirements. However, given the shortcomings it comes along with, ethanol is not a promising candidate in replacing petrol. Firstly, it is low in energy density which means more ethanol will be consumed for driving the same distance, compared to gasoline. Thus, a larger oil tank or frequent fuel refills will be necessary. Secondly, ethanol is highly hygroscopic. It can be blended with water in any ratio and cause 7

25 severe corrosion on the current fuel pipelines. Thirdly, pure ethanol cannot be directly used in existing engines. Engine modification is required to combust ethanol as the sole fuel (Cascone, 2008). On the contrary, higher alcohols (carbon chain longer than two) such as isopropanol, n-butanol, and isobutanol are higher in energy content, lower in moisture absorption (see Table 2.1) and can be directly burned in current gasoline engines. Therefore, they are believed to be better choices for second generation transportation biofuels. Among these higher alcohols, butanol has received the most attention because it can be naturally produced at a relatively high yield by certain Clostridium strains (Keis et al., 2001). Clostridia are a class of rod-shaped, spore-forming bacteria. They are gram positive and grow in strictly anaerobic conditions. C. acetobutylicum, C. beijerinckii, C. saccharoperbutylacetonium and C. saccharobutylicum are considered as the major solventogenic Clostridia according to fingerprint analysis (Keis et al., 2001). Although they all generate butanol as one of the main products, they have different preferences for substrates and optimal ph, and their product spectra vary from strain to strain. Recent developments in metabolic engineering tools and systematic biology have facilitated the manipulation of the central metabolic pathways of these native producers to increase solvent generation as well as product selection. Other broadly used model systems like E. coli and yeast have also been engineered to produce higher alcohols via heterogenic gene overexpression and gene knockout. In this chapter, the recent progress in strain development and fermentation process optimization of these native or non-native alcohol producers is reviewed. In addition, upstream fermentation feedstock pretreatment and 8

26 downstream product recovery strategies utilized for economical solvent manufacture are also summarized. 2.2 C3-C4 alcohol production via fermentation In order to commercialize higher alcohols as fuels through fermentation process, bacterial strains with high titers, yields and productivities are highly desirable. As yield is a measurement of the amount of products obtained per gram substrate, strains with high yields can lower the overall cost, given the price of feedstock usually takes about 50%- 70% of the whole budget under current fermentation condition (Green et al., 2011). On the other hand, productivity indicates the speed of how fast products can be generated. Higher productivity will lead to more product formation, and thus, increase the profit in the same period of time. Therefore, obtaining strains with high solvent titers, yields and productivities is the ultimate goal of strain development to commercialize biofuels Strain development for n-butanol production Mutagenesis and screening of native producers for butanol production N-butanol is naturally produced by solventogenic Clostridia via Acetone-butanol-Ethanol (ABE) fermentation. This process is biphasic, which contains acidogenesis and solventogenesis (Gheshlaghi et al., 2009). In acidogenic phase, large amounts of acids, including acetic acid and butyric acid, as well as hydrogen and carbon dioxide are produced. Coupled with acids generation, large amount of ATPs are generated and cells grow exponentially. Then, the acidogenesis to solvntogenesis shift occurs, cells reassimilate the acids produced previously and start to produce acetone, ethanol and 9

27 butanol at a ratio of 3:1:6 (Jones and Woods, 1986) (Fig. 2.1). This transition is a complicated physiological event, involving global gene regulation, cell autolysis and endospore formation (Alsaker et al., 2010; Jones et al., 2008). During the shift, significant up-regulation of the solvent production related genes including aad, ctfab, adc and adhe has been observed in different Clostridium strains (Shi and Blaschek, 2008; Alsaker and Papoutsakis, 2005; Grimmler et al., 2011). It is also proposed that the onset of solventogenesis is influenced by various factors including extracellular environment, intercellular metabolites and redox balance (Ezeji et al., 2010; Nicolaou et al., 2010, Wietzke and Bahl, 2012). However, the detailed mechanism of how this metabolic shift occur is still not well studied. Given the complex metabolic pathway and its unknown regulation in solventogenic Clostridia, mutagenesis followed by screening has been extensively applied as an efficient method to obtain bacterial strains with desirable features. It was demonstrated that low butanol tolerance capacity of native producers was the bottleneck in boosting ABE fermentation. Butanol, as a lipophilic solvent, can penetrate into cell membrane and affect its fluidity and membrane-bound protein activities (like ATPase), and therefore, interfere normal cell metabolism (Bowles and Ellefson, 1985; Liyanage et al., 2000). Thus, high butanol tolerance is a prerequisite for high butanol production. Selecting mutants survived under butanol stress is a reasonable strategy for such strain improvement. Soucaille et al. first reported their success in obtaining a C. acetobutylicum strain G-1, which could tolerate and produce up to 13 g/l butanol, by passing its parental stain in serial serum tubes containing increased butanol concentrations (Soucaille et al., 1987). The same method was 10

28 utilized by Liyanage et al. on C. beijerinckii NCIMB 8052, and a remarkable increase in butanol tolerance was also achieved (Liyanage et al., 2000). Recently, by performing genome shuffling, Mao et al reported a C. acetobutylicum mutant which can tolerate up to 19 g/l butanol, but its butanol titer was 15.3 g/l (Mao, 2010). Although high butanol tolerance is necessary for high butanol production, it is not sufficient. In response to butanol challenge, an alteration of gene expression profile was observed in C. acetobutylicum (Borden and Papoutsakis 2007; Mao, 2010). These changes may enable cells to resist butanol in stress response, but not certainly lead to increase butanol production. Interestingly, the screening for non-spore forming and hyperamylolyic strains in Jain s and Blaschek s groups resulted in mutants with high butanol tolerance and production (Jain, 1993; Blaschek, 2002). It was reported that asporogenic C. acetobutylicum ATCC was able to produce 20.2 g/l butanol with highly enhanced butyrate uptaking rate (Jain, 1993). C. beijerinckii BA101 achieved butanol titer of 20.9 g/l in free cell fermentation (Blaschek, 2002). Although BA101 exhibited similar levels of acid production with its parental strain during acidogenesis, its conversion rate of acetic and butyric acids to solvents was much higher in solventogenic phase (Formanek et al., 1997). This outstanding capacity of BA101 in butanol production might have resulted from its usage of both phosphoenolpyruvate-dependent PTS and non PTS transport systems at the same time (Lee et al., 2008). Later on, a mutant strain JB200 with even better butanol production performance (24.1 g/l) was obtained using fibrous bed bioreactor (FBB) adaption (Zhao and Yang, 2009). Comparative proteomic analysis of JB200 identified seven highly 11

29 expressed proteins closely related to butanol tolerance (Yang and Zhao, 2013). In addition, the comparative genomic analysis between JB200 and its parental strain ATCC indicated that a truncation of a histidine kinase might play a crucial role in the significantly increased butanol tolerance and butanol production by JB 200 (unpublished data) Metabolic engineering of solventogenic Clostridia for higher alcohol production While mutagenesis and screening depend on obtaining the mutants with attractive phenotypes, metabolic engineering is directly targeted to get mutants by manipulating specific gene regulation. With the rapid development in gene modulation tools (Huang et al., 2010; Papoutsakis, 2008; Lee et al., 2008), metabolic engineering have become extremely powerful in understanding the physiology of solventogenic Clostridia and engineering current strains toward more butanol production. Substantial efforts had been dedicated to down-regulate acid and acetone production associated genes and/or upregulate solvent, especially butanol, producing pathways. Harris et al. down-regulated the buk gene, which is responsible for the conversion of butyryl-p to butyrate in C. acetobutylicum ATCC 824 and observed increase in both butanol (16.7 g/l) and total ABE titers (23.7 g/l) under ph higher than 5 (Harris et al., 2000). Desai and Papoutsakis attempted to restrain the same butyrate producing pathway by expressing specific antisense RNAs against buk and ptb genes (Desai and Papoutsakis, 1999). The enzyme activities of the butyrate kinase and phosphotransacetylase were decreased to 15% and 30%, respectively. Although the mutant with buk inactivation produced 50% and 35% more acetone and butanol, the generation of these two products was significantly hindered in the 12

30 strain transformed with ptb-asrna (Desai and Papoutsakis, 1999). Siller et al. overexpressed the primary alcohol/aldehyde dehydrogenase (aad) gene in a non-sporeforming, non-solvent-producing C. acetobutylicum M5 strain and successfully restored the butanol titer equal to wild type without acetone generation (Siller et al., 2008). Later on, the same group reported enhanced alcohol titers (30 g/l) as well as alcohol/acetone ratio in Clostridium acetobutylicum fermentation by down-regulating CoA transferase (ctfab) with antisense RNA and overexpressing aad and thiolase genes (Sillers et al., 2009). Other studies illustrated that transcriptional regulators may also play important roles in solvent production. Nair et al. discovered a transcriptional repressor SolR, whose gene was located upstream of the sol operon (including aad, ctfab and adc). The inactivation of solr by homologous recombination led to an earlier transcription of aad, and improved butanol (17.3 g/l) and total ABE (26.4 g/l) formation (Nair et al., 1999). When the aad gene was overexpressed in the solr knockout strain, a slightly decrease in butanol titer (17.1 g/l) but higher ABE production (27.5 g/l) was achieved (Harris et al., 2001). This was the highest butanol titer reported via metabolic engineering approach, which was still lower than the record of JB200 strain (24.1 g/l butanol) obtained from evolutionary mutagenesis. Later on, an extremely efficient gene knockout system was developed by Heap et al in By using group II introns in Clostridia, studies of single gene deletion were much easier than ever before (Heap et al., 2007; 2010). Jiang et al. took the advantage of this new strategy and successfully knocked out the adc gene in acetone producing pathway in C. acetobutylicum strain EA As a result, an increase in butanol/ethanol ratio from 70% to 80.05% was inspected (Jiang et al., 2009). 13

31 The completion of whole genome sequencing of model strain C. acetobutylicum ATCC 824 has enabled system-level analysis of gene regulation (Nolling et al., 2001). Genomewide transcriptome (Alsaker et al., 2004; Paredes et al., 2004; Tomas et al., 2004) and proteome (Sullivan and Bennett, 2006) studies have been conducted and the roles of proteins including chaperones, spore-forming and transcriptional regulators in solvent tolerance and production were unveiled. Tomas et al. demonstrated that with the overexpression of heat shock genes localized on groesl operon, the final solvent titers of C. acetobutylicum mutant were 40% higher than the wild type strain. They also compared the cdna microarray profiles of the mutant, the wild type and the control with empty vector and observed complicated gene expression shifts in different clusters (Tomas et al., 2003). Recent proteomic analysis of C. acetobutylicum also confirmed the up-regulation of GroES and GroEL during solventogenesis (Sullivan and Bennett, 2006). These results suggested that the carbon distribution in Clostridium is tightly regulated by many physiological aspects and hence, more sophisticated strategies are necessary to enhance butanol production while decreasing the generation of byproducts Metabolic engineering of non-native producers for higher alcohol production Since the genetics and physiology of native solventogenic Clostridia are complicated, efforts has been made to engineer non-native microorganisms for higher alcohol production. Most of the work has been done in model systems including E. coli and yeast, because they have relatively better studied genomic information and more efficient gene recombination tools (Mainguet and Liao, 2010). When the original butanol producing pathway from C. acetobutylicum was introduced into E. coli, only 14 mg/l butanol was 14

32 generated. Then, various gene overexpression and deletion were tested to select suitable enzymes to catalyze each step, reduce byproducts generation as well as increase cofactor availability. The replacement of thl gene from C. acetobutylicum with E. coli atob led to a 3-fold increase in butanol titer which was further boosted when the mutant was cultured in aerobic and semi-aerobic conditions (Atsumi et al., 2008a). In addition, increasing NADH supplement and glycolytic flux by overexpressing formate dehydrogenase (fdh) from S. cerevisiae and glyceraldehyde 3-phosphate dehydrogenase from E. coli also led to 87% and 15% butanol titer increases (Nielsen et al., 2009). A breakthrough occurred in Bond- Watts s study of converting a polyhydroxyalkanoates (PHAs) pathway into a butanol synthetic pathway. They first overexpressed phaa from Ralstonia ecurophus and hbd from C. acetobutylicum to generate (s)-3-hydroxybutyryl-coa as the precursor. Then, they constructed another plasmid to overexpress butanol synthetic genes including crt, hbd and adhe2 from C. acetobutylicum and NADH dependent crotonyl-coa specific trans-enoyl- CoA reductase (ter) from Treponema denticola. Finally, with the enhanced NADH availability resulted from overexpressing aceef-lpd operon, the mutant was able to produce 4.65 g/l butanol (Bond-Watts et al., 2011). Soon after, the highest butanol titer, about 15 g/l, in E. coli was achieved by replacing the pha and aceef.lpd with the fdh gene from Ralstonia eutrophus, coupled with NADH consuming reaction gene adhe, ldha, frdbc and pta deletion (Shen et al., 2011). The final butanol yield of this mutant reached about 80% of the theoretic maximum. These results highlighted the advantages of using E. coli as the host for metabolic pathway regulation study and indicated its potential in industrial butanol production. The butanol biosynthetic pathway as well as its optimized versions were also transferred to B. subtilis, P. putida and S. cerevisiae to take advantage 15

33 of their outstanding features including fast cell growth, easy gene manipulation and relatively high butanol tolerance (Fischer et al., 2008; Knoshaug and Zhang, 2009). But the final butanol titers of their mutants were far from satisfactory (0.12 g/l, 24 mg/l, 2.5 mg/l, respectively) (Nielsen et al., 2009; Steen et al., 2008). Clostridium tyrobutyricum is a non-spore forming acidogenic strain which does not have the shift from acidogensis to solventogenesis and associated cell autolysis. Yu et al. overexpressed the adhe2 gene from C. acetobutylicum in C. tyrobutyricum acetate kinase knockout strain and obtained a mutant capable of producing 10 g/l butanol from glucose with no acetone and little ethanol (0.7 g/l) generation (Yu et al., 2011). This feature is highly desirable in industrial butanol manufacture as it will significantly reduce the cost for product separation. The butanol titer was further increased to about 20.5 g/l, with a yield of 0.33 g/g and a productivity of 0.32 g/l h when more reduced mannitol was used as the substrate in batch fermentation (Yu et al., 2012). This data suggested that C. tyrobutyricum might be a good candidate for higher alcohol production. Besides butanol synthetic pathway originated from solventogenic Clostridia, other metabolic pathways were also engineered for higher alcohol production. Hazelwood et al. proposed a keto acid pathway based strategy for higher alcohol production (Hazelwood et al., 2008). It was demonstrated in S. cerevisiae that an n-carbon keto acid can be converted to an n-1 carbon alcohol catalyzed by a keto acid decarboxylase (KDC) followed by an alcohol dehydrogenase (ADH) (Mainguet and Liao, 2010). Since keto and 2-keto acids are naturally formed in microorganisms as part of the amino acids synthetic pathways, various higher alcohols are generated by introducing this KDC-ADH system into E. coli (Mainguet 16

34 and Liao, 2010). Among all of them, isobutanol production from valine and leucine biosynthesis reached the highest titer of 22 g/l (Atsumi et al., 2008b). Atsumi et al. overexpressed AlsS, and ilvih gene from B. Subtilis and ilvcd from E. coli to enhance substrate 2-keto-isovalerate generation, whereas pyruvate consumption pathway related genes including adhe, ldha, frdab, fnr, pta and pfl were deleted (Atsumi et al., 2008b). In their later study, in situ gas stripping was coupled with batch fermentation and a final titer of 50 g/l isobutanol was achieved (Baez et al., 2011). Meanwhile, up to 3.6 g/l 1-propanol, 0.8 g/l butanol, 1.25 g/l 2-methyl-1-butanol, 9.5 g/l 3-methyl-1-butanol and g/l 3-methyl-1-butanol were also generated in specifically engineered E. coli JCL16 mutant strains based on the same principle (Shen and Liao, 2008; Cann and Liao, 2008; Connor et al., 2010). Later on, this keto acid based strategy for isobutanol was also utilized in Corynebacterium glutamincum ATCC which led to a 4.9 g/l isobutanol titer with 23% of the theoretical maximum yield (Blombachb et al., 2011). However, when the same approach was introduced to S. elongatus, only 0.45 g/l isobutanol was obtained (Atsumi et al., 2009). In addition, Dellomonaco et al. reported another scheme for higher alcohol production by reversing the β-oxidation cycle for long-chain fatty acid synthesis in E. coli (Dellomonaco et al., 2011). In their study, two specific mutations on fadr and atoc(c) were first introduced to E. coli MG1655, which enabled the strain to constitutively express β- oxidation system genes in the absence of substrate fatty acids. Then, they replaced the native cyclic AMP (camp) receptor protein gene with a camp-independent mutant (crp*) to release catabolite depression. Combined with overexpression of an acyltransferase (yqef) and L-1, 2-propanediol oxidoreductase (fuco), and deletion of two dehydrogenase (eute and yqhd) and other fermentative pathways (adhe, pta and frda), the mutant was 17

35 able to produce about 14 g/l butanol with 0.33 g/g yield using glucose (Dellomonaco et al., 2011). These data suggested that E. coli could be promising as a host for higher alcohol production, given its well-known genomic information and abundant gene manipulation tools. Although tremendous efforts has been contributed to develop new mutant strains via metabolic engineering, their highest butanol titers still cannot surpass the mutants obtained from traditional mutagenesis and screening (like JB200, with the highest butanol titer of 24.1 g/l). Therefore, better understanding of the characteristics of metabolic enzymes, systematic information of how the targeted pathways are regulated as well as development of more powerful genetic manipulation tools are necessary for further utilizing metabolic engineering to generate mutants with better performance. Isopropanol is another higher alcohol that can be used as an additive to gasoline (Peralta- Yahya and Keasling, 2010). It is superior to methanol in esterifying fats and oils because its branched chain can reduce the crystallization temperature of biodiesel (Lee et al., 1995). In addition, isopropanol can be dehydrated to propylene, which is one of the most important starting chemicals in industry (Inokuma et al., 2010). Some Clostridium strains are native isopropanol producers, with the highest titer of about 2 g/l (George et al., 1983). Metabolic engineering was also utilized in improving isopropanol production. C. acetobutylicum ATCC 824, a previous ABE producer, was transformed with a dehydroegenase (adh) from C. beijerinckii NRRL B593, and was able to convert more than 95% acetone to isopropanol (Collas et al., 2012). By overexpressing an acetoacetate decarboxylase (adc) and a CoA transferase (ctfab) along with adh, the transformant was capable of generating 24.4 g/l total IBE, including 8.8 g/l isopropanol (Collas et al., 18

36 2012). Similar study was performed in Lee s group, in which ctfab, adc and adh were driven by adc promoter and transformed into a butyrate kinase (buk) gene knocked out Clostridium acetobutylicum strain (Lee et al, 2012). These pathway manipulations led to 20.4 g/l total IBE, including 5.1 g/l isopropanol production (Lee et al., 2012). Moreover, Dusseaux et al. replaced the previous solventogenic promoter with constitutive thiolase (thl) promoter, resulting in about 4.75 g/l isopropanol but higher total solvent yield and productivity (Dusseaux et al., 2013). In addition, it was demonstrated that Clostridium acetobutylicum transformed with C. beijerinckii sadh and hydg was able to produce 27.9 g/l IBE in batch scale fermentation and its alcohol yield was further improved to 0.37 g/g in 200 L pilot-scale fermenter (Jang et al., 2013). The isopropanol synthetic pathway was also introduced to many other organisms to test their feasibilities in isopropanol production. Hanai et al. first demonstrated that with overexpression of C. acetobutylicum thl, E. coli atoad and C. beijerinckii adh genes, an E. coli mutant was able to produce 4.9 g/l isopropanol, which exceeded the maximum titer of native producers (Hanai et al., 2007). Almost at same time, Jojima et al. claimed their success in fed batch fermentation of genetic engineered E. coli strain JM109 which could produce up to g/l isopropanol by transformed with a similar set of genes (Jojima et al., 2007). Furthermore, since the accumulation of isopropanol inhibited its own production, in situ gas stripping was integrated with fed batch fermentation of engineered E. coli strain TA76, which resulted in a total 143 g/l isopropanol titer with a yield of 67.4% (mol/mol) in 240 h (Inokuma et al., 2010). Lately, the same pathway was expressed in yeast Candida utilis (Tamakawa et al., 2013). The initial isopropanol titer was 1.2 g/l with ph 19

37 control, and was boosted to 9.5 g/l in free cell and 27.2 g/l in fed-batch fermentation with extra acetyl-coa synthetase gene expressed (Tamakawa et al., 2013). Moreover, Grousseau et al. performed codon optimization of the Clostridium adc and adh genes and expressed them in Cupriavidus necator strain Re2133. The mutant achieved 3.44 g/l isopropanol titer with only 0.82 g/l biomass formation using fructose as sole carbon source (Grousseau et al., 2014). It should be noted that redox balance also plays an important role in isopropanol synthesis as NADPH is a cofactor in the reaction. However, while the redox status can be easily balanced in producing alcohols with even number carbons using glucose, the mechanism of how it is regulated in producing alcohols with odd number remains unknown (Mainguet and Liao, 2008) Process development for n-butanol production In order to maximize the potential of microbial strains in solvent production, the fermentation process needs to be optimized and precisely controlled. Batch fermentation with ph control is the most common strategy used in industry because it is easy to perform and has less risk in contamination (Lee et al., 2008). However, due to the lag phase at the beginning of each batch, as well as the cleaning and re-filling time in between, batch fermentation suffers from low productivity (Lee et al., 2008). On the other hand, continuous fermentation, in which sterilized nutrient solution is continuously added to the bioreactor while an equivalent amount of used medium with bacteria is simultaneously removed from the system, can eliminate the lag phase time and increase productivity. Based on biphasic characteristic of ABE fermentation, Ramey claimed a patent of high butanol productivity (about 8 g/l h) in two stage continuous fermentation (Ramey, 1998). 20

38 In the first stage, acidogenic C. tyrobutyricum ATCC was cultured to produce high levels of acetic and butyric acids, while in the second reactor, these acids were reasimilate by C. acetobutylicum ATCC 4259 to generate solvents. Moreover, fed-batch fermentation was applied to reduce substrate inhibition and promote cell growth. Tashiro et al. illustrated that by maintaining a constant ph and butyric acid level, and adding glucose at a butyric acid/glucose ratio equivalent to 1.4, C. saccharoperbutylacetonicum N1-4 was able to produce 16 g/l butanol with 0.55 g/g yield (Tashiro et al., 2004). Compared to free cell, fermentation with cell immobilization and recycling was proved to be superior in promoting cell renewal as well as solvent production. Low cell density resulted from butanol cytotoxicity was reported to be one of the major drawbacks in ABE fermentation (Durre, 1998; Ezeji et al., 2010). However, previous studies indicated that when cells are adsorbed or entrapped by a supporting material, their growth and proliferation rate would be promoted (Zhao et al., 2013). In the meantime, cell recycling using a filter membrane to retain cells in the bioreactor in continuous fermentation can prevent loss of working cells. Therefore, utilizing cell immobilization or cell recycling can increase cell density and thus, increase the reactor productivity. Pierrrot et al. first reported using a hollow-fiber ultrafilter to separate and recycle cells in Clostridium acetobutylicum continuous fermentation (Pierrrot et al., 1986). At a dilute rate of 0.5 h -1, 20 g/l cell mass and a total solvent titer of 13 g/l with a productivity of 6.5 g/l h were achieved which was much higher than the productivity in batch fermentation (usually g/l h). Qureshi et al. immobilized cells onto clay brick particles in continuous ABE fermentation of C. berjerinckii BA101, in which the total solvent productivity reached 15.8 g/l h with 7.9 g/l 21

39 ABE titer and a yield at 0.38 g/g (Qureshi et al., 2000). Although it seemed that a significant amount of biomass in the bioreactor was in spores but not in solventogenic cells, the high productivity indicated that cell immobilization might be a good approach for industrial fermentation process (Qureshi et al., 2000; Lee et al., 2008). Moreover, it was illustrated that cell immobilization using fibrous-bed bioreactor boosted solvent production of C. acetobutylicum JB200. A total 40.3 g/l solvents with 0.43 g/g yield and 0.4 g/l h productivity was obtained and the butanol titer was as high as 24.1g/L (Zhao and Yang, 2009). This is the highest butanol and total solvent titers reported in single batch without product removal. It might be due to the high solvent tolerance of JB200 achieved following the rule of survival of the fittest, as cells that cannot survive under high level of solvents would be eliminated in FBB (Yang, 1996). Meanwhile, scanning electron microscope unveiled that the cotton towel wrapped in FBB provided highly porous surface areas for cells to attach on (Fig. 2.2). The condensed cell density in fibrous bed might result in local high acids concentration and therefore lead to an early onset of solventogenesis. Modulating redox balance was also proved to be a useful approach in process optimization, because reduced NAD(P)H are cofactors for butanol production. It was claimed that by sparging H2 into Clostridium acetobutylicum culture broth, the butanol and ethanol yields were increased by 18% and 13%, while acetone and H2 production was hindered (Yerushalmi et al., 1985). It was proposed that as partial H2 pressure was increased, the activity of hydrogenase was arrested by product inhibition. Thus, more electrons were flowed to generate reduced NADH which directed carbon flux toward solvent production (Rao and Mutharasan, 1986). Meanwhile, when a mixture of glucose and glycerol was used 22

40 as the substrate, Clostridium acetobutylicum shifted from a sole acidogenic strain to solvent producer at neutral ph (Vasconcelos et al., 1994). This might be due to the more reduced status of glycerol, which led to the activation of ferrodoxin NAD + reductase and a 7-fold increase in NADH level (Vasconcelos et al., 1994). Recently, Wang et al. utilized trace oxygen and cysteine to control ORP at -290 mv in C. acetobutylicum DSM 1731 ABE fermentation and observed an early onset of solventogenesis and a 35% increase in total solvent production as compared to the batch without ORP control (Wang et al., 2012). The redox regulation also led to a change in solvent ratio from 25:64:11 for acetone:butanl:ethanol in no controlled batch to 11:66:23 in the controlled one. This study demonstrated the importance of redox status in solvent production and provided insights into using redox engineering as a strategy to increase butanol production. Moreover, previous studies manifested that artificial electron carriers like methyl viologen (MV), benzyl viologen (BV) were capable of modulating electron flow from hydrogen generation to butanol formation in Clostridium acetobutylicum (Rao and Mutharasan, 1987; Peguin et al., 1994; Peguin and Soucaille, 1995). In Du et al. s study, the butanol yield was boosted to 0.29 g/g from 0.13 g/g by adding 500 µm MV in batch fermentation of C. tyrobutyricum ack with adhe2 overexpression while the yields of butyric acid, ethanol and acetic acid were only 0.03, 0.02 and 0.01 g/g, respectively (Du et al., 2013). These results showed that adding external electron carrier is an easy but extremely efficient process optimization method to increase butanol yield by reducing byproducts generation, which is highly desirable in industrial butanol manufacture. 23

41 2.3 N-butanol production from alternative feedstock Butanol production via fermentation using conventional feedstock suffers from high raw material cost as well as limited availability of substrates (Kumar and Gayen, 2011; Jang et al., 2012). It was estimated that about 60% to 70% of the product cost can be attributed to feedstock from corn or cassava via conventional ABE fermentation (Green, 2011). The high substrate cost significantly hinders the economic competitiveness of biobutanol against producing butanol through petrochemical process (Durre, 2007; Green, 2011). Recently, sugar and starch-based agricultural residues and industrial byproducts like molasses, bagasse were tested for butanol production. It was reported that both C. saccharobutylicum DSM and C. beijerinckii NCP P260 were able to use cane molasses to produce solvents with butanol titer at 11.9 g/l and 14.2 g/l, respectively (Ni et al., 2012; Shaheen et al., 2000). In Thang et al. s study, corn and cassava starch were used as feedstock for butanol production by C. saccharoperbutylacetonicum N1-4. Similar fermentation performance including butanol (16.2 g/l, 16.9 g/l), solvent titers (20.7 g/l, 21 g/l), and ABE yield (0.48 g/g, 0.41 g/g) were observed (Thang et al., 2010). Meanwhile, it was demonstrated that super solventogenic strain C. beijerinckii BA101 could utilize a wide range of renewable materials including soy molasses (Qureshi et al., 2001), degermed corn (Campos et al., 2002), packing peanut (Jesse et al., 2002), and maltodextrin (Parekh and Blaschek, 1999) as carbon sources to produce high titers of solvents (more than 19 g/l). In addition, Lu et al. claimed a butanol titer of 20.3 g/l, with 33.9 g/l ABE titers, 0.39 g/g ABE yield and 0.62 g/l h ABE productivity by C. acetobutylicum JB200 using cassava bagasse and glucose as the feedstock (Lu et al., 2012). This is the best fermentation 24

42 performance of using renewable materials in butanol production reported so far. However, the utilization of these feedstock like corn and sugar may cause food shortage, and hence, has already raised an intensive debate over food or fuel (Kumar and Gayen, 2011). Meanwhile, limited raw material availability due to regional plant cultivation may restrict these biomasses to be applied in large scale butanol production (Searchinger et al., 2008). Therefore, alternative feedstock that are cheap, abundant, and non-food based are urgently needed (Tracy et al., 2012; Jang et al., 2012). Lignocellulose based materials like woody biomass and agricultural wastes are thus considered as next generation feedstock, because they are the most abundant resources on the earth and widely available. It is worth noted that although some clostidium strains express membrane-bound or secretory endoglucanase and cellubiase, their abilities in directly using cellulosic materials are very limited (Kim et al., 1994; Perret et al., 2004). Therefore, in order to release sugars from these cellulosic biomasses for fermentation purpose, one or combined pretreatments are usually needed. Corn-derived wastes like corn fiber (Qureshi et al., 2008a; Guo et al., 2013; Du et al., 2013), corn stover (Qureshi et al., 2010a; Ni et al., 2012; He and Chen, 2012), and corncob (Zhang et al., 2013) were extensively studied as cost-effective substrates for butanol production by various strains. Among all these, Qureshi et al. reported the highest ABE titer (26.3 g/l) with inhibitor removed corn stover hydrolysate in ABE fermentation by C. beijerinckii P260, while the control batch with glucose produced 21.1 g/l (Qureshi et al., 2010a). Interestingly, There was no cell growth and solvent production observed when the same fermentation was conducted without inhibitor removal by Ca(OH)2 (Qureshi et al., 2010a). In addition, straw-type of cellulosic materials were also studied. 25

43 There were reports about solvent production utilizing rice straw (Al-Shorgani et al., 2012), wheat straw (Qureshi et al., 2007; 2008a, 2008b, 2008c), barley straw (Qureshi et al., 2010b) and switchgrass (Qureshi et al., 2010b). These studies were mainly done by Qureshi s group using C. beijerinckii P260. When wheat straw was investigated, as high as g/l ABE was produced with 0.42 g/g yield and 0.60 g/l h productivity, indicating it was a good candidate as alternative feedstock for solvent production (Qureshi et al., 2007). It was also demonstrated that utilizing dilute sulfuric acid treated barley straw, C. beijerinckii P260 could produce 7.09 g/l ABE with 0.33 g/g yield and 0.10 g/l h (Qureshi et al., 2010b). However, when the inhibitors were removed by Ca(OH)2, the ABE titer, yield and productivity were boosted to g/l, 0.43 g/g and 0.39 g/l h (Qureshi et al., 2010b). The importance of inhibitor removal was also exhibited when switchgrass hydrolysate was used as the substrate. The ABE titer was increased by 10-fold after the initial hydrolysate was diluted and extra glucose was added (Qureshi et al., 2010b). These inhibitors are generated in the process of biomass pretreatments with weak acids or enzymes, when cellulosic structures were broken down to fermentable sugars. They were classified into four groups as aldyhydes, ketones, organic acids and phenols and have various inhibitory effects on cell growth, substrate utilization, enzymatic activities and protein and RNA synthesis (Khan and Hadi, 1994; Modig et al., 2002; Liu and Blaschek, 2010). These inhibitors can be removed by physical, chemical or biological processes like vacuum evaporation, alkali precipitation. However, the efficiency of each inhibitor removal process varies according to the types of hydrolysate. Hence, a combination of different methods is more effective than one method alone in removing inhibitory chemicals from diverse categories (Liu and Blaschek, 2010). The necessity of 26

44 pretreatments and inhibitor removal in utilizing cellulosic feedstock as substrates have compromised their wide availability and inexpensiveness, and more studies are required to make this process more efficient and economically attractive (Ezeji et al., 2007; Weber et al., 2010). Table 2.2 summarizes ABE production by solventogenic Clostridia from various feedstocks. 2.4 In situ product separation It was reported that the separation cost for butanol recovery from ABE fermentation broth can be reduced by 50% if the final butanol titer is increased from 12 g/l to 19 g/l (Papoutsakis et al., 2005). However, only a few Clostridium strains can survive under more than 15 g/l butanol, because butanol at concentrations above 1% (v/v) is highly toxic to cells and can cause significant growth inhibition and cell death (Liu and Qureshi, 2009; Kumar and Gayen, 2011). Therefore, butanol recovery using conventional distillation suffers from a high handling cost due to low butanol titer in broth (Lee et al., 2008). To solve this problem, in situ butanol separation processes were integrated with batch fermentation to remove butanol simultaneously with its production. As butanol is efficiently extracted, the butanol concentration in the culture broth can be maintained below the threshold of strain s tolerance. Thus, the butanol induced inhibition is alleviated and the solventogenic phase is elongated for more solvent production. Till now, various in situ butanol recovery processes have been studied and each of them has its own advantages and disadvantages (Table 2.3). Gas stripping is a simple but efficient process to recover butanol simultaneously during fermentation process. Sterilized nitrogen or fermentation gases like H2 and CO2 are 27

45 bubbled into fermentation broth to strip out dissolved acetone, ethanol and butanol. Then the ABE in the gas are recovered from saturated gas phase by passing through a cooled condenser (Fig. 2.3) (Ezeji et al., 2010; Lee et al., 2008). The temperature of the condenser needs to be precisely controlled at around 1-2 C. Although it was demonstrated that lower the temperature, more the butanol collected from the gas phase, product selectivity is decreased when temperature is lower than -10 C (Xue et al., 2012). Gas stripping has been broadly applied in many studies to promote solvent production. Ezeji et al. integrated gas stripping system with batch, fed batch and continuous fermentation of P2 medium by C. beijerinckii BA101 and observed significant increases in ABE titers, yields and productivities (Ezeji et al., 2003b, 2004a; 2004b). Recently, by coupling a novel one stage continuous fermentation with gas stripping, a total of g/l ABE with a yield of 0.4 g/g and 0.91 g/l h productivity was achieved within 504 h by C. beijerinckii BA101 (Ezeji et al., 2013). Although gas stripping is effective in extracting solvents out of culture broth, it cannot collect the butanol remains in the fermentation broth and does not have selectivity over solvents. Thus, further separation processes are required to recover the remaining solvents, as well as extract butanol out of the condensate if purity is required. Moreover, the efficiency of gas stripping highly depends on the solvent concentrations in the solution. High speed gas circulation is necessary to extract solvent in low level and thus, is energy intensive. Xue et al. utilized a two-stage gas stripping method, in which first gas stripping was conducted to generate a concentrated ABE-water mixture (containing g/l butanol, g/l ABE) and another gas tripping was carried out to obtain the final g/l butanol, g/l total ABE solution. By using this strategy, 90% energy cost could be saved compared to batch fermentation without gas stripping but only distillation (Xue 28

46 et al., 2013). Pervaporation is a membrane-based technique that allows volatile components to diffuse through a membrane and get concentrated in a following condenser (Qureshi et al., 1992; Vane, 2005). There are three steps in this process. First, the solvent in the vapor is adsorbed onto the upstream surface of the membrane. Then, the solvent diffuse through the membrane. Finally, the dissolved solvents are absorbed into permeate vapor at the other side of the membrane and carried to cooled condenser (Shao and Huang, 2007). The most commonly used pervaporation membrane material is polydimethilsiloxane (PDMS), which has 6 to 8-fold more separation factor for butanol-water than for ethanol-water (Vane, 2005). Because pervaporation is simple to operate and have high selectivity over solvents, it was proposed to be a promising separation process for butanol production (Liu and Feng 2005; Thongsukmaka and Sirkar, 2007; Tong et al., 2010). Nevertheless, improved membrane material and/or process control are still necessary to solve membrane clogging and fouling problems. Liquid-liquid extraction or perstraction is a method of separation based on different solubility of chemicals in water and an organic phase (Ezeji et al., 2010; Vane, 2008). Butanol is less soluble in water than in extractant. Thus, ABE are extracted from the aqueous phase (culture broth), concentrated in the organic extractant, and separated by following methods. In Roffler et al. s study, six solvents or combinations were investigated in extractive fermentation. It unveiled that oleyl alcohol or a combination of oleyl alcohol and benzyl benzoate had the highest efficiency in removing butanol from culture broth and therefore improved the butanol productivity by 60% (Roffler et al., 1987a; 1987b). Liquid- 29

47 liquid extraction has its own disadvantages which include high cost, extractant toxicity toward bacteria, generation of an emulsion and accumulation of cells in the interphase between fermentation broth and extractant (Ezeji et al., 2010). Perstraction was performed to avoid extractant cytotoxicity by employing a membrane contactor (Roffler et al., 1987a; 1987b; Qureshi et al., 1992). It can significantly reduce emulsion, interphase layer formation and phase dispersion, because it prevents direct contact of the two phases (Ezeji et al., 2010). However, like pervaporation, perstraction also suffers from membrane fouling (Ezeji and Li, 2010). The high cost of the membrane and extractant make it less favorable in industrial application. Adsorption is another useful separation process in which certain chemicals are bound to the surface of adsorbent by either chemical or physical attraction. The performance of adsorption highly depends on the interaction between the adsorbent and butanol. Thus, various materials including hydrophobic zeolites, activated carbon and resin has been investigated for their feasibilities in butanol separation (Groot et al., 1992; Oudshoorn et al., 2009; Nielsen and Prather, 2009). References Alsaker, K.V., Papoutsakis, E.T., Transcriptional program of early sporulation and stationary-phase events in Clostridium acetobutylicum. J. Bacteriol. 187, Alsaker, K.V., Paredes, C., Papoutsakis, E.T., Metabolite stress and tolerance in the production of biofuels and chemicals: Gene-expression-based systems analysis of butanol, butyrate, and acetate stresses in the anaerobe Clostridium acetobutylicum. Biotechnol. Bioeng. 105, Alsaker, K., Spitzer, T., Papoutsakis, E.T., Transcriptional analysis of spo0a over expression in Clostridium acetobutylicum and its effect on the cell's response to butanol stress. J. Bacteriol. 186,

48 Al-Shorgani, N.K., Kalil, M.R., Yusoff, W.M., Biobutanol production from rice bran and de-oiled rice bran by Clostridium saccharoperbutylacetonicum N1-4. Bioproc. Biosyst. Eng. 35, Atsumi, S., Cann, A.F., Connor, M.R., Shen, C.R., Smith, K.M., Brynildsen, M.P., Chou, K.J.Y., Hanai, T., Liao, J.C., 2008a. Metabolic engineering of Escherichia coli for 1- butanol production, Metab. Eng. 10, Atsumi, S., Hanai, T., Liao, J., 2008b. Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature. 451, Atsumi, S., Higashide, W., Liao, J., Direct photosynthetic recycling of carbon dioxide to isobutyraldehyde. Nat. Biotechnol. 27, Baez, A., Cho, K., Liao, J., High-flux isobutanol production using engineered Escherichia coli: a bioreactor study with in situ product removal, Appl. Microbiol. Biotechnol. 90, Berezina, O.V., Zakharova, N.V., Brandt, A., Yarotsky, S.V., Schwarz, W.H., Zverlov, V.V., Reconstructing the clostridial n-butanol metabolic pathway in Lactobacillus brevis. Appl. Microbiol. Biotechnol. 87, Blaschek, H.P., Method of producing butanol using a mutant strain of Clostridium beijerinckii. US Blombach, B., Riester, T., Wieschalka, S., Ziert, C., Youn, J.W., Wendisch, V.F., Eikmanns, B., Corynebacterium glutamicum tailored for efficient isobutanol production. Appl. Environ. Microbiol. 77, Bond-Watts, B.B., Bellerose, R.J., Chang, M.C., Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways. Nat. Chem. Biol. 7, Borden, J.R., Papoutsakis, E.T., 2007, Dynamics of genomic-library enrichment and identification of solvent tolerance genes for Clostridium acetobutylicum. Appl. Environ. Microbiol. 73, Bullifent, H.L., Moir, A., Titball, R.W., The construction of a reporter system and use for the investigation of Clostridium perfringens gene expression. FEMS Microbiol. Lett. 131, Campos, E.J., Qureshi, N., Blaschek, H.P, Production of acetone butanol ethanol from degermed corn using Clostridium beijerinckii BA101. Appl. Biochem. Biotechnol. Part A Enz. Eng. Biotechnol , Cann, A.F., Liao J.C., Production of 2-methyl-1-butanol in engineered Escherichia coli. Appl. Microbiol. Biotehnol. 81,

49 Cascone, R., Biobutanol-A replacement for bioethanol? Chem. Eng. Prog. 104, S4- S8. Chang, W., Acetone-butanol-ethanol fermentation by engineered Clostridium beijerinckii and Clostridium tyrobutyricum, PhD dissertation, Ohio State University, Columbus, OH, USA. Chen, W.H., Chen, Y.C., Lin, J.G., Evaluation of biobutanol production from nonpretreated rice straw hydrolysate under non-sterile environmental conditions. Bioresour. Technol. 135, Chudakov, D.M., Lukyanov, S., Lukyanov, K.A., Fluorescent proteins as a toolkit for in vivo imaging. Trends Biotechnol. 23, Collas, F., Kuit, W., Clément, B., Marchal, R., López-Contreras, A.M., Monot, F., Simultaneous production of isopropanol, butanol, ethanol and 2, 3-butanediol by Clostridium acetobutylicum ATCC 824 engineered strains. AMB Express, 2, Connor, M.R., Cann, A.F. and Liao, J.C., Methyl-1-butanol production in Escherichia coli: random mutagenesis and two-phase fermentation. Appl. Microbiol. Biotechnol. 86, Dellomonaco, C., Clomburg, J.M., Miller, E.N., Gonzalez, R., Engineered reversal of the beta-oxidation cycle for the synthesis of fuels and chemicals. Nature. 476, Drepper, T., Eggert, T., Circolone, F., Heck, A., Krauß, U., Guterl, J.K., Wendorff, M. Losi, A., Gärtner, W. Jaeger, K.E., Reporter proteins for in vivo fluorescence without oxygen. Nat. Biotechnol. 25, Drepper, T., Huber, R., Heck, A., Circolone, F., Hillmer, A. K., Büchs, J., Jaeger, K. E., Flavin mononucleotide-based fluorescent reporter proteins outperform green fluorescent protein-like proteins as quantitative in vivo real-time reporters. Appl. Environ. Microbiol. 76, Du, Y., High-yield and high-titer n-butanol producttion from lignocellulosic feedstocks by metabolically engineered Clostridium tyrobutyricum. PhD dissertation, Ohio State University, Columbus, OH, USA. Du, T,. He, A., Wu, H., Chen, J., Kong, X., Liu, J., Jiang, M., Ouyang, P., Butanol production from acid hydrolyzed corn fiber with Clostridium beijerinckii mutant. Bioresour. Technol. 135, Dürre, P., New insights and novel developments in clostridial acetone/butanol/isopropanol fermentation. Appl. Microbiol. Biotechnol. 49, Dürre, P., Biobutanol: an attractive biofuel. Biotechnol. J. 2,

50 Dusséaux, S., Croux, C., Soucaille, P., Meynial-Salles, I., Metabolic engineering of Clostridium acetobutylicum ATCC 824 for the high-yield production of a biofuel composed of an isopropanol/butanol/ethanol mixture. Metab. Eng., 18, 1-8. Evans, P.J, Wang, H.W., Enhancement of butanol fermentation by Clostridium acetobutylicum in the presence of decanol-oleyl alcohol mixed extractants. 54, Ezeji, T.C., Milne, C., Price, N.D., Blaschek, H.P., Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl. Microbiol. Biotechnol. 85, Ezeji, T.C., Groberg, M., Qureshi, N., Blaschek, H.P., 2003a. Continuous production of butanol from starch-based packing peanuts. Appl. Biochem. Biotechnol. Part A Enz. Eng. Biotechnol. 106, Ezeji, T.C., Qureshi, N., Blaschek, H.P., 2003b. Production of acetone, butanol and ethanol by Clostridium beijerinckii BA101 and in situ recovery by gas stripping. World J. Microbiol. Biotechnol. 19, Ezeji, T.C., Qureshi, N., Blaschek, H.P., 2004a. Acetone butanol ethanol (ABE) production from concentrated substrate: Reduction in substrate inhibition by fed-batch technique and product inhibition by gas stripping. Appl. Microbiol. Biotechnol. 63, Ezeji, T.C., Qureshi, N., Blaschek, H.P., 2004b. Butanol fermentation research: Upstream and downstream manipulations. Chem. Rec. 4, Ezeji, T.C, Qureshi, N., Blaschek, H.P., Production of acetone butanol (AB) from liquefied corn starch, a commercial substrate, using Clostridium beijerinckii coupled with product recovery by gas stripping. J. Ind. Microbiol. Biotechnol. 34, Ezeji, T.C, Qureshi N, Blaschek H.P., Microbial production of a biofuel (acetonebutanol-ethanol) in a continuous bioreactor: impact of bleed and simultaneous product removal. Bioproc. Biosys. Eng. 36, Ezeji T.C., Qureshi N, Karcher P.M., Blaschek H.P, Improving the performance of a gas stripping-based recovery system to remove butanol from Clostridium beijerinckii fermentation. Bioproc. Biosys. Eng. 27, Fischer, C., Klein-Marcuschamer, D., Stephanopoulos, G., Selection and optimization of microbial hosts for biofuels production. Metab. Eng. 10, Formanek, J., Mackie, R., Blaschek, H.P, Enhanced butanol production by Clostridium beijerinckii BA101 grown in semidefined P2 medium containing 6 percent maltodextrin or glucose. Appl. Environ. Microbiol. 63,

51 Fradkov, A.F., Verkhusha, V.V., Staroverov, D.B., Bulina, M.E. Yanushevich, Y.G. Martynov, V.I., Lukyanov, S., Lukyanov. K.A., Far-red fluorescent tag for protein labelling. Biochem. J. 368, George, H.A., Johnson, J.L., Moore, W.E.C., Holdeman, L.V., Chen, J.S., Acetone, isopropanol, and butanol production by Clostridium beijerinckii (syn. Clostridium butylicum) and Clostridium aurantibutyricum. Appl. Environ. Microbiol. 45(3), Gheshlaghi, R., Scharer, J.M., Moo-Young, M., Chou, C.P., Metabolic pathways of clostridia for producing butanol. Biotechnol. Adv. 27, Green, E.M., Fermentative production of butanol-the industrial perspective. Curr. Opin. Biotechnol. 22, Grimmler, C., Janssen, H., Krauβe, D., Fischer, R.J., Bahl, H., Dürre, P., Liebl, W., Ehrenreich, A., Genome-wide gene expression analysis of the switch between acidogenesis and solventogenesis in continuous cultures of Clostridium acetobutylicum. J. Mol. Microbiol. Biotechnol. 20, Groot, W.J., van den Oever, C.E., Kossen N.W.F., 1984, Pervaporation for simultaneous product recovery in the butanol/isopropanol batch fermentation. Biotechnol. Lett. 6, Grousseau, E., Lu, J., Gorret, N., Guillouet, S. E., Sinskey, A. J., Isopropanol production with engineered Cupriavidus necator as bioproduction platform. Appl. Microbiol. Biotechnol. 98, Guo, T., He, A., Du, T., Zhu, D., Liang, D., Jiang, M., Wei, P., Ouyang, P., Butanol production from hemicellulosic hydrolysate of corn fiber by a Clostridium beijerinckii mutant with high inhibitor-tolerance. Bioresour. Technol. 135, Hanai, T., Atsumi, S., Liao, J.C., Engineered synthetic pathway for isopropanol production in Escherichia coli. Appl. Environ. Microbiol. 73, Harris, L., Blank, L., Desai, R.P., Welker, N.E., Papoutsakis, E.T., Fermentation characterization and flux analysis of recombinant strains of Clostridium acetobutylicum with an inactivated gene. J. Ind. Microbiol. Biotechnol. 27, Harris, L.M., Desai, R.P., Welker, N.E., Papoutsakis, E.T., Characterization of recombinant strains of the Clostridium acetobutylicum butyrate kinase inactivation mutant: Need for new phenomenological models for solventogenesis and butanol inhibition? Biotechnol. Bioeng. 67, Hazelwood, L.A., Daran, J.M., Van Maris, A.J.A., Pronk, J.T., Dickinson, J.R., The Ehrlich pathway for fusel alcohol production: A century of research on Saccharomyces cerevisiae metabolism. Appl. Environ. Microbiol. 74,

52 He, L., Wu, X., Simone, J., Hewgill, D., Lipsky, P.E., Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP YFP mrfp FRET detected by flow cytometry. Nucleic Acids Res. 33, e61-e61. He, Q., Chen, H., Improved efficiency of butanol production by absorbed lignocellulose fermentation. J. Biosci. Bioeng. 115, Heap, J.T., Pennington, O.J., Cartman, S.T., Carter, G.P., Minton, N.P., The ClosTron: A universal gene knock-out system for the genus Clostridium. J. Microbiol. Methods 70, Heap, J.T., Kuehne, S.A., Ehsaan, M., Cartman, S.T., Cooksley, C.M., Scott, J.C., Minton, N.P., The ClosTron: Mutagenesis in Clostridium refined and streamlined. J. Microbiol. Methods 80, Huang, H., Liu, H., Gan, Y.R., Genetic modification of critical enzymes and involved genes in butanol biosynthesis from biomass. Biotechnol. Adv. 28, Inokuma, K., Liao, J.C., Okamoto, M., Hanai, T., Improvement of isopropanol production by metabolically engineered Escherichia coli using gas stripping. J. Biosci. Bioeng, 110, Jain, M.K., Mutant strain of C. acetobutylicum and process for making butanol. US Patent Jang Y.S., Malaviya, A., Cho, C., Lee, J., Lee, S., Butanol production from renewable biomass by clostridia. Bioresourc. Technol. 123, Jang, Y.S., Malaviya, A., Lee, J., Im, J., Lee, S.Y., Lee, J., Seung, D.Y., Metabolic engineering of Clostridium acetobutylicum for the enhanced production of isopropanol butanol ethanol fuel mixture. Biotechnol. Progr. 29, Jesse, T.W., Ezeji, T.C., Qureshi, N., Blaschek, H.P., Production of butanol from starch-based waste packing peanuts and agricultural waste. J. Ind. Microbiol. Biotechnol. 29, Jiang, Y., Xu, C.M., Dong, F., Yang, Y.L., Jiang, W.H., Yang, S., Disruption of the acetoacetate decarboxylase gene in solvent-producing Clostridium acetobutylicum increases the butanol ratio. Metab. Eng. 11, Jojima, T., Inui, M., Yukawa, H., Production of isopropanol by metabolically engineered Escherichia coli. Appl. Microbiol. Biotechnol. 77, Jones, S.W., Paredes, C.J., Tracy, B., Cheng, N. et al., The transcriptional program underlying the physiology of clostridial sporulation. Genome Biol. 9, R114. Keis, S., Shaheen, R., Jones, D.T., Emended description of Clostridium acetobutylicum and Clostridium beijerinckii, and description of Clostridium 35

53 saccharoperbutylacetonicum sp. nov. and Clostridium saccharobutylicum sp. nov. Int. J. Syst. Evol. Microbiol. 51, Khan, Q.A., Hadi, S.M., Inactivation and repair of bacteriophage lambda by furfural. Biochem. Mol. Biol. Int. 32, Knoshaug, E.P. and Zhang, M., Butanol tolerance in a selection of microorganisms. Appl. Biochem. Biotechnol. 153, Kumar, M., Gayen K., Developments in biobutanol production: New insights. Appl. Energ. 88, Lee, J., Jang, Y.S., Choi, S.J., Im, J.A., Song, H., Cho, J.H. Papoutsakis, T., Bennett, G., Lee. S.Y., Metabolic engineering of Clostridium acetobutylicum ATCC 824 for isopropanol-butanol-ethanol fermentation. Appl. Environ. Microbiol. 78, Lee, I., Johnson, L.A., Hammond, E.G., Use of branched-chain esters to reduce the crystallization temperature of biodiesel. J. the Am. Oil Chem. Soc., 72, Li, X., Zhao, X., Fang, Y., Jiang, X., Duong, T., Fan, C., Huang, C.C., Kain, S.R., Generation of destabilized green fluorescent protein as a transcription reporter. J. Biol. Chem. 273, Liu, Z.L., Blaschek, H.P., Biomass conversion inhibitors and in situ detoxification. Biomass to biofuels: strategies for global industries, Liu, F., Feng, X., Separation of acetone-butanol-ethanol (ABE) from dilute aqueous solutions by pervaporation. Sep. Purif. Technol. 42, Liu, S., Qureshi, N., How microbes tolerate ethanol and butanol. New Biotechnol. 26, Lobo, L.A., Smith, C.J., Rocha, E.R., Flavin mononucleotide (FMN) based fluorescent protein (FbFP) as reporter for gene expression in the anaerobe Bacteroides fragilis. FEMS Microbiol. Lett. 317, Lu, C., Dong, J., Yang, S.T., Butanol production from wood pulping hydrolysate in an integrated fermentation-gas stripping process. Bioresour. Technol. 143, Lu, C., Zhao, J., Yang, S.T., Wei, D Fed-batch fermentation for butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour. Technol. 104, Liyanage, H., Young, M., Kashket, E., Butanol tolerance of Clostridium beijerinckii NCIMB 8052 associated with down-regulation of glda by antisense RNA. J. Mol. Microbiol. Biotechnol. 2,

54 Mainguet, S.E., Liao, J.C., Bioengineering of microorganisms for C3 to C5 alcohols production, Biotechnol. J. 5, Mao, S., Luo, Y., Zhang, T., Li, J., Bao, G., Zhu, Y., Chen, Z., Zhang, Y., Li, Y., Ma, Y., Proteome reference map and comparative proteomic analysis between a wild type Clostridium acetobutylicum DSM 1731 and its mutant with enhanced butanol tolerance and butanol yield. J. Proteome Res. 9, Marchal, R., Blanchet, D., Vandecasteele, J.P., Industrial optimization of acetonebutanol fermentation: a study of the utilization of Jerusalem artichokes. Appl. Microbiol. Biotechnol. 23, Matsushita, C., Matsushita, O., Koyama, M., Okabe, A., A Clostridium perfringens vector for the selection of promoters. Plasmid. 31, Matz, M.V., Lukyanov, K.A., Lukyanov, S.A., Family of the green fluorescent protein: journey to the end of the rainbow. Bioessays. 24, Nair, R.V., Green, E.M., Watson, D.E., Bennett, G.N., Papoutsakis, E.T., Regulation of the sol locus genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 by a putative transcriptional repressor. J. Bacteriol. 181, Nakayama, S.I., Kosaka, T., Hirakawa, H., Matsuura, K., Yoshino, S., Furukawa, K., Metabolic engineering for solvent productivity by downregulation of the hydrogenase gene cluster hupcba in Clostridium saccharoperbutylacetonicum strain N1-4. Appl. Microbiol. Biotechnol. 78, Ni Y, Xia Z, Wang Y, Sun Z., Continuous butanol fermentation from inexpensive sugar-based feedstocks by Clostridium saccharobutylicum DSM Bioresour. Technol. 129, Nicolaou, S.A., Gaida, S.M., Papoutsakis, E.T., A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: From biofuels and chemicals, to biocatalysis and bioremediation. Metab. Eng. 12, Nielson L, Larsson, M, Holst, O, Mattiasson, B., Adsorbents for extractive bioconversion applied to the acetone butanol fermentation. Appl. Microbiol. Biotechnol. 28, Nielsen, D.R., Leonard, E., Yoon, S.H., Tseng, H.C., Yuan, C., Prather, K.J., 2009a. Engineering alternative butanol production platforms in heterologous bacteria. Metab. Eng. 11, Nielsen, D.R., Prather, K.J. 2009b. In situ product recovery of n-butanol using polymeric resins. Biotechnol. Bioeng. 102,

55 Nolling, J., Breton, G., Omelchenko, M.V., Makarova, K.S., Zeng, Q., Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J. Bacteriol. 183, Oudshoorn, A., Van der Wielen, L.A.M., Straathof, A.J.J Assessment of options for selective 1-butanol recovery from aqueous solutions. Ind. Eng. Chem. Res. 48, Panitz, J.C., Zverlov, V.V., Pham, V.T.T., Stürzl, S., Schieder, D., Schwarz, W. H., Isolation of a solventogenic Clostridium sp. strain: Fermentation of glycerol to n- butanol, analysis of the bcs operon region and its potential regulatory elements. Sys. Appl. Microbiol. 37, 1-9. Papoutsakis, E.T., Engineering solventogenic clostridia. Curr. Opin. Biotechnol. 19, Papoutsakis, E.T., Tomas, C.A., Tesic, M., Santiago, J.Y., Increased cell resistance to toxic organic substances. US Patent, No Parekh, M., Blaschek, H.P., Butanol production by hypersolvent-producing mutant Clostridium beijerinckii BA101 in corn steep water medium containing maltodextrin. Biotechnol. Lett. 21, Peguin, S., Goma, G., Delorme, P., Soucaille, P., Metabolic flexibility of Clostridium acetobutylicum in response to methyl viologen addition. Appl. Microbiol. Biotechnol. 42, Peguin, S., Soucaille, P., Modulation of Carbon and Electron Flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl. Environ. Microbiol. 61(1), Phillips-Jones, M.K., Use of a lux reporter system for monitoring rapid changes in α-toxin gene expression in Clostridium perfringens during growth. FEMS Microbiol. Lett. 188, Piekarski, T., Buchholz, I., Drepper, T., Schobert, M., Wagner-Doebler, I., Tielen, P., Jahn, D., Genetic tools for the investigation of Roseobacter clade bacteria. BMC Microbiol. 9, Pierrot, P., Fick, M., Engasser, J.M., Continuous acetone-butanol fermentation with high productivity by cell ultrafiltration and recycling. Biotechnol. Lett. 8, Qureshi, N., Saha, B.C., Cotta, M.A., Butanol production from wheat straw hydrolysate using Clostridium beijerinckii. Bioproc. Biosyst. Eng. 30,

56 Qureshi, N., Blaschek, H.P., Butanol production using Clostridium beijerinckii BA101 hyper-butanol producing mutant strain and recovery by pervaporation. Appl. Biochem. Biotechnol. 84, Qureshi, N. Ezeji, T.C., Butanol, a superior biofuel production from agricultural residues (renewable biomass): recent progress in technology. Biofuels, Bioprod. Bioref. 2, Qureshi, N., Ezeji, T.C., Ebener, J., Dien, B.S., Cotta, M.A., Blaschek, H.P., Butanol production by Clostridium beijerinckii. Part I: Use of acid and enzyme hydrolyzed corn fiber. Bioresour. Technol. 99, Qureshi, N., Lolas, A., Blaschek, H.P., Soy molasses as fermentation substrate for production of butanol using Clostridium beijerinckii BA101. J. Ind. Microbiol. Biotechnol. 26, Qureshi, N., Maddox, I.S, Friedl, A., Application of continuous substrate feeding to the ABE fermentation: relief of product inhibition using extraction, perstraction, stripping and pervaporation. Biotechnol. Prog. 8, Qureshi, N., Saha, B.C., Cotta, M.A., Butanol production from wheat straw hydrolysate using Clostridium beijerinckii. Bioprocess Biosyst. Eng. 30, Qureshi, N., Saha, B. C., Dien, B., Hector, R. E., Cotta, M.A., 2010b. Production of butanol (a biofuel) from agricultural residues: Part I - Use of barley straw hydrolysate. Biomass Bioenergy. 34, Qureshi, N., Saha, B. C., Hector, R. E., Cotta, M.A., 2008c. Removal of fermentation inhibitors from alkaline peroxide pretreated and enzymatically hydrolyzed wheat straw: Production of butanol from hydrolysate using Clostridium beijerinckii in batch reactors. Biomass Bioenergy. 32, Qureshi, N., Saha, B.C., Hector, R.E., Dien, B., Hughes, S., Liu, S., Iten, L., Bowman, M.J., Sarath, G., Cott, M.A., Production of butanol (a biofuel) from agricultural residues: part II - use of corn stover and switchgrass hydrolysates. Biomass Bioenergy. 34, Ramey, D.E Continuous two stage, dual path anaerobic fermentation of butanol and other organic solvents using two different strains of bacteria. US Patent No Rao, G., Mutharasan, R., Alcohol production by Clostridium acetobutylicum induced by methyl viologen. Biotechnol. Lett. 8, Roffler, S.R., Blanch, H.W., Wilke, C.R., 1987a. In-situ recovery of butanol during fermentation, part 1: batch extractive fermentation. Bioprocess Eng. 2,

57 Roffler, S.R., Blanch, H.W., Wilke, C.R., 1987b. In-situ recovery of butanol during fermentation, part 2: fed-batch extractive fermentation. Bioprocess Eng. 2, Searchinger, T., Heimlich, R., Houghton, R.A., Dong, F., Elobeid, A., Fabiosa, J., Tokgoz, S., Hayes, D., Yu, T.H., Use of U.S. croplands for biofuels increases greenhouse gases through emissions from land-use change. Science. 319, Sillers, R., Chow, A., Tracy, B., Papoutsakis, E.T., Metabolic engineering of the non-sporulating, non-solventogenic Clostridium acetobutylicum strain M5 to produce butanol without acetone demonstrate the robustness of the acid-formation pathways and the importance of the electron balance. Metab. Eng. 10, Sillers, R., A-Hinai, M.A., Papoutsakis, E.T., Aldehyde-alcohol dehydrogenase and/or thiolase overexpression coupled with CoA transferase downregulation lead to higher alcohol titers and selectivity in Clostridium acetobutylicum fermentations. Biotechnol. Bioeng. 102, Shao, P., Huang, R.Y.M., Polymeric membrane pervaporation. J. Membr. Sci. 287, Shen, C.R., Lan, E.I., Dekishima, Y., Baez, A., Cho, K.M., Liao, J.C., Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl. Environ. Microbiol. 77, Shen, C.R., Liao, J.C., Metabolic engineering of Escherichia coli for 1-butanol and 1-propanol production via the keto-acid pathways. Metab. Eng. 10, Shi, Z., Blaschek, H.P., Transcriptional analysis of Clostridium beijerinckii NCIMB 8052 and the hyper-butanol-producing mutant BA101 during the shift from acidogenesis to solventogenesis. Appl. Environ. Microbiol. 74, Smith, K.M., Cho, K., Liao, J.C., Engineering Corynebacterium glutamicum for isobutanol production. Appl. Microbiol. Biotechnol. 87, Soucaille, P., Joliff, G., Izard, A., Goma, G., Butanol tolerance and autobacteriocin production by Clostridium acetobutylicum. Curr. Microbiol. 14, Steen, E.J., Chan, R., Prasad, N., Myers, S., Petzold, C.J., Redding, A., Ouellet, M., Keasling, J.D., Metabolic engineering of Saccharomyces cerevisiae for the production of n-butanol. Microb. Cell. Fact. 7, Tamakawa, H., Mita, T., Yokoyama, A., Ikushima, S., Yoshida, S., Metabolic engineering of Candida utilis for isopropanol production. Appl. Microbiol. Biotechnol. 97, Tashiro, Y., Takeda, K., Kobayashi, G., Sonomoto, K., Ishizaki, A., Yoshino, S., High butanol production by Clostridium saccharoperbutylacetonicum N1-4 in fed- 40

58 batch culture with ph-stat continuous butyric acid and glucose feeding method. J. Biosci. Bioeng. 98: Thang, V.H., Kanda, K., Kobayashi. G., Production of acetone-butanol-ethanol (ABE) in direct fermentation of cassava by Clostridium saccharoperbutylacetonicum N1-4. Appl. Biochem. Biotechnol. 161, Thongsukmaka, A., and Sirkar, K.K., Pervaporation membranes highly selective for solvents present in fermentation broths. J. Membr. Sci. 302, Tomas, C.A., Welker, N.E., Papoutsakis, E.T., Overexpression of groesl in Clostridium acetobutylicum results in increased solvent production and tolerance, prolonged metabolism, and changes in the cell's transcriptional program. Appl. Environ. Microbiol. 69, Tong, C.C., Bai, Y.X., Wu, J.P., Zhang, L., Yang, L.R., Qian, J.W., Pervaporation recovery of acetone-butanol from aqueous solution and fermentation broth using HTPB-based polyurethaneurea membranes. Sep. Sci. Technol. 45, Tracy, B.P., Jones, S.W., Fast, A.G., Indurthi, D.C., Papoutsakis, E.T., Clostridia: the importance of their exceptional substrate and metabolite diversity for biofuel and biorefinery applications. Curr. Opin. Biotechnol. 23, Tsien, R.Y., The green fluorescent protein. Annu. Rev. Biochem. 67, Vane, L.M., Review: A review of Pervaporation for product recovery from biomass fermentation processes. J. Chem. Technol. Biotechnol. 80, Vane, L.M., Separation technologies for the recovery and dehydration of alcohols from fermentation broths. Biofuels. Bioprod. Bioref. 2, Verkhusha, V.V., Chudakov, D.M., Gurskaya, N.G., Lukyanov, S., Lukyanov, K.A., Common pathway for the red chromophore formation in fluorescent proteins and chromoproteins. Chem. Biol. 11, Weber, C., Farwick, A., Benisch, F., Brat, D., Dietz, H., Subtil, T., Boles, E., Trends and challenges in the microbial production of lignocellulosic bioalcohol fuels. Appl. Microbiol. Biotecnol. 87, Xue, C., Zhao, J., Lu, C., Yang, S.T., Bai, F., Tang, L.C., High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping, Biotechnol. Bioeng. 109, Xue, C., Zhao, J., Liu, F., Lu, C., Yang, S.T., Bai, F.W., Two-stage in situ gas stripping for enhanced butanol fermentation and energy-saving product recovery. Bioresour. Technol. 135,

59 Yang, S.T., Extractive fermentation using convoluted fibrous bed bioreactor. US Patent NO Yang, S.T., Zhao, J., Adaptive engineering of Clostridium for increased butanol production, US Patent NO Yu, M., Du, Y., Jiang, W., Chang, W.L., Yang, S.T., Tang, L.C., Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum, Appl. Microbiol. Biotechnol. 93, Yu, M., Zhang, Y., Tang, I., Yang, S.T., Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab. Eng. 13, Zacharias, D.A., Violin, J.D., Newton, A.C., Tsien, R.Y., Partitioning of lipidmodified monomeric GFPs into membrane microdomains of live cells. Science. 296, Zhang, J., Wang, M., Gao, M., Fang, X., Yano, S., Qin, S., Xia, R., Efficient acetonebutanol-ethanol production from corncob with a new pretreatment technologywet disk milling. Bioenergy Res. 6, Zhao, J., Yang, S.T., Evolution of solvent-producing Clostridium beijerinckii toward high butanol tolerance. ACS 238th Annual Meeting (BIOT 305). Zhao, J., Lu, C., Chen, C.C., Yang, S.T., Biological production of butanol and higher alcohols. Bioprocessing Technologies in Biorefinery for Sustainable Production of Fuels, Chemicals, and Polymers, Wiley, Chapter 13, pp

60 Table 2.1 Comparison of chemical and physical properties of gasoline and biofuels. Fuel Structure Energy density (MJ/kg) Motor octane number Hygroscopicity Compatible with current engine Gasoline N/A Low Yes Ethanol High No Butanol Low Yes Isobutanol Low Yes Isopropanol N/A N/A N/A: now available 43

61 44 Table 2.2 Summary of ABE production by solventogenic Clostridia from various feedstocks. Feedstock Strain Butanol (g/l) ABE (g/l) ABE Yield (g/g) ABE Productivity (g/l) References Glucose C. beijerinckii BA Qureshi et al., 2001 Cane molasses C. acetobutylicum JB Lu et al., 2012 C. saccharobutylicum DSM Ni et al., 2012 C. beijerinckii NCP P NA Shaheen et al., 2000 Soy molasses C. beijerinckii BA Qureshi et al., 2001 Jerusalem artichokes Maize mash C. acetobutylicum IFP Marchal et al., 1985 C. acetobutylicum ATCC 4259 NA NA Shaheen et al., 2000 Corn starch, liq. C. beijerinckii BA Ezeji et al., 2007 Corn starch C. saccharoperbutylacetonicum Cassava starch N Thang et al., 2010 Cassava bagasse C. acetobutylicum JB Lu et al., 2012 Barley straw C. beijerinckii P Qureshi et al., 2010b Corn stover C. beijerinckii P Qureshi et al., 2010a Corn fiber C. beijerinckii BA Qureshi et al., 2008b Rice straw C. saccharoperbutylacetonicum N Chen et al., 2013 Wheat straw C. beijerinckii BA Qureshi et al., 2007 Wood pulp C. beijerinckii CC Lu et al., 2013 Switchgrass C. beijerinckii P Qureshi et al., 2010a 44

62 45 Table 2.3 Summary of the integrated butanol fermentation and in situ butanol removal techniques (Ezeji et al., 2010). Process Relieves butanol toxicity Increase productivity Increase yield Adsorption Yes Yes No Gas stripping Liquid liquid extraction Perstraction Pervaporation Limitation Loss of nutrients to adsorbent, clogging, loss of fermentation (acetic and butyric acid) intermediate products Yes Yes Yes Low butanol stripping rate Yes Yes No Yes Yes No Yes Yes No Extractant toxicity to cells, formation of rag layer, emulsion, loss of fermentation intermediate products to extractant Loss of fermentation intermediate product to extractant, expensive to operate, membrane fouling, and lack simplicity Loss of fermentation intermediate products to extractant due to diffusion across membrane, membrane fouling Reference Nielson et al., 1988 Ezeji et al., 2005 Evens and Wang, 1988 Qureshi et al., 1992 Qureshi and Blaschek,

63 Figure 2.1 Combined transcriptome and metabolic flux analysis of C. acetobutylicum. Solid and dashd arrows are utilized to differentiate reactions predominant in acidogenesis and solventogenesis, respectively. Numbers represent normalized flux ratios between acidogenesis and solventogenesis (Desaiet al., 1999). +/ indicates the reaction direction is changed in solventogenesis. Curves beside genes indicate the relative mrna expression levels vs. fermentation time (From: Alsaker and Papoutsakis, 2005; Lee et al., 2008). 46

64 Figure 2.2 Schematic diagram of the fibrous-bed bioreactor (FBB) and scanning electron microscopic pictures of cells immobilized in fibrous matrices (From: Yang, 1996). 47

65 Figure 2.3 In situ solvent recovery strategies. Fermentation integrated with (a) gas stripping, (b) liquid liquid extraction (perstraction), (c) pervaporation (From: Lee et al., 2008). 48

66 Chapter 3 : Stable high-titer n-butanol production from sucrose and sugarcane juice by Clostridium acetobutylicum JB200 in repeated batch fermentations Abstract The production of n-butanol, a widely used industrial chemical and promising transportation fuel, from abundant, low-cost substrates, such as sugarcane juice, in acetonebutanol-ethanol (ABE) fermentation was studied with Clostridium acetobutylicum JB200, a mutant with high butanol tolerance and capable of producing high-titer (>20 g/l) n- butanol from glucose. Although JB200 is a favorable host for industrial bio-butanol production, its fermentation performance with sucrose and sugarcane juice as substrates has not been well studied. In this study, the long-term n-butanol production from sucrose by JB200 was evaluated with cells immobilized in a fibrous-bed bioreactor (FBB), showing stable performance with high titer (16 20 g/l), yield (~0.21 g/g sucrose) and productivity (~0.32 g/l h) for 16 consecutive batches over 800 h. Sugarcane thick juice as low-cost substrate was then tested in 3 consecutive batches, which gave similar n-butanol production, demonstrating that JB200 is a robust and promising strain for industrial ABE fermentation. 49

67 3.1 Introduction N-Butanol is a four-carbon primary alcohol with the molecular formula C4H10O. It is widely used as an industrial solvent and intermediate in producing butyl acrylate, butyl acetate and other butyl esters. In addition, butanol has also been considered as a promising fuel substitute for gasoline, as well as a fuel additive. Compared to ethanol, butanol is less corrosive, has higher energy content, and can be better burnt in existing gasoline engines. Historically, n-butanol production via acetone-butanol-ethanol (ABE) fermentation was once the second largest industrial fermentation and recently has regained increasing attention (Jang et al., 2012; Zhao et al., 2013) because butanol production from biomass is more environmentally friendly and can reduce costs, especially considering the recent dramatic increase in crude oil prices (Green, 2011). However, in order to commercialize bio-butanol, bacterial strains that can use low-cost substrates in ABE fermentation with high butanol titer, yield and productivity are needed (Ezeji et al., 2010; Lee et al., 2008; Zhao et al., 2013). Because butanol at concentrations above 1% (v/v) is highly toxic to cells and can cause significant growth inhibition and cell death, the final butanol titer in conventional ABE fermentation usually cannot surpass 12 g/l. Consequently, it is highly energy intensive and costly to recover butanol from the ABE fermentation broth (Garcia et al., 2011; Xue et al., 2012). However, the separation cost for butanol recovery from ABE fermentation broth can be reduced by 50% if the final butanol titer is increased from 12 g/l to 19 g/l (Papoutsakis, et al., 2005). Although extensive research has been done to improve butanol production by metabolically engineered mutants, only limited success has been achieved 50

68 due to complicated and difficult to control metabolic and regulatory pathways involving acidogenesis, solventogenesis, and spore formation (Lee et al., 2008; Papoutsakis, 2008). Recently, a hyper butanol-producing strain, C. acetobutylicum JB200 that can produce ~21 g/l butanol from glucose in free-cell fermentation and ~25 g/l butanol in immobilizedcell fermentation in a fibrous-bed bioreactor (FBB) was developed through adaptive mutagenesis of the non-spore forming C. acetobutylicum ATCC (Yang and Zhao, 2013). However, the genetic stability and long-term fermentation performance of JB200 need to be evaluated before its use in industrial fermentation. In this study, the stability of C. acetobutylicum JB200 was first examined in long-term repeated batch fermentations with sucrose as the substrate. The robustness of JB200 for butanol production was then evaluated using concentrated sugarcane juice as the substrate. The results demonstrated the feasibility of using JB200 to produce high-titer butanol from low-cost industrial feedstock, sugarcane thick juice, which could lower the production cost and make bio-butanol more profitable. 3.2 Materials and methods Culture and media Sugarcane thick juice containing about 57.3% (w/w) sucrose, 10.7% (w/w) glucose and 4.0% (w/w) fructose was obtained after concentrating sugarcane juice by evaporation from a sugarcane mill in Brazil. C. acetobutylicum JB200 (ATCC PTA-12215) was derived from ATCC through adaptive mutagenesis in a fibrous bed bioreactor (Yang and Zhao, 2013). The stock culture of this mutant strain was stored in a 15% glycerol-p2 stock 51

69 solution at -80 C. The seed culture for fermentation was prepared by inoculating 200 L of the glycerol stock culture into a serum bottle containing 50 ml P2 medium with 50 g/l glucose and incubating at 37 C for h until the cell density reached an optical density (OD) value of ~2. Unless otherwise noted, the P2 medium containing 80 g/l sucrose or 150 g/l thick juice as the carbon source, 1 g/l yeast extract, 0.5 g/l KH2PO4, 0.5 g/l K2HPO4, 2.2 g/l ammonium acetate, mineral salts (0.2 g/l MgSO4 7H2O, 0.01 g/l MnSO4 H2O, 0.01 g/l FeSO4 7H2O, 0.01 g/l NaCl), and vitamins (1 mg/l p-aminobenzoic acid, 1 mg/l thiamine and 0.01 mg/l biotin) was used in the fermentation studies. For fermentation with thick juice as the carbon source, 60 g thick juice was mixed with 0.4 g yeast extract, phosphate buffer (in 20 ml H2O), minerals (concentrated 200-fold, 2 ml) and vitamins (concentrated 1000-fold, 0.4 ml) to make 400 ml thick juice-based medium. Thick juice and buffer were sterilized separately by autoclaving at 121 C and 15 psig for 30 min. Concentrated mineral salt and vitamin solutions were filter-sterilized through sterile 0.2 m membrane filters (25 mm, syringe filter). All solutions were purged with nitrogen for 1 h to ensure anaerobiosis Free-cell fermentation Free-cell batch fermentation kinetics was studied in a 400-mL spinner flask (Bellco) at 37 C with ph controlled at >5.1 by adding 25% (v/v) ammonia solution. After sterilization, the spinner flask with the P2 medium was purged with nitrogen for 1 h and then inoculated with 20 ml of actively growing cells from the seed culture. Samples were taken periodically for the analyses of sugar and product concentrations. All fermentation kinetics 52

70 studies were repeated 2 to 3 times and average values are reported Immobilized-cell fermentation in fibrous bed bioreactor Immobilized-cell fermentation was studied in a fibrous bed bioreactor (FBB), which was made of a glass column (250 ml working volume) packed with spirally wound cotton towel and stainless steel wire cloth, and was connected to a 400-mL spinner flask (Bellco) with medium recirculation through a peristaltic pump (see Fig. 3.1). Detailed descriptions of the FBB construction and operation can be found elsewhere (Lu et al., 2012). The spinner flask and the FBB were autoclaved separately for 30 min, and aseptically connected after sterilization. The spinner flask containing 400 ml medium and the FBB were purged with nitrogen for 1-2 h to remove any trace oxygen. Then, 20 ml of actively growing cells (12-16 h) were inoculated into the spinner flask. After h when cell growth had reached an optical density (OD) of over 6.0, the fermentation broth with cells was recirculated through the FBB for cell immobilization onto the fibrous matrix for h, until the cell density in the broth no longer decreased. The old broth was then drained and replaced with a fresh P2 medium to allow cells in the FBB to continue to grow. Again the old medium was changed and the process was repeated several times until a stable and high cell density in the FBB was achieved. The fermentation kinetics was then studied in a repeated batch mode at 37 C with the ph controlled at >5.1 by adding 25% (v/v) ammonia solution. Before starting a new batch, the medium in the reactor system was completely drained. Then, 400 ml fresh P2 medium with sugar was pumped into the spinner flask and circulated through the FBB. Each batch fermentation lasted for about 48 h. A total of 16 batches were operated with sucrose as the substrate in ~800 h. In addition, a second FBB 53

71 was operated with sugarcane thick juice as the substrate for three consecutive batches. Broth samples were taken from the spinner flask periodically for the analyses of sugar and product concentrations Scanning electron microscopy A piece of towel (about 1 cm 1 cm) was collected after repeated batch fermentations. The sample was rinsed with PBS three times and then fixed in 2.5% glutaraldehyde (Sigma- Aldrich) at 4 C overnight, and then progressively dehydrated in 10%, 30%, 50%, 70%, 90% and 100% ethanol for 10 min each. After dehydration, the samples were soaked in hexamethyldisilazane (HMDS) (Sigma-Aldrich) for 1 min. Samples were then placed in a desiccator for a week. Finally, the dried samples were sputter-coated with gold and studied with a scanning electron microscope (Philips Electronics, Eindhoven, The Netherlands) to examine cell density and morphology Analytical methods Cell density was analyzed by measuring optical density (OD) of the cell suspension at 600 nm using a spectrophotometer (Shimadzu, Columbia, MD, UV-16-1). After removing the bacterial cells by centrifuging at 13,000 g for 5 min, the clear fermentation broth was analyzed for sugar and product concentrations. The sugars present in the fermentation broth were analyzed with a high performance liquid chromatograph (HPLC) equipped with an organic acid analysis column (Bio-Rad HPX-87H) and a refractive index detector (Shimadzu RID-10A) at 45 C. The eluent was M H2SO4 at 0.6 ml/min. The fermentation products, including acetone, butanol, ethanol, acetic acid and butyric acid, 54

72 were measured with a gas chromatograph (GC, Shimadzu GC-2014) equipped with a flame ionization detector and a 30-m fused silica column (0.25 m film thickness and 0.25 mm ID, Stabilwax-DA). The carrier gas was nitrogen at 1.47 ml/min (linear velocity: 35 cm/s). Samples were diluted 20 times with an internal standard buffer solution containing 0.5 g/l isobutanol, 0.1 g/l isobutyric acid and 1% phosphoric acid (for acidification), and injected (1 L each) with an auto-injector (AOC-20i Shimadzu). The column temperature was held at 80 C for 3 min, raised to 150 C at a rate of 30 C/min, and held at 150 C for 3.7 min. Both the injector and detector were set at 250 C. 3.3 Results and discussion Free-cell fermentation kinetics Figure 3.2 shows kinetics of free-cell fermentation with glucose, sucrose, and thick juice, respectively, as carbon source in spinner flasks. About 21.2 g/l butanol, 8.0 g/l acetone and 2.2 g/l ethanol (total ABE: 31.4 g/l) were produced from ~100 g/l glucose consumed in 54 h. The corresponding product yields were ~0.21 g/g butanol, ~0.09 g/g acetone, ~0.02 g/g ethanol, and ~0.33 g/g total ABE. Similarly, about 14.9 g/l butanol, 10.4 g/l acetone and 1.2 g/l ethanol (total ABE: 26.3 g/l) were produced from ~70 g/l sucrose consumed in 72 h. The corresponding product yields were ~0.21 g/g butanol, ~0.14 g/g acetone, ~0.02 g/g ethanol, and ~0.37 g/g total ABE. Similar kinetics was also obtained when sugarcane thick juice was used as the carbon source. About 18.5 g/l butanol, 8.9 g/l acetone and 1.3 g/l ethanol (total ABE 28.7 g/l) were produced from 75.2 g/l sucrose, 12.6 g/l glucose and 6.0 g/l fructose consumed in 72 h. In general, sucrose, glucose and fructose in the 55

73 thick juice were consumed simultaneously, although glucose and fructose were reported as the preferred substrates over sucrose by C. acetobutylicum (Servinsky et al., 2010). As shown in Figure 3.3, the specific growth rate was much higher for cells grown on glucose (0.23 ± 0.07 h -1 ) than on sucrose (0.13 ± 0.01 h -1 ). Consequently, the fermentation was faster with higher productivity with glucose than with sucrose as the substrate. Compared to glucose as the sole carbon source, similar amounts of butanol and ethanol but slightly more acetone were produced from sucrose (see Table 3.1). It is noted that ABE fermentation using starch or glucose as the substrate typically produced ~20 g/l ABE at a product ratio of 6:3:1 (B:A:E) and butanol yield of g/g substrate consumed (Jones and Woods, 1986). CO2 and H2 are also produced as byproducts in the fermentation. More butanol with a yield of >0.35 g/g can be produced from glucose or sugars when acetone and ethanol production is negligible, such as using metabolically engineered mutant (Yu et al., 2011; Zhao et al., 2013). The theoretical max. yield of n-butanol is 0.4 g/g glucose or sucrose if n-butanol is the only solvent product and no acids or cell were produced in the fermentation. The ABE yield and productivity from sugarcane thick juice were slightly lower than those from sucrose, but the difference was not significant. It is clear that sugarcane thick juice performed similarly well compared to sucrose as the substrate for ABE fermentation, and is thus a promising low-cost substrate for industrial butanol production. It should be noted that 18.5 g/l of butanol and 28.7 g/l of ABE production from sugarcane juice by JB200 were much higher than the reported 11.9 g/l butanol and 17.9 g/l ABE from cane molasses by C. saccharobutylicum DSM (Ni et al., 2012) and 18.9 g/l ABE by C. beijerinckii 56

74 NCP P260 (Shaheen et al., 2000). Compared to other solventogenic Clostridia, JB200 produced the highest titers of butanol and total ABE from sucrose as the substrate (see Table 3.2), confirming that JB200 can tolerate a higher butanol concentration and is a desirable strain for butanol production from sucrose Batch fermentation in the FBB Figure 3.4 shows typical batch fermentation kinetics of C. acetobutylicum JB200 in the FBB. With sucrose as the sole carbon source, about 16.5 g/l butanol, 8.1 g/l acetone and 1.3 g/l ethanol (Fig. 3A) were produced from 75.9 g/l sucrose consumed in 47 h. The corresponding product yields were ~0.21 g/g butanol, ~0.11 g/g acetone, ~0.02 g/g ethanol, and ~0.34 g/g total ABE. As expected, similar fermentation kinetics was observed with sugarcane thick juice as the substrate: 16.2 g/l butanol, 7.1 g/l acetone and 1.37 g/l ethanol were produced from 60.8 g/l sucrose, 12.8 g/l glucose and 6 g/l fructose consumed in 47 h. However, compared to sucrose, the fermentation with thick juice produced more butyric acid and less acetone. Compared to free-cell fermentation, butanol and ABE productivities increased 20% to 30% with the FBB fermentation (see Table 3.1), which can be attributed to the higher cell density and better butanol tolerance for cells immobilized in the fibrous bed (Huang et al., 2004; Lu et al., 2012). As can be seen in the scanning electron micrographs (see Fig. 3.1), high density of cells were immobilized in the fibrous matrix. They either attached to the fiber surface or formed large clumps in the interstitial space. The high cell density in the FBB not only gave higher productivity but also increased cell tolerance to butanol (Yang 57

75 and Zhao, 2013). Improved productivity and cell tolerance to inhibiting fermentation products, such as butyric and propionic acids, in the FBB have also been reported before (Jiang et al., 2011). Table 3.1 summarizes and compares ABE yields and productivities from free-cell and FBB fermentations with sucrose and sugarcane thick juice as substrates. In general, similar product yields were obtained from these fermentations except that less acetone was produced in the sugarcane thick juice fermentation, leading to a higher butanol/acetone ratio, which is 2 (g/g) in typical ABE fermentation Repeated batch fermentations To investigate the long-term stability and performance of C. acetobutylicum JB200, repeated batch fermentations with sucrose and thick juice were performed in the FBB, and the results are shown in Figure 3.5. The batch fermentation was repeated for 16 cycles, ~50 h each, for a total of ~800 h with sucrose as the substrate. Except for the first batch, consistent butanol production of g/l butanol, 8-10 g/l acetone, and ~1.4 g/l ethanol (total ABE: g/l) were obtained from ~80 g/l sucrose consumed (Fig. 5A), with an average butanol yield of 0.21 ± 0.04 g/g, acetone yield of 0.11 ± 0.02 g/g, ethanol yield of 0.02 ± 0.00 g/g, and total ABE yield of 0.34 ± 0.06 g/g (Table 3.1). The average butanol and ABE productivities over the last 15 batches were 0.32 ± 0.03 g/l h and 0.50 ± 0.06 g/l h, respectively. Similarly, sugarcane thick juice was used as the carbon source in three repeated batch fermentations (Fig. 5B). On average, 16.6 g/l butanol, 7.4 g/l acetone and 1.4 g/l ethanol (total ABE 25.4 g/l) were obtained from ~83 g/l sugars 58

76 consumed, with the average butanol and ABE yields of 0.20 ± 0.01 g/g and 0.31 ± 0.03 g/g, respectively, which were slightly lower than the batches with sucrose as the substrate but the difference was not significant. The average butanol and ABE productivities were 0.34 ± 0.01 g/l h and 0.52 ± 0.02 g/l h, respectively, which were slightly higher than those with sucrose as the substrate but the difference was insignificant. The similar fermentation kinetics from both sucrose and sugarcane thick juice in these repeated batch fermentations further confirmed that sugarcane thick juice is a promising low-cost feedstock for butanol production. As can be seen in Figure 3.6, ABE production in the repeated batch fermentations was stable, giving consistent ABE yield and productivity for all batches except for the first batch, which had a relatively low cell density because the FBB was in the initial startup period. In fact, the butanol productivity increased gradually from the first batch at 0.2 g/l h to over 0.3 g/l h by the fifth batch, because of increased cell density and adaptation in the FBB. On the other hand, the butanol to acetone ratio (B/A ratio) maintained a relatively constant value of 2.0 (g/g) throughout the repeated batch fermentations, except for the first batch, with sucrose as the substrate (Fig. 6C). The B/A ratio was higher at ~2.25 (g/g) when sugar cane juice was used as substrate because less acetone was produced. The results from this study confirmed that JB200 is stable for long-term high-titer butanol production. To the best of our knowledge, no other solventogenic Clostridia strain has been reported to continuously produce high-titer (>15 g/l) butanol over an extended fermentation period without culture degeneration. Industrial ABE fermentation was usually operated under batch or semi-continuous mode, continuously fed with new seed culture to 59

77 overcome the culture degeneration problem (Green, 2011). Although JB200 can tolerate and produce over 20 g/l of butanol from sucrose, each batch fermentation was terminated when the butanol titer had reached ~16 g/l at 48 h in the present study. This was done to avoid prolonged exposure of cells to a highly toxic butanol concentration of 16 g/l, which would severely inhibit cells and even cause cell lysis (data not shown). Because the same cells in the FBB were used in the repeated batch fermentations, it is critical to keep the butanol concentration below the highly toxic level by changing the media at an appropriate fermentation time. Alternatively, in situ butanol removal by, such as, gas stripping can be used to allow the fermentation to continue to produce butanol without replacing the entire medium, but instead, operating the fermentation at a fed-batch mode (Lu et al., 2012; Xue et al., 2012) Culture stability and butanol tolerance of JB200 Usually strains obtained from mutagenesis are not genetically stable and can easily lose their desirable phenotypes after several generations in storage or cultivation. For example, C. acetobutylicum ATCC 55025, a non-sporulating mutant strain obtained through mutagenesis was once reported to produce ~20 g/l of butanol (Jain, 1993). However, later fermentation studies using this strain obtained from ATCC could only obtain a butanol titer up to ~14 g/l, indicating the culture might have degenerated. JB200 is a mutant strain generated from ATCC through adaptive mutagenesis and screening for high butanol tolerance. Comparative proteomic analysis identified eight proteins with the highest expression in stationary-phase JB200 cells (Yang and Zhao, 2013). Among them, three belonged to the small heat shock protein (hsp18) and four were from the hook-associated 60

78 protein (hag), both have been reported to be closely related to butanol tolerance (Nicolaou et al., 2010). Comparative genomic analysis, including SNP and InDel (insertion/deletion) analysis, using C. acetobutylicum ATCC 824 genome sequence as a reference, indicated that both JB200 and its parental strain ATCC are highly similar to ATCC 824 (Yang and Zhao, 2013). Compared with its parental strain ATCC 55025, the comparative genomic analysis revealed 7 point mutations in the genome of JB200. Among these mutations, the most dramatic one occurred in the gene coding a signal transduction histidine kinase, resulting in a large portion (70%) of C-terminal truncation of this histidine kinase, which contributed to the significantly increased butanol tolerance and production by JB200 (unpublished data). The glycerol stock culture of JB200 maintained its ability to produce more than ~21 g/l of butanol from glucose in free-cell fermentation and ~25 g/l butanol in FBB fermentation after more than 12 months of storage at -80 o C (data not shown). In the present study, JB200 cells in the FBB were used consecutively in 16 repeated batch fermentation of sucrose over 30 days or 140 generations (with ~5 h generation time for cells grown on sucrose) without any notable degeneration, confirming its long-term stability for industrial ABE fermentation. This long-term operation stability may also be partially attributed to cell immobilization in the FBB (Huang et al., 2004). It should be noted that culture degeneration or loss of butanol production ability can be attributed to the loss of the megaplasmid containing the Sol operon in C. acetobutylicum and the high cytotoxicity of butanol (Zhao et al., 2013), while the genetic instability can be attributed to the reverse mutations of mutated genes in the genome during culture storage and repeated sub- 61

79 culturing without a selection pressure. Nevertheless, further studies would be necessary to better understand the mechanisms contributing to the genetic stability of JB Comparison to other studies Table 3.2 summarizes the highest solvent production from various substrates by different Clostridium strains. C. beijerinckii BA101, a mutant strain of C. beijerinckii NCIMB 8052 isolated after mutagenesis using mutagen N-methyl-N -nitro-n-nitrosoguanidine (NTG) and selective enrichment, was reported to produce 19.9 g/l butanol and 23.8 g/l total ABE from glucose (Qureshi and Blaschek, 2001b), which are higher than most of those reported to date for ABE fermentation. However, like other spore-forming Clostridia strains, BA101 could easily degenerate and lose its butanol production capability upon extended exposure to butanol at >10 g/l during the fermentation (Ezeji et al., 2007). Furthermore, our recent tests of BA101, obtained from ATCC, showed only ~12 g/l of butanol production from glucose in batch fermentation (data not shown). Various metabolic engineering studies on over-expression and down-regulation or knockout of a single or a group of genes in solventogenic Clostridia metabolic pathways have also been investigated aiming at increasing butanol tolerance and production (Lee et al., 2008; Nicolaou et al., 2010; Papoutsakis, 2008; Yu et al., 2011). However, to date no strain with a higher butanol production titer has been obtained as compared to C. acetobutylicum JB200. Also, the genetic stability of metabolically engineered mutants has not been well studied and is a major concern in industrial fermentation. C. acetobutylicum JB200 is thus advantageous for use in ABE fermentation. 62

80 Historically, various starch and sugar-based substrates, including corn, molasses, and cassava have been used in ABE fermentation (Jane et al., 2012; Jones and Woods, 1986; Shaheen et al., 2000). However, in addition to the high feedstock cost, the use of corn and other grains for biofuels production has also caused a worldwide food or fuel concern. On the other hand, agricultural residues, including barley straw (Qureshi et al., 2010a), cassava bagasse (Lu et al., 2012), corn fiber (Qureshi et al., 2008), corn stover (Qureshi et al., 2010b), rice straw (Chen et al., 2013), and wheat bran (Liu et al., 2010), and other plantderived biomass such as wood pulp (Lu et al., 2013) and switchgrass (Qureshi et al., 2010b) have also been studied as low-cost substrates for butanol production. In general, lignocellulosic biomass must be thermo-chemically pretreated and enzymatically hydrolyzed to simple sugars, mainly glucose and xylose, in order to be used by microbes in fermentation. In addition, soy molasses containing mainly soy oligosaccharides such as stachyose and raffinose (Qureshi et al., 2001b), and Jarusalem artichokes containing mainly inulin (Marchal et al., 1985) have also been studied for their hydrolysates as substrates in ABE fermentation. However, the pretreatment and hydrolysis process not only is costly but also can generate chemical inhibitors that could dramatically decrease solvent production in ABE fermentation (Jang et al., 2012). Therefore, detoxification of hydrolysate before fermentation is usually necessary, but is also costly. Nevertheless, lignocellosic biomass hydrolysates generally gave inferior performance in ABE fermentation (see Table 2) and are not yet economically viable for butanol production (Jang et al., 2012). 63

81 In contrast, sugarcane based substrates, including cane molasses and juice containing mainly sucrose, can be readily converted to n-butanol in ABE fermentation by solventogenic Clostridia. Sugarcane is an abundant bioresource and has been extensively used for ethanol production in Brazil and other tropical regions because its cultivation is more energy-efficient and use as fermentation substrate is more cost effective as compared to corn and other starch-based crops (Filho et al., 2011; Kumar et al., 2012). However, a recent study showed that conventional ABE fermentation in a sugarcane biorefinery would not be economically attractive unless the fermentation performance in terms of butanol titer, yield, and productivity can be significantly enhanced (Mariano et al., 2013). In the present study, we demonstrated the use of sugarcane thick juice as substrate in ABE fermentation, attaining 18.5 g/l butanol and 28.7 g/l total ABE production, which is significantly higher than those obtained from other sucrose-based substrates (i.e., molasses). Compared to other sugarcane refinery byproducts such as molasses and raw sugarcane extraction juice, the highly concentrated thick juice has excellent storability and transportability, and thus is a more favorable feedstock for butanol production. Table 3.3 compares the economics of butanol production from corn and sugarcane juice in ABE fermentation. The current cost for n-butanol production from corn or cassava by conventional ABE fermentation is about $1.47/kg or $4.50/gal. About 60% to 70% of the product cost can be attributed to the feedstock or corn, while the energy cost for butanol recovery by distillation accounts for ~30% of the production cost (Green, 2011). Compared to corn (starch) as the feedstock, sugarcane juice (cane sugars) would be ~50% cheaper on the basis of fermentable sugar substrate. In addition, the ABE fermentation with JB200 can 64

82 produce butanol at a 50% higher titer and 100% higher productivity. Thus, butanol can be produced from sugarcane juice by the ABE fermentation with JB200 at ~$2.25/gal. A recent comparative economic analysis of ABE fermentation also showed that n-butanol can be produced from sugarcane at $0.59-$0.75 per kg or $1.8-$2.3 per gallon butanol, which is comparable to the petroleum derived n-butanol and less than half of that using corn ($1.295/kg) as the feedstock (Kumar et al., 2012). It should also be noted that the current n-butanol spot market price is ~$2200/ton or $6.7/gal. The production of n-butanol from sugarcane juice using C. acetobutylicum JB200 is thus economically attractive and promising for industrial application. 3.4 Conclusions This study demonstrated the stability and robustness of C. acetobutylicum JB200 in ABE fermentation. With cells immobilized in the FBB and sucrose as substrate, JB200 sustained stable ABE production in 16 consecutive repeated batch fermentations over a period of more than 30 days. With sugarcane thick juice as the substrate, g/l butanol and g/l ABE were produced from sucrose with a total ABE productivity of g/l h and yield of 0.31 g/g, making this fermentation process promising for industrial n-butanol production. References Chen, W.H., Chen, Y.C., Lin, J.G., Evaluation of biobutanol production from nonpretreated rice straw hydrolysate under non-sterile environmental conditions. Bioresour. Technol. 135,

83 Ezeji, T.C., Qureshi, N., Blaschek, H.P., Production of acetone butanol (AB) from liquefied corn starch, a commercial substrate, using Clostridium beijerinckii coupled with product recovery by gas stripping. J. Ind. Microbiol. Biotechnol. 34, Ezeji, T., Milne, C., Price, N.D., Blaschek, H.P., Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl. Microbiol. Biotechnol. 85, Filho, M.V., Araujo, C., Bonfa, A., Porto, W., Chemistry based on renewable raw materials: perspectives for a sugar cane-based biorefinery. Enzyme Res. 11, García, V., Päkkilä, J., Ojamo, H., Muurinen, E., Keiski, R.L., Challenges in biobutanol production: How to improve the efficiency? Renewable and Sustainable Energy Rev. 15, Green, E.M., Fermentative production of butanol-the industrial perspective. Curr. Opin. Biotechnol. 22, Huang, W.C., Ramey, D.E., Yang, S.T., Continuous production of butanol by Clostridium acetobutylicum immobilized in a fibrous bed bioreactor. Appl. Biochem. Biotechnol , Jain, M.K., Mutant strain of C. acetobutylicum and process for making butanol, US Patent No Jang, Y.S., Malaviya, A., Cho, C., Lee, J., Lee, S.Y., Butanol production from renewable biomass by clostridia. Bioresour. Technol. 123, Jiang, L., Wang, J., Liang, S., Cai, J., Xu, Z., Cen, P., Yang, S.T., Li, S., Enhanced butyric acid tolerance and bioproduction by Clostridium tyrobutyricum immobilized in a fibrous bed bioreactor. Biotechnol. Bioeng. 108, Jones, D.T., Woods, D.R.,1986. Acetone-butanol fermentation revisited. Microbiol. Rev. 50, Kumar, M., Goyal, Y., Sarkar, A., Gayen, K., Comparative economic assessment of ABE fermentation based on cellulosic and non-cellulosic feedstocks. Appl. Energy. 93, Lee, S.Y., Park, J.H., Jang, S.H., Nielsen, L.K., Kim, J., Jung, K.S., Fermentative butanol production by Clostridia. Biotechnol. Bioeng. 101, Liu, Z., Ying, Y., Li, F., Ma, C., Xu, P., Butanol production by Clostridium beijerinckii ATCC from wheat bran. J. Ind. Microbiol. Biotechnol. 37,

84 Lu, C., Zhao, J., Yang, S.T., Wei, D., Fed-batch fermentation for n-butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour. Technol. 104, Lu, C., Dong, J., Yang, S.T., Butanol production from wood pulping hydrolysate in an integrated fermentation-gas stripping process. Bioresour. Technol. 143, Marchal, R., Blanchet, D., Vandecasteele, J.P., Industrial optimization of acetonebutanol fermentation: a study of the utilization of Jerusalem artichokes. Appl. Microbiol. Biotechnol. 23, Mariano, A.P., Dias, M.O.S., Junqueira, T.L., Cunha, M.P., Bonomi, A., Filho, R.M., Butanol production in a first-generation Brazilian sugarcane biorefinery: Technical aspects and economics of greenfield projects. Bioresour. Technol. 135, Ni, Y., Wang, Y., Sun, Z., Butanol production from cane molasses by Clostridium saccharobutylicum DSM 13864: batch and semicontinuous fermentation. Appl. Biochem. Biotechnol. 166, Nicolaou, S.A., Gaida, S.M., Papoutsakis, E.T., A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: From biofuels and chemicals, to biocatalysis and bioremediation. Metab. Eng. 12, Papoutsakis, E.T., Engineering solventogenic clostridia. Curr. Opin. Biotechnol. 19, Papoutsakis, E.T., Tomas, C.A., Tesic, M., Santiago, J.Y., Increased cell resistance to toxic organic substances. US Patent No Qureshi, N., Blaschek, H.P., Recent advances in ABE fermentation: hyper-butanol producing Clostridium beijerinckii BA101. J. Ind. Microbiol. Biotechnol. 27, Qureshi, N., Lolas, A., Blaschek, H.P., Soy molasses as fermentation substrate for production of butanol using Clostridium beijerinckii BA101. J. Ind. Microbiol. Biotechnol. 26, Qureshi, N., Saha, B.C., Cotta, M.A., Butanol production from wheat straw hydrolysate using Clostridium beijerinckii. Bioprocess Biosyst. Eng. 30, Qureshi, N., Ezeji, T.C., Ebener, J., Dien, B.S., Cotta, M.A., Blaschek, H.P., Butanol production by Clostridium beijerinckii. Part I: use of acid and enzyme hydrolyzed corn fiber. Bioresour. Technol. 99, Qureshi, N., Saha, B.C., Dien, B., Hector, R.E., Cotta, M.A., 2010a. Production of butanol (a biofuel) from agricultural residues: Part I - Use of barley straw hydrolysate. Biomass Bioenerg. 34,

85 Qureshi, N., Saha, B.C., Hector, R.E., Dien, B., Hughes, S., Liu, S., Iten, L., Bowman, M.J., Sarath, G., Cotta, M.A., Production of butanol (a biofuel) from agricultural residues: Part II - Use of corn stover and switchgrass hydrolysates. Biomass Bioenerg. 34, Servinsky, M.D., Kiel, J.T., Dupuy, N.F., Sund, C.J., Transcriptional analysis of differential carbohydrate utilization by Clostridium acetobutylicum. Microbiol. 156, Shaheen, R., Shirley, M., Jones, D.T., Comparative fermentation studies of industrial strains belonging to four species of solvent-producing clostridia. J. Mol. Microbiol. Biotechnol. 2, Thang, V.H., Kanda, K., Kobayashi, G., Production of acetone-butanol-ethanol (ABE) in direct fermentation of cassava by Clostridium saccharoperbutylacetonicum N1-4. Appl. Biochem. Biotechnol. 161, Xue, C., Zhao, J., Lu, C., Yang, S.T., Bai, F., Tang, I.C., High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping. Biotechnol. Bioeng. 109, Yang, S.T., Zhao, J., Adaptive engineering of Clostridium for increased butanol production, US Patent No Yu, M., Zhang, L., Tang, I.C., Yang, S.T., Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab. Eng. 13, Zhao, J., Lu, C., Chen, C.C., Yang, S.T., Biological production of butanol and higher alcohols. Bioprocessing Technologies in Biorefinery for Sustainable Production of Fuels, Chemicals, and Polymers. Wiley, Chapter 13, pp

86 Table 3.1 Kinetics of ABE fermentation of sucrose and sugarcane thick juice by JB200. Yield (g/g) Free-cell fermentation Glucose Sucrose Sugarcane thick juice Productivity (g/l h) Yield (g/g) Productivity (g/l h) Yield (g/g) Productivity (g/l h) Butanol 0.22± ± ± ± Acetone 0.09± ± ± ± Ethanol 0.017± ± ± ± Total ABE FBB fermentation 0.33± ± ± ± Butanol ± ± ± ±0.01 Acetone ± ± ± ±0.01 Ethanol ± ± ± ±0.00 Total ABE : Not available ± ± ± ±

87 Table 3.2 Solvents production from sucrose and agricultural residues by various Clostridia strains. Feedstock Strain Glucose C. beijerinckii BA101 C. acetobutylicum JB200 Sucrose C. acetobutylicum JB200 Sugarcane C. acetobutylicum juice JB200 C. saccharobutylicum Cane DSM molasses C. beijerinckii NCP P260 Soy C. beijerinckii molasses BA101 Jerusalem C. acetobutylicum artichokes IFP 904 Maize mash C. acetobutylicum ATCC 4259 Corn starch, C. beijerinckii liq. BA101 Corn starch C. Cassava saccharoperbutylacetonicum starch N1-4 Cassava C. acetobutylicum bagasse JB200 Barley straw C. beijerinckii P260 Corn stover C. beijerinckii P260 Corn fiber C. beijerinckii BA101 C. Rice straw saccharoperbutylacetonicum N1-4 Wheat straw C. beijerinckii BA101 Wood pulp C. beijerinckii CC101 Switchgrass C. beijerinckii P260 NA: not available Butanol (g/l) ABE (g/l) ABE Yield (g/g) ABE Productivity (g/l) References Qureshi et al. 2001a Lu et al This study This study This study Ni et al NA Shaheen et al Qureshi et al. 2001b Marchal et al NA NA Shaheen et al Ezeji et al., Thang et al Lu et al Qureshi et al. 2010a Qureshi et al. 2010b Qureshi et al Chen et al., 2013 Qureshi et al Lu et al Qureshi et al., 2010b 70

88 Table 3.3 Comparison of biobutanol production in ABE fermentation from corn starch (glucose) and sugarcane juice (sucrose). Feedstock Corn starch (Glucose) Sugarcane juice (Sucrose) Microorganism Substrate cost ($/kg) Butanol / ABE titer (g/l) Butanol Productivity (g/l h) Butanol / ABE yield (g/g) C. acetobutylicum ATCC 824 Corn: $210/ton 61% starch $0.344/kg corn starch 12 / / 0.35 C. acetobutylicum JB200 Sugarcane: $27.26/ton a 15.3% total reducing sugars $0.178/kg sucrose 18 / / 0.35 Butanol production cost $4.50/gal or $1.47/kg b $2.25/gal or $0.74/kg a Mariano et al., b Current n-butanol production cost in ABE fermentation using corn meal as the feedstock in China. 71

89 Figure 3.1 Experimental set-up of the fibrous bed bioreactor (FBB) system. Scanning electron micrographs showing high density of cells in the fibrous matrix. They either attached to the fiber surface or formed large clumps in the interstitial space. 72

90 Substrates (g/l) OD, products (g/l) Substrate (g/l) OD, products (g/l) Substrate (g/l) OD, products (g/l) A Glucose Ethanol Acetic acid Butyric acid Acetone Butanol OD B C Time (h) Sucrose Glucose Fructose Butanol Acetic Acid Acetone Ethanol Butyric acid OD Time (h) Sucrose Glucose Fructose Butanol Acetic Acid Acetone Ethanol Butyric acid OD Time (h) Figure 3.2 Kinetics of free-cell batch fermentations of C. acetobutylicum JB200 with different carbon sources. (A) Glucose; (B) Sucrose; (C) Sugarcane thick juice containing sucrose, glucose and fructose. 73

91 Sp. Growth Rate ( -1 ) Sp. Growth Rate ( -1 ) A 100 Glucose 10 1 µ = ± h Time (h) B 100 Sucrose 10 1 µ= ± h Time (h) Figure 3.3 Growth kinetics of C. acetobutylicum JB200 on glucose and sucrose, respectively, as substrate. (A) Growth on glucose. Different symbols show three different batch cultures seeded with glycerol-stock cultures prepared and stored in the deep freezer for 1, 6, and 12 months, respectively. There was no apparent difference in the specific growth rate for these cultures. (B) Growth on sucrose ( ) or sugarcane juice ( ). 74

92 Substrates (g/l) Products (g/l) Substrate (g/l) Products (g/l) A Sucrose Acetic Acid Ethanol Butanol Acetone Butyric acid Time (h) B Butanol Butyric acid Acetone Ethanol Acetic Acid Sucrose Glucose Fructose Time (h) Figure 3.4 Kinetics of immobilized-cell batch fermentations of C. acetobutylicum JB200 in the FBB with different carbon sources. (A) Sucrose; (B) Sugarcane thick juice. 75

93 Substrates (g/l) Products (g/l) Substrate (g/l) Products (g/l) A 120 Butanol Butyric acid Acetone Ethanol Acetic Acid Sucrose Time (h) B Sucrose Glucose Fructose Butanol Acetic Acid Acetone Ethanol Butyric acid Time (h) Figure 3.5 Repeated batch fermentations of C. acetobutylicum JB200 in the FBB with different carbon sources in 19 consecutive batches showing stable fermentation performance. (A) Sucrose; (B) Sugarcane thick juice. 76

94 B/A ratio (g/g) Productivity (g/l/h) Yield (g/g) Productivity (g/l/h) Yield (g/g) A Butanol Productivity Butanol Yield Batch # B ABE yield ABE Productivity Batch # C B/A ratio Batch # Figure 3.6 Kinetics of repeated batch fermentations of C. acetobutylicum JB200 in the FBB. (A) Butanol yields and productivities; (B) ABE yields and productivities; (C) B/A ratio. 77

95 Chapter 4 : Effects of external driving forces on redox balance and butanol production of engineered Clostridium tyrobutyricum mutant Abstract Butanol production by solventogenic Clostridia via ABE fermentation suffers from low titer and selectivity, leading to high cost in following recovery and separation processes. In our previous studies, we constructed a mutant CtΔack-adhE2 by overexpressing adhe2 gene in Clostidium tyrobutyricum acetate knockout strain. It can produce 10 g/l butanol as the main solvent product with no acetone and little ethanol. In this study, in order to further boost butanol production in CtΔack-adhE2, extra NADH driving forces provided by artificial electron carriers such as methyl viologen (MV) and benzyl viologen (BV) were created to direct more electrons and carbon towards butanol synthesis. Compared to the batches without MV or BV, significant increases in butanol titer and yield and decreases in acids and H2 generation were observed with MV or BV addition. Butanol titer as high as g/l with a yield of 0.27 g/g was achieved with 10 µm BV and 0.5 g/l cysteine in CtΔack-adhE2 fermentation using xylose as the substrate. Changes in oxidation reduction potential (ORP) in experimental and control fermentation batches were compared to evaluate possible effects of artificial electron carriers on cell redox balance. 78

96 4.1 Introduction With the rapid increase of gasoline prices and the concerns of sustainable development, biofuels have gained more and more attention during the past decade. Although bioethanol production from engineered E. coli and yeast has met industrial requirements, it still suffers from low energy density, high volatility and hygroscopicity, and cannot be directly used in current engine system (Stephanopoulos, 2007). On the other hand, butanol has a lower solubility in water and its motor octane number is close enough to gasoline to be compatible with present diesel engines. Therefore, n-butanol is proposed to be a better candidate to replace petrol or serve as an additive in future gasoline manufacture (Dürre, 2008). Certain strains in Clostridium genera are native butanol producers (Keis et al., 2001). These solventogenic strains are able to generate acetone-butanol-ethanol (ABE) at a ratio of 3:6:1 via anaerobic fermentation (Jones and Woods, 1986). Various strategies have been utilized to increase butanol production in these microbes. Strain improvement through mutagenesis followed by screening as well as metabolic engineering has been performed. The highest butanol titer (20.4 g/l) in batch fermentation was achieved with JB200, a mutant strain developed from Clostridium acetobutylicum ATCC via evolutionary random mutagenesis (Lu et al., 2012). Meanwhile, bioprocess engineering including media optimization (Choi et al., 2012; Parekh et al., 1999), cell immobilization (Zhang et al., 2009; Liu et al., 2003), and in situ product recovery (Xue et al., 2012) was conducted to further boost butanol titer, yield and productivity. Some of these studies also demonstrated that the redox potential was tightly associated with butanol production (Girbal and Soucaille, 1994; Vasconcelos et al., 1994; Wang et al., 2012), and thus, methods leading to more 79

97 NADH generation often resulted in higher butanol formation (Liu et al., 2013; Peguin and Soucaille, 1995). Oxidation / reduction potential (ORP) is a measurement of the tendency of chemicals to obtain electrons and therefore, be reduced. The oxidizing compound and its reduced form are named as a redox pair (or redox couple), which has an intrinsic standard ORP value (Table 4.1). The higher the value is, the more easily the oxidizing compound acquires electrons. Compared to ph, an indicator of proton level, ORP displays the electron activities. During fermentation, the overall ORP is a combined result of extracellular environmental ORP and intracellular cell metabolism. The ORP in cell culture broth is affected by different reduction degrees of media components as well as secretory chemicals from cell fermentation. On the other hand, the extracellular ORP influences intracellular ORP by electron transfer. It can adjust intracellular metabolism by interacting with membrane-bound oxidoreductases (Baker and Lawen, 2000). Chemicals like dissolved oxygen can pass through cell membrane and react directly with metabolites within the cell. In addition, the intercellular ORP also controls gene expression through redox sensing regulatory proteins (Wietzke and Bahl, 2012). These transcriptional factors regulate the synthesis of enzymes involved in different metabolic pathways according to the redox status (Wang et al., 2013). Consequently, new redox balance will be achieved as a net outcome from carbon flow redistribution and product generation (Fig. 4.1) (Pei et al. 2011; Wietzke and Bahl, 2012). Although techniques for simultaneous intracellular ORP measurement are limited, ORP of the fermentation broth can be easily detected by using 80

98 an ORP electrode. Since cells actively interact with the environment they live in, extracellular ORP can effectively represent the ORP changes within the cell. Certain redox pairs are essential in redox balance maintenance in fermentation and product formation. Under aerobic conditions, the electrons are eventually transferred to dissolved O2 to form H2O, because O2/H2O has the highest standard ORP value among all the metabolites. Therefore, regulating the level of dissolved O2 has become a useful way to manipulate fermentation processes as well as change product spectra under aerobic conditions (Phem et al., 2008; Djelal et al., 2006). As for anaerobic fermentation, there is no detectable dissolved oxygen. Therefore, the ORP value is mainly determined by the reduction stages of various chemicals in the medium as well as intermediate metabolites and end-products generated in cell metabolism (Chen et al., 2012; Nakashimada et al., 2002). Among all of these, the redox pair NADH/NAD + was confirmed to play a crucial role in intercellular metabolism. It not only affects the ORP by itself, but also participates in numerous oxidation-reduction reactions as cofactors (KEGG report, 2012). In addition, the ratio of NADH/NAD + affects the affinity of transcriptional regulators on gene promoter region and thus, control the global gene expression profile, especially under stress response (Wietzke and Bahl, 2012; Wang et al., 2013). ABE fermentation is biphasic, which contains acidogenesis and solventogenesis (Jones and Woods, 1986). Based on previous research, a theory was developed to demonstrate the correlation between NADH availability and butanol production in solventogenic Clostridia. In the first part, substrate like glucose or xylose is consumed to produce acids and generate ATP for cell growth and proliferation. During this time, the electrons formed in pyruvate 81

99 cleavage are transferred to hydrogenase mediated by oxidized ferredoxin. As a result, a large amount of hydrogen is produced. When the accumulation of acids reaches the limit of cell tolerance, the ph gradient across cell membrane can no longer be sustained (Huang et al., 2010). Cell growth slows down and stress response system is activated. Proteins related to solvent production are expressed and cells shift to solventogenesis (Grimmler et al., 2011; Grupe and Gottschalk, 1992). In this stage, acids are reassimilated to produce acetone, ethanol and butanol. The generation of ethanol or butanol also requires two moles of NADH. Therefore, the electrons generated from pyruvate to acetyl-coa are directed to ferredoxin-nad + reductase, instead of hydrogenase, to produce NADH. The ratio 3:6:1 for acetone, butanol and ethanol is a combined result from carbon distribution and intracellular redox balance sustainment (Jones and Woods, 1986). According to this theory, various studies have been conducted to further understand the effects of NAD(P)(H) on ABE fermentation and to manipulate relative metabolic flux towards solvents production. Collas et al cloned adh, a secondary alcohol dehydrogenase from C. beijerinckii to C. acetobutylicum ATCC 824 to convert acetone to isopropanol. They reported that coupled with overexpression of the acetoacetyl-coa: acetate/butyrate: CoA transferase ctfab, a total isopropanol-butanol-ethanol titer of 24.4 g/l with 8.8 g/l isopropanol was achieved (Collas et al., 2012). In contrast, the mutant containing the empty plasmid produced 20.2 g/l ABE, including 7.6 g/l acetone (Collas et al., 2012). Later, the same adh was overexpressed in a butanol-tolerant strain C. acetobutylicum Rh8, and the total alcohol titer was boosted to g/l with 15 g/l butanol production (Dai et al., 2012). Since the production of isopropanol required NADPH as a cofactor, it seemed that 82

100 overexpression of adh redirected both carbon and electron fluxes towards solvent generation. In addition, Yu et al. introduced the adhe2 gene from C. acetobutylicum ATCC 824 to the acidogenic C. tyrobutyricum with acetate kinase knockout (Fig. 4.2) (Liu et al., 2006). The transformant was able to produce 10 g/l butanol when glucose was used as the substrate and the titer went up to 16 g/l with mannitol (Yu et al., 2012). It was concluded that more reduced substrate mannitol enhanced NADH availability and therefore, increased butanol titer, the most reduced product at the cost of more oxidized acids (Yu et al., 2012). In these studies, redox redistribution was resulted from gene overexpression and knockout targeted to produce solvents, rather than the cause for enhanced solvent production. The power of reduce was better exhibited in synthetic biology strategies, in which the butanol pathway and regulatory proteins were manipulated in non-native solvent producers. It was demonstrated that by deleting the reactions consuming NADH, along with overexpressing a synthetic butanol producing pathway, the engineered E. coli strain was able to produce 1.3 g/l butanol under anaerobic condition (Shen et al., 2011). Then, a formate hydrogenase (Fdh) which oxidizes formate to form CO2 and NADH was overexpressed in the previous strain and the butanol titer was boosted to more than 5 g/l (Shen et al., 2011). However, when the same fdh gene was overexpressed in the wild type strain with the butanol synthetic pathway but without deletion of the other NADH consuming reactions, the strain performed poorly in butanol synthesis (~0.5 g/l) (Shen et al., 2011). These results emphasized the significance of NADH driving power in butanol production and implied that enhancing NAD(P)H level might be a promising method to increase solvent generation in other microbial organisms. 83

101 In accordance with strain development strategies, bioprocess studies of solvent producing strains also revealed the effects of ORP on product spectra. It was claimed that by sparging H2 into C. acetobutylicum culture broth, the butanol and ethanol titers were increased, while acetone and H2 production were hindered (Yerushalmi et al., 1985). It was explained that as partial H2 pressure was increased, the activity of hydrogenase was arrested by product inhibition (Yerushalmi et al., 1985). Thus, more electrons were flown to ferrodoxin NAD + reductase to balance intracellular redox and more butanol and ethanol were generated with increased NADH driving force. Meanwhile, when a mixture of glucose and glycerol was used as substrates, C. acetobutylicum shifted from a sole acidogenic strain to solvent producer at neutral ph (Vasconcelos et al., 1994). This might be due to the more reduced status of glycerol, which led to the activation of ferrodoxin NAD + reductase and a 7-fold increase in NADH level (Vasconcelos et al., 1994). Moreover, previous studies manifested that artificial electron carriers like methyl viologen (MV) and benzyl viologen (BV) were capable of modulating electron flow from hydrogen generation to NAD(P)H formation in C. acetobutylicum (Rao and Mutharasan, 1986, 1987; Peguin et al., 1994; Peguin and Soucaille, 1995). With a similar first stage ORP to ferredoxin, MV could inhibit the activity of hydrogenase by competing with reduced ferredoxin for the active sites. The electron flow from pyruvate was then redirected through oxidized ferrodoxin to ferrodoxin NAD + reductase to generate NADH. The increased NADH level pulled the carbon flux toward butanol production. These reports illustrated an easy way to manipulate the intracellular redox balance and provided a useful strategy to study the correlation between ORP and solvent production. 84

102 In this study, C. tyrobutyricum ack knockout harboring pmtl82151-adhe2 mutant was used as the host to study the effects of external driving forces (MV or BV) on redox balance and butanol production. Unlike native solvent producers, C. tyrobutyricum was a sole acidogenic strain. With acetate kinase knocked out and adhe2 overexpressed, it could produce a high amount of butanol but no acetone and little ethanol, which made it an excellent candidate for this study (Yu et al., 2012). The extracellular ORP was measured to represent the intercellular cell metabolism and the production of H2 was monitored to demonstrate the activity of hydrogenase in vivo. 4.2 Materials and methods Strains and culture conditions Clostridium tyrobutyricum acetate kinase (ack) knockout strain carrying pmtl adhe2 was used in this study (Yu et al., 2011). The seed was cultured at 37 C in the Clostridium Growth Medium (CGM) containing 40 g/l glucose, 2 g/l (NH4)2SO4, 1 g/l K2HPO4, 1 g/l KH2PO4, 0.1 g/l MgSO4 7H2O, 2 g/l yeast extract, 4 g/l trypticase peptone, g/l FeSO4 7H2O, g/l CaCl2 2H2O, 0.01 g/l MnSO4 H2O, 0.02 g/l CoCl2 6H2O, g/l ZnSO4 7H2O. The minerals were made in a 50-fold solution and filtered through 0.22 m membrane to sterilize. In batch fermentation, CSL medium containing 30 g/l corn steep liquor (Cargill, Eddyville, IA), 3 g/l (NH4)2SO4, 1.5 g/l K2HPO4, 0.03 g/l FeSO4 7H2O, and 0.6 g/l MgSO4 7H2O was utilized. 0.5 or 1.5 g/l cysteine was added when xylose was used as the substrate. The stock culture was conserved 85

103 anaerobically at -80 C in reinforced clostridial medium (RCM; Difco, Detroit, MI) containing 15% glycerol and 30 μg/ml thiamphenicol Free cell fermentation in bioreactor with ORP and gas measurement The effects of methyl viologen or benzyl viologen on redox potential and butanol production of Ct ack-adhe2 were determined in bench scale fermentation (Fig. 4.3) fold methyl viologen or benzyl viologen (Sigma-Aldrich) stock solution was made and sterilized by filtration. The sugar (glucose or xylose) and the rest CSL medium components were sterilized and purged separately, and combined together afterwards to make total 1.5 L medium containing g/l sugar with ph adjusted to 6.5. The seed culture was fostered in 100 ml CGM medium, at 37 C, overnight. Methyl viologen or benzyl viologen was added to the final concentration of 500 μm and 10 μm, respectively, before inoculation. 30 μg/ml thiamphenicol was used as antibiotic selection. The fermentation was carried out anaerobically in a spinner flask at 37 C with agitation at 350 rpm. The ph was controlled at 6.0 by adding 20% (V/V) NH4OH. Samples were taken periodically for analysis of cell growth, and sugar and product concentrations. A redox electrode (Mettler, Pt4805-sc-k8s), connected to a ph/redox controller (Cole Parmer, ), was used to measure redox potential of the fermentation broth. The gas produced during the fermentation was measured with a 5 L graduated cylinder using the drainage method. A small portion of gas sample was collected periodically Analytical methods Cell growth was calculated based on the optical density at 600 nm (OD600) measured with 86

104 a spectrophotometer (UV-16-1, Shimadzu, Columbia, MD). Samples were diluted until OD600 was between 0.2 and 0.8 to ensure accuracy. The sugar concentration was determined by using high liquid chromatography (HPLC, LC-20AD, Shimadzu, Columbia, MD) with a Rezex ROA-Organic Acid H+ column (Phenomenex, Torrance, CA) and a refractive index detector (RID) N H2SO4 was used as the mobile phase. Samples were centrifuged at 13,200 g for 10 min. and diluted 10 times with distilled water before analysis. 15 µl sample was then injected by an auto injector (SIL-10Ai) and analyzed for 40 min. with the column temperature set at 45 C. All the fermentation products except for gases were measured by gas chromatography. A Zebron ZB-FFAP capillary GC column (30 m, 0.25 mm internal diameter and 0.25 μm film thickness, Phenomenex, Torrance, CA) equipped with an auto sampler (AOC-20i, Shimadzu, Columbia, MD) and a flame ionization detector (FID) was used to measure the concentrations of fermentation products including isopropanol, ethanol, butanol, butyric acid, acetone and acetic acid. One L acidified sample was injected at 250 C. The temperature of the column was programmed at 60 C for 3 min., and increased by 30 C per min. until it reached 150 C, then held at 150 C for 4 min. The detector temperature was set at 250 C. Isobutanol and isobutyric acid were used as the internal standards for concentration calculation. The gas sample was soaked into saturated NaOH solution and the initial and final gas volumes were used to estimate the CO2 percentage in the gas mixture, which was then used to estimate the amounts (volumes) of CO2 and H2 produced in the fermentation. 87

105 4.3 Results and discussion Effects of methyl viologen on redox potential and butanol production In order to examine the effects of methyl viologen on butanol production and associated redox potential change, free cell fermentation was carried out using glucose as the substrate supplemented with or without MV (Fig. 4.4 and Fig. 4.5). It was clear that MV had significant influence on the fermentation performance of Ct ack-adhe2. Firstly, the butanol titer was boosted from g/l to g/l, with both yield and productivity increased from 0.13 g/g and g/l h to 0.26 g/g and g/l h, respectively. This data was in agreement with previous observation of enhancement in butanol production upon MV addition in C. acetobutylicum (Peguin et al., 1994). It implied that although C. tyrobutyricum was an acidogenic strain, it shared a similar electron regulation strategy with solventogenic C. acetobutylicum in intercellular redox balance maintenance. Meanwhile, in the presence of MV, the titers of butyric acid and acetic acid were decreased. Butyric acid production reduced from 7.99 g/l to 1.57 g/l and acetic acid titer dropped to only 0.83 g/l from g/l. These data indicated that the input of MV redirected the carbon flux towards the generation of butanol at the expense of acids production. In addition, there was a slight decrease in ethanol titer from 2.12 g/l to 1.24 g/l. These results are highly desirable in industrial butanol production because the following separation cost would be significantly reduced when butanol is the only main product in the fermentation broth (Papoutsaki et al., 2005). 88

106 Secondly, by comparing Figures 4.4B and 4.5B, it can be concluded that MV was toxic to cell growth. The maximum OD600 was 44.2 in the batch without MV, but decreased to 23.2 when MV was added. Moreover, the specific growth rate of Ct ack-adhe2 in glucose fermentation was also reduced almost 50% from h -1 to h -1. This could be attributed to the decrease of ATP generation. Since more carbon was used to produce butanol when MV was present, less carbon was directed to form acetic acid and butyric acid. Therefore, the ATP generation coupled with acids production was diminished. Since there was not enough ATP, cell growth was prohibited. In contrast, the redox potential of the two cultures showed a similar trend. Initially, the presence of MV resulted in a 10 mv decrease in the redox potential. Then in both batches, the redox dropped rapidly from about -25 mv to -300 mv in the lag phase and then decreased slowly to about -350 mv, along with the start of cell growth and products generation. After that, the redox potential started to climb up, until it reached -305 mv and -290 mv for batch with and without MV, respectively. In the end, there was a slight decrease in ORP in the batch without MV, but an increase of ~10 mv in the one with MV. Since this measurement was extracellular, which means, it was a reflection of the overall redox change of the cell metabolism based on the environment they lived in, it could not be coupled with any specific cell activities. However, it was clear that the addition of MV did not alter the redox potential as notably as it did on acids and butanol production. This suggested that although the addition of MV redistributed the electron flow, it did not change the electron balance throughout the fermentation. The extra NADH generated by ferredoxin-nad+ reductase activation upon MV might have been utilized simultaneously in butanol generation. Therefore, there was 89

107 no extra NADH accumulated and no significant redox alteration observed. This also implies that the adhe2 was highly active that it was able to convert butyryl-coa to butanol as long as NADH existed. Based on the redox potential data, it seemed that ORP from mv to -290 mv was adequate for butanol production using glucose as the substrate. This data was consistent with Wang et al. s study of C. acetobutylicum DSM 1731, in which ORP -290 mv was considered to be the ideal value for butanol formation (Wang et al., 2012). The production of H2 and CO2 in the fermentation is shown in Figures 4.1C and 4.2C. With MV addition, a significant reduction (from 8.75 L to 1.76 L) in H2 production was observed, indicating that MV did inhibit the activity of hydrogenase in vivo. In the meantime, the production of CO2 increased from 6.28 L to 7.05 L. It is possible that MV increased the speed of conversion of reduced ferredoxin to oxidized ferredoxin by activating ferredox- NAD+ reductase. The increased amount of substrate oxidized ferredoxin could have promotion effect on the pyruvate ferredoxin oxdioredutase. Therefore, as a byproduct from pyruvate to acetyl-coa, CO2 production increased. The product titers, yields and productivities of two different batches are compared in Table 4.2 and Fig Effects of benzyl viologen on redox potential and butanol production It was demonstrated that benzyl viologen (BV), concomitant with cysteine, had beneficial effects on butanol production in Ct ack-adhe2 xylose fermentation (Du, 2013). Thus, its impacts on redox potential and gas production were examined to unveil the underneath principles of carbon and electron distributions in the mutant. The results of Ct ack-adhe2 90

108 xylose fermentation are illustrated in Fig Compared to glucose fermentation, by using xylose as the substrate, the mutant produced 3.18 g/l, 2.24 g/l more butanol and butyric acid, but 4.49 g/l and 0.31 g/l less acetic acid and ethanol. This could be explained by the more reduced status of xylose than glucose. Because stoichiometrically, 1 mole of glucose leads to 2 moles each of pyruvate and NADH, while 1 mole of xylose produce 1.7 moles pyruvate and 2 moles of NADH. Thus, xylose has a higher ratio of NADH/pyruvate, which was more reduced and therefore, more preferred in butanol production (Peguin et al., 1994). In addition, there was a longer lag phase when xylose was used, leading to a drop of 0.86 h -1 in specific growth rate, indicating there was a longer induction time for cells to utilize xylose. In gas production, the total gas amount increased from L to L, while the H2/CO2 ratio in xylose fermentation decreased from 1.39 v/v in glucose fermentation to 0.68 v/v. Moreover, although the trend of redox potential was similar in both batches, the lowest redox point in cells using xylose was 35 mv higher than glucose. This data suggested that although xylose was more reduced than glucose, its reducing power was transferred effectively to butanol, the most reduced end point product and there was no remarkable accumulation of reduced intermediates. According to previous studies, 10 µm BV and 0.5 g/l cysteine were blended to the culture broth to test their influence on Ct ack-adhe2 xylose fermentation. Similar changes as seen in MV addition were observed in fermentation kinetics (Fig. 4.7). A final butanol titer of g/l was achieved, while titers of butyric acid (4.13 g/l), acetic acid (0.94 g/l), ethanol (0.54 g/l) and hydrogen (2.58 L) were reduced in contrast to the batch without BV and cysteine (Table 4.2). It was notable that in the presence of BV and cysteine, the redox 91

109 potential dropped to -365 mv in the lag phase, which was the lowest among all the batches. It then rose up slowly and reached -230 mv, which was about the same to the batch without BV and cysteine. This result supported the claim that reducing power could drive the metabolic flux towards butanol production (Shen et al., 2011). In order to evaluate the effects of BV and cysteine individually, Ct ack-adhe2 xylose fermentation with only BV and BV plus 1.5 g/l cysteine were conducted, and the kinetics are shown in Fig. 4.8 and Fig It seemed that when only BV was used, the cell growth was arrested, with the fermentation period elongated to about 10 days and the final OD600 reached only Although a decrease of butyric acid/butanol ratio was again observed, the titers of all the products were reduced. The redox potential profile demonstrated that the redox balance within the cell was badly interfered. It was first dropped to -330 mv as the batch without BV. Then the redox potential jumped up and fluctuated at around 100 mv, and finally went back down to around -160 mv. Since the standard redox potential of BV was -359 mv, the abnormal increase of ORP in the culture broth might be due to the imbalance of cell metabolism caused by BV rather than BV itself. It could also be proposed that the addition of 0.5 g/l cysteine rescued the cells from the harmful influence of BV and maintained the redox potential in a range that was suitable for butanol production. To further investigate role of cysteine and its effects on redox regulation, fermentation supplemented with 1.5 g/l cysteine along with 10 µm BV was utilized in Ct ack-adhe2 xylose fermentation (Fig. 4.9). In this batch, the cells produced g/l butanol, 0.44 g/l ethanol, 0.42 g/l acetic acid, and 4.23 g/l butyric acid. Compared to Fig. 4.7A, it was clear that except the titer of butyric acid, the formation of the rest of the products all 92

110 decreased. Meanwhile, the fermentation period was extended for ~1 day, and the maximum OD600 was reduced. As shown in Fig. 4.9B, the additional cysteine did keep the redox balance lower at the beginning of fermentation, compared to Fig. 4.7B. Meanwhile, in the latter period of fermentation, instead of increasing as in the other batches, the redox potential of the batch with 1.5 g/l cysteine decreased to -320 mv, and the butanol production was diminished. This data indicated that the lower ORP resulted from additional cysteine was not favored in cell metabolism, as well as butanol generation. It could be attributed to the imbalanced redox potential caused by excessive cysteine addition. Based on the redox profiles of all the xylose fermentation, a redox potential range from -315 mv to -240 mv seemed to be preferable for butanol production by Ct ack-adhe2 using xylose. Recent progresses showed that besides influencing the carbon flux and butanol generation, the homeostasis of redox couple NADH/NAD + might also be involved in enzyme transcriptional regulation, especially in stress response (Murray et al., 2011; Vemuri et al., 2006; Kültz, 2005). Transcriptional regulation of solventogenesis in C. acetobutylicum illustrated the role of protein Rex in redox mediated modulation of solvent synthetic gene expression. Rex was a redox-sensing protein and was proposed to be a transcriptional repressor on genes essential for carbon and energy metabolism in various bacteria strains (Brekasis and Paget, 2003; Ravcheev et al., 2012; Pei et al., 2011). In Wang et al. s transcriptional microarray assay of C. acetbutylicum, a high level of up-regulation of adhe2 and adhe1-ctfab was observed when rex was down-regulated in response to butyrate stress (Wang et al., 2013). In addition, Wietzke and Bahl demonstrated that Rex was able to interact with the promoter regions of crt, thl, and adhe2 (see Fig. 4.2) in C. 93

111 acetobutylicum (Wietzke and Bahl, 2012). Also, its affinity to the adhe2 promoter was dependent on the ratio of NADH/NAD + rather than NADH or NAD + individually. Their later studies showed an up-regulated transcript levels of thl, adhe2 and bcs operon (including crt, bcd, etfab and hbd) in rex negative strain (Wietzke and Bahl, 2012). In addition, the study of a newly isolated solventogenic C. tetanomorphum GT6 strain also illustrated a rex like gene upstream of the bcs operon. The promoter analysis of the bcs and some upstream NADH oxidization related genes unveiled their potential binding regions for Rex (Panitz et al., 2014). These studies unveiled that the role of Rex in regulating fermentation products associated genes might be extensive and fundamental in anaerobic bacteria. Therefore, the enhanced butanol production in Ct ack-adhe2 might also be attributed to the down-regulation of Rex. Since the addition of MV or BV increased NADH/NAD + ratio, Rex lost its affinity towards the thl promoter in front of adhe2. As a result, the repression on adhe2 gene expression was relieved and AdhE2 enzyme activity increased. Nevertheless, the detailed mechanism will still need to be investigated. Compared to other studies, using C. tyrobutyricum ack-adhe2 as the host for industrial butanol fermentation with external driving force has many advantages. Firstly, Ct ackadhe2 has the highest butanol titer among all non-native butanol producers. So far, extensive efforts have been contributed to metabolically engineered model systems like E. coli (Bond-Watts et al., 2011; Shen et al., 2011) and S. cerevisiae (Si et al., 2014; Krivoruchko et al., 2013) to produce butanol. The most promising result came from Shen et al., in which they overexpressed butanol pathway associated genes including hbd, crt and adhe2 from C. acetobutylicum (see Fig. 4.2), ter encoding NADH dependent crotonyl- 94

112 CoA specific trans-enoyl-coa reductase from Treponema denticola and fdh, a formate dehydrogenase gene from Candida boidinii. Along with the shutdown of other NADH consuming pathways, the mutant produced about 15 g/l butanol (Shen et al., 2011). However, it is still lower than our report. Secondly, using Ct ack-adhe2 with MV or BV addition can remarkably reduce the separation cost. Native solvontogenic Clostridium strains has to produce ABE in order to balance materials and redox. The generation of acetone and ethanol would not only compromise butanol yield, but also complicate the product recovery process (Keasling and Chou, 2008). Engineered Ct ack-adhe2 does not produce acetone. Meanwhile, with the addition of MV or BV, the acids generation is sacrificed to produce a high titer of butanol. Therefore, butanol becomes the only main product in the fermentation broth. Since butanol is moderately miscible in water, it could be easily separated by gas stripping or other recovery approaches (Du et al., 2013). Thirdly, Ct ack-adhe2 is genetically stable. It was reported that C. beijerinckii strain BA101 was able to produce up to 23.6 g/l total ABE with a yield of 0.4 g/g using glucose. However, as it was obtained from random mutagenesis and screening, its outstanding solvent production capacity suffered from strain degeneration. On the other hand, Ct ack-adhe2 is achieved from metabolic engineering. Under thiamphenicol selection pressure, the mutant would need to sustain the plasmid pmtl82151-adhe2 in order to survive. Therefore, Ct ack-adhe2 is more reliable for industrial butanol manufacturing than mutagenesis-based strains. Recently, Wang et al utilized trace oxygen and cysteine to control the redox potential at -290 mv in C. acetobutylicum DSM 1731 ABE fermentation and observed an early onset of solvent production and increased productivity (Wang et al., 95

113 2012). This study demonstrates the importance of redox status in solvent production and provides insights into using redox engineering as a strategy to increase butanol production. Since the reported optimal redox range was close to the results, the similar method could be applied to further enhance butanol production by Ct ack-adhe Conclusions In this study, we examined the effects of artificial electron carriers, methyl viologen and benzyl viologen, on redox balance and butanol production by C. tyrobutyricum acetate kinase knockout strain containing pmtl adhe2 using glucose or xylose as substrate. When MV was utilized in glucose fermentation, the butanol titer, yield and productivity increased significantly compared to the one without MV, while the acids and H2 generation, and cell growth were hindered. However, there was no principal alteration in redox potential map observed. Similar results were obtained in xylose fermentation with BV and cysteine. It was confirmed that the addition of a certain amount of cysteine rescued the redox imbalance caused by BV and sustained the redox potential in a suitable range for butanol production. It could be concluded that Ct ack-adhe2 is a promising candidate for industrial butanol fermentation and the addition of artificial electron carrier would be a useful strategy to boost butanol titer, yield and productivity, as well as save the cost for following product recovery. 96

114 Reference Baker, M.A., Lawen, A., Plasma membrane NADH-oxidoreductase system: a critical review of the structural and functional data. Antioxid. Redox Signal. 2, Bond-Watts, B.B., Bellerose, R.J., Chang, M.C., Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways. Nat. Chem. Biol. 7, Bianco, P., Haladjian, J., Tobiana, G., Forget, P., Bruschi, M., Voltammetric determination of the redox potential of bacterial ferredoxins: Clostridium thermocellum ferredoxin. Bioelectroch. Bioener. 12, Brekasis, D., Paget, M.S., A novel sensor of NADH/NAD+ redox poise in Streptomyces coelicolor A3 (2). The EMBO J. 22, Chen, X., Jiang, S., Zheng, Z., Pan, L., Luo, S., Effects of culture redox potential on succinic acid production by Corynebacterium crenatum under anaerobic conditions. Process Biochem. 47(8), Collas, F., Kuit, W., Clément, B., Marchal, R., López-Contreras, A.M., Monot, F., Simultaneous production of isopropanol, butanol, ethanol and 2, 3-butanediol by Clostridium acetobutylicum ATCC 824 engineered strains. AMB Express, 2(1), Dai, Z., Dong, H., Zhu, Y., Zhang, Y., Li, Y., Ma, Y., Introducing a single secondary alcohol dehydrogenase into butanol-tolerant Clostridium acetobutylicum Rh8 switches ABE fermentation to high level IBE fermentation. Biotechnol. Biofuels. 5(1), De Graef, M.R., Alexeeva, S., Snoep, J.L., de Mattos, M.J.T., The steady-state internal redox state (NADH/NAD) reflects the external redox state and is correlated with catabolic adaptation in Escherichia coli. J. Bacteriol. 181(8), Djelal, H., Larher, F., Martin, G., Amrane, A., Effect of the dissolved oxygen on the bioproduction of glycerol and ethanol by Hansenula anomala growing under salt stress conditions. J. Biotechnol. 125(1), Du, Y., High-yield and high-titer n-butanol producttion from lignocellulosic feedstocks by metabolically engineered Clostridium tyrobutyricum. PhD dissertation, Ohio State University, Columbus, OH, USA. Grimmler, C., Janssen, H., Krauβe, D., Fischer,R.J., Bahl, H., Dürre, P., Liebl, W., Ehrenreich, A., Genome-wide gene expression analysis of the switch between acidogenesis and solventogenesis in continuous cultures of Clostridium acetobutylicum. J. Mol. Microbiol. Biotechnol. 20,

115 Grupe, H., Gottschalk, G., Physiological events in Clostridium acetobutylicum during the shift from acidogenesis to solventogenesis in continuous culture and presentation of a model for shift induction. Appl. Environ. Microbiol. 58(12), Huang, H., Liu, H., Gan, Y. R., Genetic modification of critical enzymes and involved genes in butanol biosynthesis from biomass. Biotechnol. Adv. 28(5), Jang, Y.S., Cho, J.H., Seung, D., Lee, S.Y., Papoutsakis, E.T., Bennett, G.N., Song, H., Characterization and evaluation of corn steep liquid in acetone-butanol-ethanol production by Clostridium acetobutylicum. Biotechnol. Bioprocess Eng. 18(2), Jones, D.T., Woods, D.R., Acetone-butanol fermentation revisited. Microbiol. Rev. 50(4), 484. Karp, G., Cell and Molecular Biology, 5th Ed. Wiley. Keis, S., Shaheen, R., Jones, D.T., Emended description of Clostridium acetobutylicum and Clostridium beijerinckii, and description of Clostridium saccharoperbutylacetonicum sp. nov. and Clostridium saccharobutylicum sp. nov. Int. J. Sys. Evol. Microbiol. 51, Krivoruchko, A., Serrano-Amatriain, C., Chen, Y., Siewers, V., Nielsen, J., Improving biobutanol production in engineered Saccharomyces cerevisiae by manipulation of acetyl-coa metabolism. J. Ind. Microbiol. Biotechnol. 40, Kültz, D., Molecular and evolutionary basis of the cellular stress response. Annu. Rev. Physiol. 67, Liu, D., Chen, Y., Li, A., Ding, F., Zhou, T., He, Y., Li, B., Niu, H., Lin, X., Chen, X., Wu. J., Ying, H., Enhanced butanol production by modulation of electron flow in Clostridium acetobutylicum B3 immobilized by surface adsorption. Bioresour. Technol. 129, Liu, X., Zhu, Y., Yang, S.T., Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol. Progr. 22, Liu, C.G., Xue, C., Lin, Y.H., Bai, F.W., Redox potential control and applications in microaerobic and anaerobic fermentations. Biotechnol. Adv. 31, Lu, C., Zhao, J., Yang, S. T., Wei, D., Fed-batch fermentation for n-butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour. Technol. 104,

116 Michaelis, L., Hill, E.S., The viologen indicators. J. Gen. Physiol. 16, 859. Murray, D.B., Haynes, K., Tomita, M., Redox regulation in respiring Saccharomyces cerevisiae. Biochim. Biophys. Acta. 1810, Nakashimada, Y., Rachman, M.A., Kakizono, T., Nishio, N., Hydrogen production of Enterobacter aerogenes altered by extracellular and intracellular redox states. Int. J. Hydrogen Energ. 27, Panitz, J.C., Zverlov, V.V., Pham, V.T.T., Stürzl, S., Schieder, D., Schwarz, W.H., Isolation of a solventogenic Clostridium sp. strain: Fermentation of glycerol to n- butanol, analysis of the bcs operon region and its potential regulatory elements. Sys. Appl. Microbiol. 37, 1-9. Papoutsakis, E.T., Santiago, J.Y., Tesic, M., Tomas, C.A., U.S. Patent No Parekh, M., Formanek, J., Blaschek, H.P., Pilot-scale production of butanol by Clostridium beijerinckii BA101 using a low-cost fermentation medium based on corn steep water. Appl. Microbiol. Biotechnol. 51, Pei, J., Zhou, Q., Jing, Q., Li, L., Dai, C., Li, H., Wiegel, J., Shao, W., The mechanism for regulating ethanol fermentation by redox levels in Thermoanaerobacter ethanolicus. Metab. Eng. 13, Peguin, S., Delorme, P., Goma, G., Soucaille, P., Enhanced alcohol yields in batch cultures of Clostridium acetobutylicum using a three-electrode potentiometric system with methyl viologen as electron carrier. Biotechnol. Lett. 16, Peguin, S., Goma, G., Delorme, P., Soucaille, P., Metabolic flexibility of Clostridium acetobutylicum in response to methyl viologen addition. Appl. Microbiol. Biotechnol. 42, Peguin, S., Soucaille, P., Modulation of carbon and electron flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl. Environ. Microbiol. 61, Pham, T.H., Mauvais, G., Vergoignan, C., De Coninck, J., Dumont, F., Lherminier, J., Lherminier, J., Cachon R., Feron, G., Gaseous environments modify physiology in the brewing yeast Saccharomyces cerevisiae during batch alcoholic fermentation. J. Appl. Microbiol. 105, Rao, G., Mutharasan, R., Alcohol production by Clostridium acetobutylicum induced by methyl viologen. Biotechnol. Lett. 8, Rao, G., Mutharasan, R., Altered electron flow in continuous cultures of Clostridium acetobutylicum induced by viologen dyes. Appl. Environ. Microbiol. 53,

117 Ravcheev, D.A., Li, X., Latif, H., Zengler, K., Leyn, S.A., Korostelev, Y.D., Kazakov, A.E., Novichkov, P.S., Osterman, A.L., Rodionov, D.A., Transcriptional regulation of central carbon and energy metabolism in bacteria by redox-responsive repressor Rex. J. Bacteriol. 194, Shen, C.R., Lan, E.I., Dekishima, Y., Baez, A., Cho, K. M., Liao, J. C., Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl. Environ. Microbiol. 77, Si, T., Luo, Y., Xiao, H., Zhao, H., Utilizing an endogenous pathway for 1-butanol production in Saccharomyces cerevisiae. Metab. Eng. 451, Stephanopoulos, G., Challenges in engineering microbes for biofuels production. Science, 315, Stombaugh, N.A., Sundquist, J.E., Burris, R.H., Orme-Johnson, W.H., Oxidationreduction properties of several low potential iron-sulfur proteins and of methylviologen. Biochem. 15, Vasconcelos, I., Girbal, L., Soucaille, P., Regulation of carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph on mixtures of glucose and glycerol. J. Bacteriol. 176, Vemuri, G.N., Altman, E., Sangurdekar, D.P., Khodursky, A.B., Eiteman, M.A., Overflow metabolism in Escherichia coli during steady-state growth: transcriptional regulation and effect of the redox ratio. Appl. Environ. Microbiol. 72, Wang, S., Zhu, Y., Zhang, Y., Li, Y., Controlling the oxidoreduction potential of the culture of Clostridium acetobutylicum leads to an earlier initiation of solventogenesis, thus increasing solvent productivity. Appl. Microbiol. Biotechnol. 93, Wang, Q., Venkataramanan, K. P., Huang, H., Papoutsakis, E. T., Wu, C. H., Transcription factors and genetic circuits orchestrating the complex, multilayered response of Clostridium acetobutylicum to butanol and butyrate stress. BMC Syst. Biol. 7, 120. Wietzke, M., Bahl, H., The redox-sensing protein Rex, a transcriptional regulator of solventogenesis in Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 96(3), Xue, C., Zhao, J., Lu, C., Yang, S.T., Bai, F., Tang, I., High titer n butanol production by Clostridium acetobutylicum JB200 in fed batch fermentation with intermittent gas stripping. Biotechnol. Bioeng. 109,

118 Yerushalmi, L., Volesky, B., Szczesny, T., Effect of increased hydrogen partial pressure on the acetone-butanol fermentation by Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 22, Yu, M., Zhang, Y., Tang, I., Yang, S.T., Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab. Eng. 13, Zhang, Y., Ma, Y., Yang, F., Zhang, C., Continuous acetone-butanol-ethanol production by corn stalk immobilized cells. J. Ind. Microbiol. Biotechnol. 36,

119 Table 4.1 Standard oxidation-reduction potentials of redox couples associated with cell metabolism. Redox couples E 0 (MV) Reference O2/H2O +816 Karp, 2008 H + /H2-421 Karp, 2008 NAD + /NADH -320 Karp, 2008 NADP + /NADPH -324 Karp, 2008 Methyl viologen -446 Michaelis and Hill, 1933 Benzyl viologen -359 Michaelis and Hill, 1933 Cystine/Cysteine -340 Karp, 2008 Fd/FdH2 C. pasteurianum -420 Bianco and Haladjian, 1984 C. thermocellum -430 Bianco and Haladjian, 1984 C. tartarivoram -424 Stombaugh et al., 1976 C. acidi-urici -434 Stombaugh et al.,

120 Table 4.2 Comparison of product titers, yields and productivities under different fermentation conditions. Substrate Glucose Xylose MV/BV (µm) Cysteine (g/l) Ethanol (g/l) Yield (g/g) Productivity (g/l h) Butanol Yield (g/g) Productivity (g/l h) Acetic Acid Yield (g/g) Productivity (g/l h) Butyric Acid Yield (g/g) Productivity (g/l h) : No addition

121 Redox probe Glucose H 2 O e - e - O 2 2NADH + 2ATP Pyruvate H + Fd ox H 2 Redox sensing protein DNA e - NAD NADH NADH NAD + Fd re NADH Acetyl-CoA 2NADH NADH Butyryl-CoA Ethanol NADH NAD Butanol e - e- NADH NAD e - Oxidoreductases e - Chemicals with different reduction degrees Figure 4.1 Redox balance achieved between extracellular redox potential and intercellular metabolism via various approaches. 104

122 Figure 4.2 Metabolic pathway in Clostridium tyrobutyricum. The pathways for butanol and ethanol formation shown in dotted lines are absent in wild-type C. tyrobutyricum and are introduced by overexpressing adhe2 gene. Key enzymes and genes in the pathway: hydrogenase (hyda); pyruvate: ferredoxin oxidoreductase (pfor); ferredoxin NAD + oxidoreductase (fnor); acetate kinase (ack); phosphotransacetylase (pta); thiolase (thl); beta-hydroxybutyryl-coa dehydrogenase (hbd); crotonase (crt); butyryl-coa dehydrogenase (bcd); electron transferring flavoprotein (etf); phosphotransbutyrylase (ptb); butyrate kinase (buk); CoA transferase (ctf); alcohol dehydrogenase (adh); butanol dehydrogenase (bdh); aldehyde-alcohol dehydrogenase (adhe2) (From: Yu et al., 2011). 105

123 ph controller Redox meter Base N 2 Figure 4.3 Experimental set-up for free cell fermentation by Ct ack-adhe2 with ORP detection and gas measurement. 106

124 Gas (L) Gas (L) ORP (mv) OD600 Glucose (g/l) Products (g/l) A Glucose Acetic Acid Butyric acid Butanol Ethanol Time (h) B ORP (mv) OD Time (h) C Total gas H2 CO Time (h) Figure 4.4 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using glucose as the substrate. 107

125 Gas (L) Gas (L) ORP (mv) OD600 Glucose (g/l) Products (g/l) A 80 Glucose Acetic Acid Butyric acid Butanol Ethanol Time (h) B ORP (mv) OD Time (h) C Total gas H2 CO Time (h) Figure 4.5 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using glucose as the substrate supplemented with 500 µm MV. 108

126 Gas (L) Gas (L) ORP (mv) OD600 Xylose (g/l) Products (g/l) A Xylose Butanol Acetic Acid Ethanol Butyric acid Time (h) B ORP (mv) OD Time (h) C Total gas H2 CO Time (h) Figure 4.6 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using xylose as the substrate. 109

127 Gas (L) Gas (L) ORP (mv) OD600 Xylose (g/l) Products (g/l) A Butanol Acetic Acid Ethanol Butyric acid Xylose B C ORP (mv) OD600 Time (h) Total gas H2 CO2 Time (h) Time (h) Figure 4.7 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using xylose as the substrate supplemented with 0.5 g/l cysteine and 10 µm BV. 110

128 ORP (mv) OD600 Xylose (g/l) Products (g/l) A Butanol Ethanol Xylose Acetic Acid Butyric acid Time (h) B ORP (mv) OD Time (h) Figure 4.8 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using xylose as the substrate supplemented with 10 µm BV. 111

129 ORP (mv) OD600 Xylose (g/l) Products (g/l) A Butanol Ethanol Xylose Acetic Acid Butyric acid Time (h) 0 B ORP (mv) OD Time (h) 0 Figure 4.9 Fermentation kinetics of free cell fermentation of CtΔack containing plasmid pmtl82151-adhe2 grown in CSL medium using xylose as the substrate supplemented with 1.5 g/l cysteine and 10 µm BV. 112

130 Figure 4.10 Comparison of product distribution, yields and productivities under different fermentation conditions. 113

131 Chapter 5 : Metabolic and process engineering of Clostridium tyrobutyricum for isopropanol production Abstract Isopropanol is one of the most widely used solvents in the world. It is also one of the secondary alcohols that can be used as a direct or partial replacement for gasoline. Since the metabolic pathways and regulations of natural isopropanol producing strains are not well known, the final isopropanol titer cannot satisfy rapidly increasing industrial demands. In this work, the feasibility of engineering Clostridium tyrobutyricum to produce isopropanol was studied. Plasmids (pmtl82151-caa and pmtl82151-pcaa) constructed with isopropanol synthetic pathway genes (C. acetobutylicum acetoacetyl-coa transferase (ctfab), acetoacetate decarboxylase (adc) and C. beijerinckii secondary alcohol dehydrogenase (adh)) were transformed into various C. tyrobutyricum strains. The abilities of isopropanol production of obtained mutants were compared. The C. tyrobutyricum phosphate butyryltransferase (ptb) knockout strain harboring pmtl82151-pcaa had the highest isopropanol titer of 1.79 g/l. The effects of artificial electron carriers (methyl viologen (MV)) on isopropanol production were also tested. By adding MV to provide extra driving force, C. tyrobutyricum acetate kinase (ack) knockout strain with pmtl82151-pcaa was able to produce 4.28 g/l isopropanol in batch fermentation. 114

132 5.1 Introduction Biofuels have gained increasing attention during the past decade, because of the continuous increase in fossil fuel prices and concerns about their sustainable development. Bioethanol produced by metabolically engineered E. coli or yeast is the first one to meet the industrial requirements and has been utilizing as a supplement in current gasoline manufacture. However, ethanol suffers from certain shortcomings like low octane rating, corrosiveness and potentially low net energy gains (Stephanopoulos, 2007).This makes it an unsuitable candidate to replace petroleum as a major energy source in future (Mainguet and Liao, 2010; Yu et al., 2011). On the other hand, Isopropanol (C3H8O), a secondary alcohol, has been shown to have a high octane number and can also be used as an additive to gasoline (Peralta-Yahya and Keasling, 2010). Isopropanol is also superior to methanol in esterifying fats and oils, because its branched chain can reduce the crystallization temperature of biodiesel (Lee et al., 1995). Meanwhile, isopropanol is a non-toxic solvent for non-polar compounds, like paints. It is widely used in household cleaning products for electronic devices and screens. In addition, isopropanol can be dehydrated to propylene, which is one of the most important starting chemicals in industry, currently being produced by traditional petrochemical process (Inokuma et al., 2010). Therefore, isopropanol obtained from renewable biomass is promising in meeting the increasing market demands for clean energy and green chemicals. It has been reported that some Clostridium strains are native isopropanol producers with the highest titer of about 2 g/l (George et al., 1983; Chen and Hiu, 1986). In order to commercialize isopropanol, various studies have been performed to obtain a strain that has 115

133 high isopropanol titer, yield and productivity. First, continuous fermentation of C. isopropylicum was conducted in a down-flow column reactor coupled with pervaporation, leading to 4.6 g/l isopropanol and 8.3 g/l butanol production (Matsumura et al., 1992). Survase et al. utilized two-stage continuous culture containing wood pulp as the holding material and produced 2.95 g/l isopropanol with a maximum solvent productivity of 0.8 g L h (Survase et al., 2011). Meanwhile, C. acetobutylicum ATCC 824, a previous ABE producer, was transformed with a dehydroegenase (adh) from C. beijerinckii NRRL B593, and was shown to convert more than 95% acetone to isopropanol (Collas et al., 2012). With further overexpression of an acetoacetate decarboxylase (adc) and a CoA transferase (ctfab) along with adh, the same transformant was capable of generating 24.4 g/l total IBE, including 8.8 g/l isopropanol (Collas et al., 2012). In a similar study, adc promoter driven ctfab, adc and adh were transformed into a butyrate kinase (buk) gene knocked out Clostridium acetobutylicum strain. These pathway modifications led to 20.4 g/l total IBE, including 5.1 g/l isopropanol production (Lee et al., 2012). Moreover, Dusseaux et al. replaced the previous solventogenic promoter with constitutive thiolase (thl) promoter, resulting in about 4.75 g/l isopropanol, but higher total solvent yield and productivity (Dusseaux et al., 2013). In addition, it was demonstrated that Clostridium acetobutylicum transformed with C. beijerinckii sadh and hydg was able to produce 27.9 g/l IBE in batch scale fermentation and its alcohol yield was further improved to 0.37 g/g in 200 L pilotscale fermentation (Jang et al., 2013). In spite of the high yield, isopropanol production in these clostridium strains faces several challenges. Firstly, solventogenic clostridium strains are required to undergo a metabolic 116

134 shift from acidogenesis to solventogenesis (Lee et al., 2008). This shift is associated with many aspects of cell metabolism, including gene expression and sporulation (Schaffer et al., 2002; Lee et al., 2008), and its correlation with solvent production is not well studied (Papoutsakis, 2008). Secondly, the capacity for genetic engineering of these strains is relatively narrow, compared to model systems like E. coli and yeast (Connor and Liao, 2009). Thirdly, isopropanol produced in Clostridia is always associated with other solvent production, like ethanol, butanol, which makes its isolation more difficult in the following recovery process (Grousseau et al., 2013). In the past few years, the isopropanol pathway has been introduced to many other organisms to test their feasibility to produce isopropanol. Hanai et al. first demonstrated that with overexpression of C. acetobutylicum thl, E. coli atoad and C. beijerinckii adh genes, E. coli was able to produce 4.9 g/l isopropanol, which exceeded the maximum titer of native producers (Hanai et al., 2007). At the same time, Jojima et al. claimed their success in fed batch fermentation of genetically engineered E. coli strain JM109, which could produce up to g/l isopropanol (Jojima et al., 2007). Furthermore, since the accumulation of isopropanol inhibited its own production, in situ gas stripping was performed in the fed batch fermentation of engineered E. coli strain TA76, which resulted in a total 143 g/l isopropanol (Inokuma et al., 2010). Recently, the same pathway was expressed in yeast Candida utilis (Tamakawa et al., 2013). Here, the initial isopropanol titer of 1.2 g/l with ph control was boosted to 9.5 g/l in free cell, and 27.2 g/l in fedbatch fermentation, by overexpressing acetyl-coa synthetase gene (Tamakawa et al., 2013). Moreover, Grousseau et al. performed codon optimization of the Clostridium adc 117

135 and adh genes and expressed them in Cupriavidus necator strain Re2133. They achieved 3.44 g/l isopropanol titer with only 0.82 g/l biomass formation, using fructose as sole carbon source (Grousseau et al., 2014). In this study, we wanted to test the possibility of engineering Clostridium tyrobutyricum to be an isopropanol producer. C. tyrobutyricum is an acidogenic Clostridium strain, which produces butyric acid, acetic acid, carbon dioxide and hydrogen as its main fermentation products, by consuming glucose or xylose (Wu and Yang, 2003). C. tyrobutyricum has partial isopropanol pathway from pyruvate to acetoacety-coa. Previously, C. tyrobutyricum mutants with disrupted acetate pathways were constructed by single gene knockouts of acetate kinase (ack), phosphotransacetylase (pta) or phosphotransbutyrylase (ptb). (Liu et al., 2006; Zhu et al., 2005; Zhang et al., 2011). The deletion mutants of ack or pta resulted in a higher butyrate:acetate ratio and butyrate tolerance (Liu et al., 2006, Zhu et al., 2005). This was beneficial for isopropanol production, because more carbon would be directed to acetoacetyl-coa instead of acetate (See Fig. 5.1). Meanwhile, the knockout of ptb gene in C. tyrobutyricum led to a higher specific growth rate with no decrease in butyrate titer (Zhang et al., 2011), indicating it might be a good host for efficient isopropanol production. As C. tyrobutyricum is not a native solvent producing strain, the heterogeneous expression of isopropanol pathway would not be related to cell sporulation and autolysis, which is commonly observed in solventogenic Clostridia (Ezeji et al., 2009). It was illustrated that by overexpressing aldehyde/alcohol dehydrogenase 2 gene from C. acetobutylicum, C. tyrobutyricum ack strain was able to produce up to 16.0 g/l butanol, with a yield of 30.6% (Yu et al., 2011). Moreover, the mutant displayed a good butanol 118

136 tolerance and achieved more than 60% relative growth rate when 1.5% butanol was present (Yu et al., 2011). Therefore, in this study, plasmids constructed with C. acetobutylicum ctfab (acetoacetyl-coa transferase), adc (acetoacetate decarboxylase) and C. beijerinckii adh (secondary alcohol dehydrogenase) genes were transformed into C. tyrobutyricum wild type and its mutants, and their capacities in isopropanol production were examined. In order to decrease the cost, isopropanol fermentation was conducted in both corn steep liquor medium and traditional CGM medium. Corn steep liquor (CSL) was a byproduct from the wet-milling industry and contained a large extent of amino acids and polypeptides (Liggett and Koffler, 1948). It was cheap in the US market (about $55/t), and therefore, was widely used as an alternative to expensive nitrogenous sources like yeast extract and peptone (Liggett and Koffler., 1948) in ethanol production by yeast (Kadma and Newman, 1997) and E. coli (Lawford and Rousseau, 1996). Parekh et al. tested the ABE fermentation performance of C. beijerinckii BA101 in optimized 6% glucose/csl medium, resulting in 17.8 g/l butanol and 23.6 total solvent in a 200 L bioreactor (Parekh et al., 1998). It was also argued that CSL medium might be an economical substitute to P2 and CGM medium in industrial fermentation (Qureshi, et al., 2004; Choi et al., 2012). Thus, CSL medium was applied in this study to economically produce isopropanol. Previous studies showed that electron distribution and NADH/NAD + ratio play important roles in Clostridium acidogenesis to solventogenesis switch and solvent production (Bahl et al., 1986; Helga et al., 1992; Vasconcelos et al., 1994). It was proposed that the electron flow resulting from the oxidization of pyruvate to acetyl-coa by pyruvate ferredoxin oxdioredutase was directed to reduce ferredoxin (See in Fig. 5.1). It was also shown that 119

137 in order to regenerate oxidized ferredoxin, there were two pathways associated: one was molecular hydrogen production catalyzed by hydorgenase, and the other was reduced pyridine nucleotides formation by ferredoxin-nad(p) + reductase. Since NAD(P)H was a strong inhibitor to its own generation (Peguin et al., 1994b), in the acidogenetic phase, the electrons from the oxidization of pyruvate were mainly transferred to hydrogenase to produce hydrogen. However, in the solventogenic phase, the production of solvents consumed NAD(P)H rapidly. Therefore, the electrons were drawn to ferredoxin-nad(p) + reductase to form NAD(P)H and hydrogen production was reduced (Peguin et al., 1994b). Since solvent formation required equivalent NAD(P)H, considerable efforts had been made to decrease the activity of hydorgenase in vivo, and therefore, to redirect the electron flow toward NAD(P)H generation. This goal was achieved in several ways. One was increasing the hydrogen partial pressure, which led to direct product inhibition of the hydrogenase (Doremus et al., 1985; Yerushalmi and Volesky, 1985). Another way was sparging the medium with carbon monoxide, a reversible inhibitor of hydrogenase (Kim et al., 1984; Meyer et al., 1986). Moreover, iron limitation and artificial electron carrier addition were also confirmed to be efficient in lowering hydrogenase activity and promoting alcohol production (Junelles et al., 1988; Peguin et al., 1994a; 1994b; Peguin and Soucaille, 1995; Rao and Mutharasan, 1987). Methyl viologen (MV), an artificial electron carrier was the most studied, and seemed to be the most significant reducing agent on redirecting electron flow to NAD(P)H formation (Rao et al., 1987). The standard redox potential of MV for the first reduction state was close to that of ferredoxin (Peguin and Soucaille, 1995). Results of independent study in Peguin s group also demonstrated that MV can increase the activity 120

138 of ferredoxin-nad(p) reductase 60-fold, by creating an artificial electron transport chain linked between pyruvate-ferredoxin oxidoreductase, methyl viologen, ferredoxin-nad(p) reductase and NAD(P) + (Peguin et al., 1994b). By both reducing the hydrogenase activity and increasing the ferredoxin-nad(p) reductase, the production of hydrogen was competitively inhibited by MV and alcohol titers were boosted in the presence of increased NAD(P)H concentration (Peguin et al., 1994b; Peguin and Soucaille, 1995; Durre et al., 1995; Rao and Mutharasan, 1987). Similar results were observed in the fermentation of C. tyrobutyricum ack containing adhe2, whereas the butanol titer was boosted by ~48% with MV (Du, 2013). This data implied that the MV introduced redirection of electron flow also applied in C. tyrobutyricum. Therefore, the effects of MV on isopropanol production were studied in this case to enhance final isopropanol titer. 5.2 Materials and methods Bacterial strain and media C. tyrobutyricum wild type (C. tyrobutyricum ATCC 25755) and mutant strains CtΔack, CtΔpta, CtΔptb generated by knocking out ack, pta, ptb respectively were used as the parent strains in this study. All the strains mentioned in this chapter are listed in Table 5.1. The serum bottle fermentation studies were carried out at 37 C in the Clostridium Growth Medium (CGM) containing 40 g/l glucose, 2 g/l (NH4)2SO4, 1 g/l K2HPO4, 1 g/l KH2PO4, 0.1 g/l MgSO4 7H2O, 2 g/l yeast extract, 4 g/l trypticase peptone, g/l FeSO4 7H2O, g/l CaCl2 2H2O, 0.01 g/l MnSO4 H2O, 0.02 g/l CoCl2 6H2O, g/l ZnSO4 7H2O. The minerals were made in a 50-fold solution and filtered through

139 m membrane to sterilize. In batch fermentation using CSL, medium containing 30 g/l corn steep liquor (Cargill, Eddyville, IA), 3 g/l (NH4)2SO4, 1.5 g/l K2HPO4, 0.6 g/l MgSO4 7H2O and 0.03 g/l FeSO4 7H2O were utilized. The stock cultures of all the strains were conserved anaerobically at -80 C in Reinforced Clostridial Medium (RCM; Difco, Detroit, MI) containing 15% glycerol Plasmids construction Plasmids utilized in this paper are listed in Table 5.1. In order to overexpress ctfab, adc and adh genes in C. tyrobutyricum, two plasmids were constructed: pmtl82151-caa and pmtl82151-pcaa. The ctfab and adc genes, along with their respective promoters, were amplified from the shuttle vector psos95 and inserted into plasmid pmtl82151 (Heap et al., 2009) by SacII and XmaI double restriction digestion, followed by ligation to generate plasmid pmtl82151-ca. The primers used: forward primer: TACCCCGCGGTAG- CCAAAGCTCTGCAGGTCGACTTTTTAACAAAA and reverse primer: AAGCCCC- GGGGTTACCATTTAAGGTAACTCTTATTTTTATTACTTAAG. Gene adh without its own promoter was amplified from the genomic DNA of its native strain Clostridium beijerinckii NRRL B593 using forward primer: CTGGCCCGGGAGGAGGAA- CATATTTTATGAAAGGTTTTGCAATGCTAGG and reverse primer: GATTCT- AGACATGATCTATTATGTTATAATATAACTACTGCTTTAATTAAGTC. The PCR product was then purified and inserted into plasmid pmtl82151-ca using restriction enzyme sites XmaI and XbaI to obtain final plasmid pmtl82151-caa (Fig. 5.2). The pmtl82151-pcaa was constructed by replacing the original thl promoter of ctfab from C. acetobutylicum ATCC 824 with C. tyrobutyricum ATCC native thiolase promoter. 122

140 The pmtl8215-thl-adhe2 (Yu et al., 2011) was digested by restriction enzymes BamHI and SacII. The 5.4 kb fragment (pmtl82151-pthl) was isolated through gel purification. The ctfab, adc and adh genes were amplified from plasmid pmtl82151-caa (without promoters) with specially designed forward primer ATTTAAATTTGGATCCA- GAATTTAAAAGGAGGGATTAAAAT and reverse primer GAAACAGCTATGA- CCGCGGCATGATCTATTATGTTATAATATA, according to the Infusion cloning system protocol (Clontech). The PCR product was purified and inserted into pmtl pthl fragment mentioned above, via homologous recombination to generate pmtl pcaa (Fig. 5.2). All the recombinant plasmids were transformed into E. coli stellar competent cells by Heat shock (42 C, 1 min) for amplification (Clontech). Then, the plasmids were extracted and confirmed by PCR, enzyme digestion, and DNA sequencing Plasmid transformation and confirmation In this study, conjugation (Heap et al., 2009; Yu et al., 2011) was performed to transform the newly constructed plasmids into C. tyrobutyricum strains. The plasmids pmtl caa and pmtl82151-pcaa were first transformed into donor strain E. coli CA434 competent cells through heat shock. Single colonies were picked and colony PCR and restriction enzyme digestion were conducted to confirm the correct transformants. The pmtl82151-caa or pmtl82151-pcaa transformed E. coli CA434 strains were cultured in 15 ml LB medium with 30 µg/ml chloramphenicol overnight at 37 C, 250 rpm until the OD600 reached about 1.5. Then, the culture was divided into five portions. Cells were harvested from each of the 3ml portions by centrifuging at 8,000 g for 3 mins and washed twice with 0.5 ml sterile phosphate-buffered saline (PBS) to remove trace antibiotics. The 123

141 donor cell pellets were moved into an anaerobic chamber and re-suspended in 75, 150, 200, 250, 300 μl of mid lag phase recipient cells separately. The recipients were C. tyrobutyricum wild type, Δack, Δpta or Δptb mutant strains cultured overnight anaerobically in reinforced clostridial medium (RCM) at 37 C until the OD600 reached about 2.5. The mixture of each combination ratio of donor and recipient cells was pipetted onto a plain RCM plate drop-by-drop and incubated at 37 C anaerobically for h. Then, the cells on each plate were washed off with 1 ml RCM using inoculation loop. All five re-suspended cell solutions were combined and inoculated into 10 ml fresh RCM, supplemented with 30 µg/ml thiamphenicol and 250 µg/ml D-cycloserine for selection. The solution was cultured at 37 C under anaerobic conditions for 3-5 days until an increase in OD and generation of gas was observed. Then 150 μl cell culture was plated onto a RCM plate with 30 µg/ml thiamphenicol, and incubated until the appearance of single colonies. Confirmation of the transformation was performed by re-extracting the plasmid from C. tyrobutyricum mutants. Single colonies were picked and inoculated into purged and sterilized (121 C, 15 psig, 30 min) tubes containing 7 ml RCM supplemented with 30 µg/ml thiamphenicol for 24 h. Then, the cells were centrifuged down and re-suspended in 250 μl Buffer P1 (Qiagen, Mineprep kit) with 10 mg/ml lysozyme. The solution was incubated at 37 C for 2 h, followed by the steps in the commercial protocol (Qiagen, Mineprep kit). The obtained plasmids were measured by nanodrop (Thermo scientific) and transformed into E. coli DH5. Chloramphenicol was used as the selection marker. The single colonies were picked after 24 h for colony PCR confirmation of the inserted DNA fragments. Restriction enzyme digestion and DNA sequencing were also performed to 124

142 verify the plasmids extracted from the mutants Fermentation in serum bottles Studies of the fermentation kinetics of the mutants obtained (C. tyrobutylicum wild type, Δack, Δpta or Δptb transformed with pmtl82151-caa or pmtl82151-pcaa) were first performed in serum bottles. Each serum bottle was filled with 50 ml CGM medium and purged for 15 min to exclude trace oxygen before it was sealed and sterilized. 1.0 ml from an over-night culture of active mutants was inoculated into the bottle containing 30 µg/ml thiamphenicol. The serum bottles were kept in 37 C incubator. The ph was adjusted to about 6.5, once a day with 4 N NaOH solution. Samples were taken periodically to study the fermentation kinetics and stored in -20 C for further analysis Free cell fermentation in bioreactor Free cell fermentation was executed to further examine mutant fermentation performance in bench scale bioreactor. Sugar (glucose or xylose) and the rest CGM or CSL medium components were purged and sterilized separately, and combined afterwards to make 400 ml medium containing g/l sugar with ph adjusted to 6.5. The seed culture was fostered in 20 ml RCM medium, 37 C, overnight. The fermentation was carried out anaerobically in a spinner flask at 37 C with 350 rpm. ph was controlled at 6.0 by 20% (V/V) NH4OH. Samples were taken periodically for analysis of cell growth, sugar and product concentrations. 125

143 5.2.6 Enzyme activity assay The enzyme activities of acetone dehydrogenase and butyraldehyde dehydrogenase of adh were assayed following the method described by Durre et al. with modifications (Durre et al., 1993). Cells were collected from 50 ml medium when the OD600 reached about 0.6. The broth was transferred into centrifuge tubes in anaerobic chamber and sealed tightly. The cells were centrifuged at 10, 000 g for 10 min, and washed once with Tris-HCl buffer (0.1, ph 7.5). The cell pellet was re-suspended in 1.5 ml of the same Tris buffer and mixed with about 0.5 ml glass beads (0.1 mm) anaerobically. The mixture was vortexed for 10 circles in a Mini beadbeater (Biospec), with 30 seconds of vortexing and 30 seconds on ice for cooling down. Supernatant was obtained by centrifugation at 13, 200 g for 20 min and used for enzyme activity assay. 50 mm Tris HCl (ph 7.8) containing 10 mm acetone, 2 mm DTT and 200 µm NADH was used to measure acetone dehydrogenase activity. Butyraldehyde dehydrogenase activity assay was performed in 11 mm butyraldehyde, 230 µm NADH, 77 mm Tris-HC1, ph 7.8. The enzyme activity was measured by monitoring the consumption rate of NADH at 365 nm and calculated with a molar NADH extinction coefficient of 3.4 cm -1 mm -1. One unit of enzyme activity was defined as the amount of enzyme required for consuming 1 mm NADH per min in the reaction system. Total protein concentrations were determined by Bio-Rad protein assay kit. 0.1, 0.2, 0.3, 0.4, 0.5 mg/l bovine serum albumin was used to make the standard carve Analytical methods Cell growth was calculated based on the optical density measured by a spectrophotometer 126

144 (UV-16-1, Shimadzu, Columbia, MD) under OD600. Samples were diluted accordingly until OD600 reached a level between 0.2 and 0.8, to ensure accuracy. The sugar concentration was determined by using high liquid chromatography (HPLC, LC-20AD, Shimadzu, Columbia, MD) assembled with a Rezex ROA-Organic Acid H+ column (Phenomenex, Torrance, CA) and a refractive index detector (RID) N H2SO4 was used as the mobile phase. Samples were centrifuged at 13,200 g for 10 min and diluted 10 times with distilled water before HPLC analysis. 15 µl of sample was injected by an auto injector (SIL-10Ai) and analyzed for 40 minutes with column temperature set at 45 C. All the fermentation products were measured by gas chromatography. A Zebron ZB-FFAP capillary GC column (30 m, 0.25 mm internal diameter and 0.25 μm film thickness, Phenomenex, Torrance, CA) equipped with an auto sampler (AOC-20i, Shimadzu, Columbia, MD) and a flame ionization detector (FID) was used to measure the concentrations of fermentation products, including isopropanol, ethanol, butyric acid, acetone and acetic acid. 1 L of acidified sample was injected at 250 C. The temperature of the column was programmed at 60 C for 3 minutes, and increased by 30 C per minute until it reached 150 C, then held at 150 C for 4 minutes. The detector temperature was set at 250 C. Isobutanol and isobutylic acid were used as the internal standards for concentration calculation. 5.3 Results and discussion Plasmid construction and transformation confirmation In order to engineer C. tyrobutyricum to produce isopropanol, four heterological genes 127

145 ctfab, adc and adh genes were overexpressed. The overall plasmid construction strategy is shown in Figure 5.2. The ctfab and adc genes from Clostridium acetobutylicum ATCC 824 were first amplified and cloned into plasmid pmtl82151 by SacII and XmaI double restriction digestion followed by ligation (Fig. 5.3A and 5.3B). Colony PCR and enzyme digestion of the plasmid obtained from E. Coli DH5 confirmed the successful cloning of the targeted gene fragment at the right cloning position. Figure 5.3A lane 2 demonstrates the original size of adh gene from Clostridium beijerinckii NRRL B593. The insertion of adh into plasmid pmtl82151-ca was verified by colony PCR and digestion (Fig. 5.3C). The plasmid pmtl82151-caa was further confirmed by DNA sequencing. Figure 5.3D shows the colony PCR results of the E. coli transformed with the plasmids extracted from C. tyrobutyricum mutant. pmtl82151-caa was also proved to be stable and reproducible in C. tyrobutyricum Isopropanol production by wild-type and Ct ack with pmtl82121-caa C. tyrobutyricum is an acidogenic strain without any detectable solvent production property. In order to engineer it to be an isopropanol producer, acetoacetyl-coenzyme A transferase (CtfAB), acetoacetate decarboxylase (ADC) and alcohol dehydrogenase (ADH) genes were introduced into its regulatory pathways. After transforming plasmid pmtl82151-caa into C. tyrobutyricum wild-type and ack knockout strain, single colonies were picked and their fermentation performance was tested in serum bottles (Fig. 5.4). About 0.57 g/l and 0.72 g/l isopropanol were produced from C. tyrobutyricum wild type and ack strain containing pmtl82151-caa within 200 h, indicating successful transformations and expression of the four heterogeneous genes. As can be seen in the 128

146 figure, butyric acid was still the main end-point product, with g/l from CtWT-caa mutants and g/l from Ct ack-caa. These titers were much more than their parent strains, which typically produce 8-9 g/l butyric acid in serum bottle fermentation. Compared to the CtWT-caa, Ct ack containing pmtl82151-caa produced slightly more acetic acid. It was consistent with the previous study (Liu et al., 2006), in which no significant decrease of acetic acid was observed when ack gene was knocked out. Moreover, the amount of acetic acid formed in both mutants was much lower than their parental strains (typically about 2 g/l in wild-type while 3 g/l in Ct ack), leading to a higher butyric acid/acetic acid (B/A) ratio: 35.7 in CtWT-caa and 26.8 in Ct ack-caa. In addition, there was a trace amount of acetone detected at the end of Ct ack-caa mutant fermentation, while no acetone is produced by CtWT-caa. The specific growth rate and titers of all the products are listed and compared in Table 5.2. Based on the results, there was a redirection of carbon flow from acetate to isopropanol and butyrate. No significant difference in cell growth rates and sugar consumption rates in these two types of mutants were noted. It seemed that upon overexpression of the four genes, butyric acid was a preferred product over isopropanol. This was most likely due to the overexpression of the CoA transferase. CtfAB was capable of catalyzing Ping-Pong Bi Bi reactions and controlling the butyric acid/butyryl-coa and acetic acid/acetyl-coa conversion based on the overall cell growth status and redox balance (Wiesenborn et al., 1989). Its effects on alteration and redistribution of carbon flux will be further discussed below. Since the promoter of the four genes utilized here was from thiolase in C. acetobutylicum 824, it is possible that the low isopropanol titers were caused by the incompatibility of the promoter 129

147 with C. tyrobutyricum gene regulation system Effects of C. tyrobutyricum thiolase promoter on isopropanol production Thiolase catalyzes the conversion of acetyl-coa to acetoacetly-coa and is discovered in both acidogenic and solventogenic Clostridium strains. Thiolase promoter has been broadly used in metabolic engineering of Clostridia (Jang et al., 2013; Yu et al., 2011; Tomas et al., 2003) as it is constitutively expressed throughout bacterial lifetime (Hartmanis and Gatenbeck, 1984). In this study, the previous thiolase promoter from C. acetobutylicum was replaced by the thiolase promoter from C. tyrobutyricum. Serum bottle fermentation of the wild-type and Ct ack with new plasmid pmtl82151-pcaa was conducted (Fig. 5.5). Apparently, with the change of the promoter, the CtWT-pcaa and Ct ack-pcaa had improved performance by producing 0.77 g/l and 1.60 g/l isopropanol, which was 1.35 and 2.22 fold of the previous mutants with C. acetobutylicum thiolase promoter accordingly. These results indicated that the thiolase promoter from C. tyrobutyricum was stronger than the one from C. acetobutylicum in the C. tyrobutyricum expression system. To further confirm this result, an enzyme activity assay was carried out. The liner equations of butyraldehyde-linked ADH activity in cell crude extract of C. tyrobutyricum ack, Ct ack pmtl82151-caa and Ct ack pmtl82151-pcaa are shown in Figure 5.6A. It was clear that the butyraldehyde-linked ADH activity in Ct ack-pcaa (0.066 U/mg) was higher than that in Ct ack-caa (0.021 U/mg), confirming that thiolase promoter from C. tyrobutyricum was stronger. Meanwhile, in accordance with previous study, there was no acetone-linked ADH activity detected when only NADH was present, indicating that NADPH was the sole equivalent associated with this activity (Ismaiel et al., 130

148 1993). On the other hand, high levels of butyric acid (14.42 g/l in CtWT-pcaa and g/l Ct ack-pcaa) and low concentrations of acetic acid (0.53 g/l in CtWT-pcaa and 0.63 g/l Ct ack-pcaa) were again detected. Interestingly, trace amounts of acetone could be detected in both types of mutants. These observations supported Jojima et al. s claim that the reaction from acetone to isopropanol might be the rate-limiting step in isopropanol production (Jojima et al., 2007). Moreover, there was generation of g/l and g/l ethanol respectively. Ethanol production was reported in previous studies in E. coli, when the adh gene from Clostridium beijerikii NRRL B593 was overexpressed (Hanai et al., 2007). Since this specific ADH was a primary-secondary alcohol dehydrogenase, it could catalyze various ketones and aldehydes to corresponding alcohols based on substrate ratio and availabilities of coenzyme NAD(H) and NADP(H) (Ismaiel et al., 1993). As the formation of ethanol required a NADH, while a NADPH was needed to generate isopropanol, the result implied a shortage of NADPH in the transformed mutants. The specific growth rates and product titers are summarized in Table Effects of pta, ptb gene knockout on isopropanol production Previous studies in Yang s group demonstrated that deletion of pta, ptb genes in C. tyrobutyricum lead to a remarkable decrease in enzymatic activities of phosphortransacetylase and phosphortransbutylase (Zhu et al., 2004; Zhang et al., 2011) As a result, carbon flux redistribution and B/A ratio alteration were perceived. In this study, the pmtl82151-pcaa was conjugated into these two mutants and their potential in isopropanol production is presented in Figure 5.5 and Table 5.2. There was 0.4 g/l isopropanol produced from the Ct pta-pcaa mutant, which was the lowest among all the mutants with 131

149 pmtl82151-pcaa. Meanwhile, the Ct pta-pcaa mutant had even higher acetate formation (about 1 g/l) than the wild-type mutant, which was consistent with the Liu et al. s conclusion about the redundancy of the acetate pathway in C. tyrobutyricum (Liu et al., 2006). In contrast to Ct ack-pcaa, there was no acetone or ethanol formation detected from Ct pta-pcaa. It was interesting to note that PTA was followed by ACK in the same pathway (Fig. 5.1). However, the knockout of these two genes separately led to diverse fermentation profiles in ethanol, acetone, isopropanol and acetate production. When the Ct ptb strain was powered with the four genes, the highest isopropanol titer 1.79 g/l was obtained. A high level of acetate (about 1.34 g/l) and a low level of butyrate (about 8.29 g/l) were also observed. Although in the original study, there was no direct decrease of butyric acid inspected when ptb was knocked out, it seemed that the introduction of the isopropanol pathway altered the carbon flux towards the generation of acetic acid and isopropanol, at the expense of butyric acid (Zhang et al., 2011) Effects of corn steep liquor and xylose on isopropanol production Corn steep liquor (CSL) has been used in fermentation by various strains, as it is inexpensive and rich in nitrogenous sources, amino acids and trace elements. (Liu et al., 2014; Choi et al., 2012; Wang et al., 2013; Qureshi et al., 2004). It is reported that as low as 6% of CSL in medium was comparable to CGM containing yeast extract and asparagine (Choi et al., 2012). Therefore, in order to further boost isopropanol titer and lower the cost, CSL was used to replace yeast extract and tryptone in CGM medium. The results of the free cell fermentation of Ct ack with pmtl82151-pcaa in both CGM and CSL medium are shown in Figure 5.7. When CGM medium was used, the titer of isopropanol, acetate, 132

150 butyrate and ethanol was 2.07 g/l, 4.05 g/l, g/l and 0.92 g/l with the final OD600 reached These data suggested that most of the extra glucose taken by the cells in the bioreactor was utilized in the accumulation of cell mass. It also seemed that isopropanol production was not favored, compared to butyrate and acetate, in batch fermentation, since only 0.4 g/l increase was observed in comparison to serum bottle fermentation. Interestingly, about 2.80 g/l butanol and 1.57 g/l ethanol were produced when CSL medium was used, and there was no isopropanol production. Also, the glucose consumption rate, cell growth rate and acetate, butyrate titers were much lower than they were in CGM medium fermentation (Table 3). This outcome was not in accordance with the previous studies about CSL s excellent capacities in promoting cell growth and products generation (Choi, et al., 2012; Liu et al., 2014). It was well established that the acetoacetyl-coa transferase plays an important role in the overall carbon allocation (Lehmann et al., 2012a; 2012b; Sillers et al., 2008). As shown in the metabolic pathways (Fig. 5.1), CoA transferase not only catalyzes the conversion of acetoacetyl-coa to acetoacetate as expected in isopropanol production, but also regulates the distribution of carbon flux towards acetate and butyrate by transferring CoA inbetween. The characterization of purified CoA transferase revealed its Ping Pong Bi Bi kinetic binding mechanism (Wiesenborn et al., 1989). The Km values of this CoA transferase for acetate and butyrate were 1200 and 660 mm, respectively, which were much higher than other reported CoA transferase (Wiesenborn et al., 1989). It is worth mentioning that the enzyme activity of CtfAB seemed to be distinctly affected by various metabolites, cofactors and inorganic salts (Wiesenborn et al., 1989). Combined with the 133

151 data we obtained, it was clear that the CtfAB overexpression in C. tyrobutyricum favored transferring CoA from butyryl-coa to acetate, as compared to transferring CoA from acetoacetyl-coa to acetate. This led to the high B/A ratio, but low isopropanol production. This was probably because the generation of butyric acid and acetic acid came along with ATP production. It is well known that ATP, as a universal energy carrier, participates in various aspects of cell metabolism and thus, is critical to cell growth and development. Therefore, the cells preferred to produce more acids and ATP, rather than the secondary product isopropanol, when both pathways were available. In addition, the ADH from C. beijerinckii NRRL B593 was a primary-secondary alcohol dehydrogenase (Ismaiel et al., 1993; Chen, 1995). It exhibited both NAD(P)H dependent acetone-linked ADH activity and NADPH or NADH dependent secondary ADH activity (Ismaiel et al., 1993). The kcat/km values of purified ADH in catalyzing acetaldehyde, butyraldehyde and acetone are 1900, 240 and 8500, indicating a substrate preference order of acetone > acetaldehyde > butyraldehyde (Ismaiel et al., 1993). It was consistent with our observation of relatively high titer of isopropanol production and low or nonexistent ethanol, butanol formation. However, the ADH enzyme activity was influenced by the concentrations of substrates and the availability of coenzyme NAD(H) and NADP(H) within cells (Ismaiel et al., 1993). Thus, the generation of ethanol from the CtWT, Ct ack and Ct ptb containing pmtl82151-pcaa might be due to the abundant existence of acetyl- CoA and butyryl-coa inside the cell. Meanwhile, the conversion of acetone to isopropanol requires an NADPH, whereas the formation of ethanol needs 2 NADHs or NADPHs. This suggested that the accumulation of ethanol might also result from the absence of NADPH 134

152 in isopropanol generation. Previous studies in our lab showed that overexpression of C. acetobutylicum 824 adhe2 gene enabled Ct ack strain to produce approximately 8 g/l butanol in CGM medium. It had similar performance in CSL medium. However, the Ct ack-pcaa in this study demonstrated different fermentation kinetics in CGM and CSL. The appearance of butanol in Ct ack pmtl82151-pcaa fermentation with CSL might be a consequence of combined effects of complex components in CSL and the diverse enzymatic activities of CoA transferase. On the other hand, corn steep liquor was a byproduct from the commercial starch manufacturing process. It was clarified earlier that certain organic acids like ferulic acid, ᵖ-Coumaric acid, formed in cellulose and lignocellulose pretreatments are inhibitors of cell growth and solvent production for various types of strains including C. beijerinckii (Ezeji et al., 2007; Varga et al., 2004; Klinke et al., 2002; Zaldivar and Ingram, 1999). The HPLC analysis of the CSL in our lab unveiled the possible existence of these organic acids. Since CSL was not toxic to Ct ack containing only adhe2, it is highly possible that certain chemicals in the CSL medium may have inhibitory effects towards the activity of CtfAB or ADC. On the other hand, the CtfAB from C. acetobutylicum 824 has relatively high affinity towards carboxylic acids comparing to other CoA transferase (Wiesenborn et al., 1989) and it exhibits significant enzymatic activity with crotonate (Wiesenborn et al., 1989). Since ferulic acid and ᵖ-coumaric acid share the same crotonyl side chain, it is possible that CtfAB could also bind to the same functional group of these two acids. Earlier studies of Clostridium acetobutylicum ATCC 824 mutants deficient in acetone pathway illustrate that 135

153 CoA transferase is the only pathway enzyme whose activity is significantly reduced when 2-bromobutyrate, an analog to butyrate is used (Junelles et al., 1987, Clark et al., 1989). Therefore, ferulic acid, ᵖ-coumaric acid or other alcohol or acid analogs in CSL might cause CtfAB to lose its enzymatic activity towards acetoacetate formation by competing with and inhibiting the active sites of the enzyme (Clark et al., 1989; Durre et al., 1986; Junelles et al., 1987). The ADH from C. berjerinckii is capable of catalyzing various substrates, including acetaldehyde and butyraldehyde to alcohols (Wiesenborn et al., 1989). The shutdown of the acetone pathway by those toxic chemicals might result in the accumulation of acetyl-coa and butyryl-coa, and therefore, promote ADH to generate ethanol and butanol. Similar results were obtained from Sillers s research, in which overexpression of an aldehyde-alcohol dehydrogenase coupled with downregulation of CoA transferase enabled C. acetobutylicum to generate less acetone, but more ethanol and butanol (Sillers et al., 2008). These alterations might cause imbalance in certain aspects of cell metabolism, like redox status, since NADH and NADPH are tightly related to solvent generation. As a result, cell growth and glucose consumption were badly affected. It was interesting to note that the fermentation results of C. acetobutylicum PJC4BK in 3% and 6% CSL containing media were better than CGM, implying the activity of CoA transferase was not affected (Choi et al., 2013) This could be due to the potential native inhibitor conversion pathways within the cells (Liu and Blaschek, 2010). Larsson et al. proposed that phenylacrylic acid decarboxylase (Pad1p) and other enzymes might be involved in a self-detoxification process by converting aromatic carboxylic acids, including ferulic acid, to vinly derivatives in yeast (Larsson et al., 2001). Since the inhibitory effects on CoA transferase are highly 136

154 harmful to cell growth and regulation, C. acetobutylicum might have obtained similar defense mechanisms during evolution; for example, removing the carboxyl groups on those toxic organic acids. However, CoA transferase in our C. tyrobutyricum mutants was heterogeneous. Therefore, CSL appeared to be more toxic to C. tyrobutyricum than to C. acetobutylicum, as C. tyrobutyricum might not have similar evolutionary defense systems. It is also possible that the CSL used in Choi s study had less toxic components than the one used in this study, since the indigents of CSL are directly determined by the source of corns as well as different treatment processes. Overall, to further enhance isopropanol titer, more information is needed to better understand the role of CoA transferase on solvent production and cell regulation. Figure 5.8 shows the fermentation kinetics of Ct ack-pcaa, using xylose as the substrate in spinner flask. Generally, the mutant displayed higher titers and yields with xylose than glucose. In total, there were 3.35 g/l isopropanol, g/l butyrate, 3.30 g/l acetate, 1.08 g/l ethanol produced within 95 hours. More isopropanol (1.29 g/l), butyric acid (7.80 g/l), and less acetic acid (0.75 g/l) were generated in xylose fermentation compared to glucose fermentation. The mutant consumed about 5 g/l less sugar, which resulting in higher product yields. Although there was a longer lag phase (about 20 h), the xylose fermentation achieved a higher cell density comparing to glucose. However, in Liu et al. s original study, the Ct ack had a better performance in almost all the fermentation parameters, including specific growth rate, product titers and yields when glucose was used (Liu et al., 2006). Thus, the introduction of the isopropanol pathway might counteract certain inhibitory effects caused by ack deletion on xylose metabolism in Ct ack. The 137

155 enhanced isopropanol titer might be attributed to the more reduced status of xylose, which is favored in solvent production (Vasconcelos and Soucaille, 1994; Nakayama et al., 2008; Yu et al., 2011). In addition, there were trace amounts of butanol (0.07 g/l) and acetone (0.19 g/l) generated in the xylose fermentation, which were not seen in glucose fermentation. These results suggested that redox potential of the substrates may have a remarkable influence on carbon and energy distribution in Ct ack. In conclusion, in order to boost the production of isopropanol, the redox balance of the mutants needed to be further studied. The fermentation results of the mutant Ct ack-pcaa using glucose and xylose are compared in Table Effects of artificial electron carrier on isopropanol production The effects of methyl viologen (MV) on isopropanol production of Ct ack-pcaa were first tested in serum bottles. Figure 5.9 presents the results of glucose fermentation with 0, 10, 25, 75, 150 µm MV. According to the data, it was obvious that MV had diverse impacts on different products. For alcohol generation with MV, concentration increased from 0 to 150 µm, the final titers of isopropanol and ethanol were continuously enhanced from 1.03 g/l to 2.78 g/l and 0.13 g/l to 2.07 g/l, representing a 2.7-fold and a fold increase, respectively. This was consistent with previous observations of the impellent power of MV on solvent production (Peguin et al., 1994b; Durre et al., 1995; Du, 2013). For acetic and butyric acid, production dropped significantly. Acetic acid titer decreased from 0.72 g/l to 0.24 g/l. Butyric acid titer was reduced from g/l to only 0.27 g/l. This was probably due to the extra NADH resulted from MV addition, which pushed the generation of ethanol and isopropanol; therefore, the carbon flowed towards acids formation deceased. 138

156 Meanwhile, it seemed that acetone titer initially increased with increasing MV concentration from 0 to 25 µm, but then decreased with a further increase in MV from 25 to 150 µm. These phenomena might be caused by the complicated regulation of redox balance and redistribution of carbon and energy upon MV addition. Also, MV showed cytotoxicity towards cell growth. The lag phase was extended with increased MV concentration, and the cell density was gradually decreased. This might also be resultant of the absence of ATP supplement, since ATP generation should also have been decreased along with acid production inhibition. When 250 µm MV was applied, cells did not grow in three days (data not shown). Moreover, the glucose consumption rate was reduced while MV increased, which led to the highest isopropanol yield of more than g/g when 150 µm was used. The titers of all the products under different concentration of MV are listed in Table 5.4. The free cell fermentation of Ct ack containing pmtl82151-pcaa supplemented with 150 M MV was conducted in a spinner flask (Fig. 5.10). There was 4.28 g/l isopropanol produced in the batch fermentation, with a yield of 0.1 g/g and productivity of g/l h. Meanwhile, there were 5.13 g/l butyrate, 0.43 g/l acetic acid and 0.33 g/l acetone obtained. In contrast to batch fermentation without MV, a significant drop of acid production and an increase of alcohol titers were observed. However, the extra glucose consumed in the batch fermentation led to more butyrate than alcohols, as compared to serum bottle fermentation. There might be two reasons. First, the conversion of acetoacetyl-coa to acetate was not as efficient as acetoacetyl-coa to butyryl-coa. This might be caused by the catalytic characteristics of the CoA transferase under that specific 139

157 metabolic environment, which was affected by various factors, including substrate and product concentrations, ph (Wiesenborn et al., 1989). Second, it is possible that there was not enough NADPH to assist ADH to turn acetone to isopropanol, as the acetone linked ADH activity was NADPH, but not NADH, dependent (Ismaiel et al., 1993). Since there was an accumulation of acetone in the medium, limited NADPH availability might be the main factor hindering carbon flow towards the isopropanol production. Meanwhile, it was noted that even though there was an increased level of NADH in the medium, there was no butanol generation in this batch. Combined with the observation in the xylose fermentation, it was clear that NADH concentration and redox status were not the only factors that contributed to the butanol formation. 5.4 Conclusions This study presents the first report on isopropanol production by C. tyrobutyricum. In this study, Ct ack was enabled to produce up to 4.28 g/l isopropanol through metabolic and process engineering. There were two plasmids constructed, pmtl82151-caa and pmtl82151-pcaa, containing ctfab and adc gene from C. acetobutylicum 824 and adh gene from C. beijerinckii NRRL 893 under thiolase promoter from 824 and C. tyrobutyricum. The transformation of these two plasmids into C. tyrobutyricum wild-type, ack, pta and ptb was performed. All the mutants obtained were able to produce isopropanol. However, the mutants containing pmtl82151-pcaa with C. tyrobutyricum thiolase promoter exhibited better fermentation results, indicating this promoter was stronger in gene expression in C. tyrobutyricum compared to the thiolase promoter from C. acetobutylicum. Among all the mutants, the Ct ptb-pcaa had the highest isopropanol titer 140

158 of 1.79 g/l and the wild-type, ack, pta mutants produced 0.77 g/l, 1.60 g/l and 0.38 g/l respectively. In the batch fermentation, xylose was proved to be a better substrate for isopropanol production than glucose. There was 3.35 g/l isopropanol produced with a yield of g/g in the xylose fermentation, comparing to 2.07 g/l and g/g when glucose was used. However, because there was a longer lag phase for cells to utilize xylose, productivity was decreased. In addition, the potential of corn steep liquor for being a cheap nitrogenous source was examined. It was clear that certain compounds within the corn steep liquor were harmful to isopropanol production. A possible mechanism was also given to explain the abnormal appearance of butanol in CSL fermentation. In addition, the effects of methyl viologen on isopropanol production were determined. When 150 µm MV was applied, isopropanol titer was boosted to 2.78 g/l in serum bottle fermentation and 4.28 g/l in bioreactor. Reference Bahl, H., Gottwald, M., Kuhn, A., Rale, V., Andersch, W., Gottschalk, G., Nutritional factors affecting the ratio of solvents produced by Clostridium acetobutylicum. Appl Environ. Microbiol. 52, Chemier, J.A., Fowler, Z.L., Koffas, M.A., Leonard, E., Trends in microbial synthesis of natural products and biofuels. Adv. in Enzymol. Relat. Areas of Mol Biol. 76, 151. Chen, J.S., Alcohol dehydrogenase: multiplicity and relatedness in the solventproducing clostridia. FEMS Microbiol. Rev. 17, Clark, S.W., Bennett, G.N., Rudolph, F.B., Isolation and characterization of mutants of Clostridium acetobutylicum ATCC 824 deficient in acetoacetyl-coenzyme A: acetate/butyrate: coenzyme A-transferase (EC ) and in other solvent pathway enzymes. Appl. Environ. Microbiol. 55,

159 Collas, F., Kuit, W., Clément, B., Marchal, R., López-Contreras, A.M., Monot, F., Simultaneous production of isopropanol, butanol, ethanol and 2, 3-butanediol by Clostridium acetobutylicum ATCC 824 engineered strains. AMB Express, 2, Connor, M.R., Liao, J.C., Microbial production of advanced transportation fuels in non-natural hosts. Curr. Opin. Biotechnol. 20, Desai, R.P., Papoutsakis, E.T., Antisense RNA strategies for metabolic engineering of Clostridium acetobutylicum. Appl. Environ. Microbiol. 65, Doremus, M.G., Linden, J.C., Moreira, A.R., Agitation and pressure effects on acetone butanol fermentation. Biotechnol. Bioeng. 27, Du, Y., High-yield and high-titer n-butanol producttion from lignocellulosic feedstocks by metabolically engineered Clostridium tyrobutyricum. PhD dissertation, Ohio State University, Columbus, OH, USA. Dürre, P., Kuhn, A., Gottschalk, G., Treatment with allyl alcohol selects specifically for mutants of Clostridium acetobutylicum defective in butanol synthesis. FEMS Microbiol. Lett. 36(1), Dürre, P., Kuhn, A., Gottwald, M., Gottschalk, G., Enzymatic investigations on butanol dehydrogenase and butyraldehyde dehydrogenase in extracts of Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 26, Dürre, P., Fischer, R. J., Kuhn, A., Lorenz, K., Schreiber, W., Stürzenhofecker, B., Ullmann, S., Winzer, K., Sauer, U., Solventogenic enzymes of Clostridium acetobutylicum: catalytic properties, genetic organization, and transcriptional regulation. FEMS Microbiol. Rev. 17, Dürre, P., New insights and novel developments in clostridial acetone/butanol/isopropanol fermentation. Appl. Microbiol. Biotechnol. 49, Ezeji, T.C., Qureshi, N., Blaschek, H.P., Butanol production from agricultural residues: impact of degradation products on Clostridium beijerinckii growth and butanol fermentation. Biotechnol. Bioeng. 97, Ezeji, T.C., Milne, C., Price, N.D., Blaschek, H.P., Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl. Microbiol. Biotechnol. 85, George, H.A., Johnson, J.L., Moore, W.E.C., Holdeman, L.V., Chen, J.S., Acetone, isopropanol, and butanol production by Clostridium beijerinckii (syn. Clostridium butylicum) and Clostridium aurantibutyricum. Appl. Environ. Microbiol. 45,

160 Grousseau, E., Lu, J., Gorret, N., Guillouet, S.E., Sinskey, A.J., Isopropanol production with engineered Cupriavidus necator as bioproduction platform. Appl. Microbiol. Biotechnol. 98, Grupe, H., Gottschalk, G., Physiological events in Clostridium acetobutylicum during the shift from acidogenesis to solventogenesis in continuous culture and presentation of a model for shift induction. Appl. Environ. Microbiol. 58, Hanai, T., Atsumi, S., Liao, J.C., Engineered synthetic pathway for isopropanol production in Escherichia coli. Appl. Environ. Microbiol. 73, Hartmanis, M. G., Gatenbeck, S., Intermediary metabolism in Clostridium acetobutylicum: levels of enzymes involved in the formation of acetate and butyrate. Appl. Environ. Microbiol. 47, Heap, J.T., Kuehne, S.A., Ehsaan, M., Cartman, S.T., Cooksley, C.M., Scott, J.C., Minton, N.P., The ClosTron: Mutagenesis in Clostridium refined and streamlined. J. Microbiol. Meth. 80, Heap, J.T., Pennington, O.J., Cartman, S.T., Minton, N.P., A modular system for Clostridium shuttle plasmids. J. Microbiol. Meth. 78, Inokuma, K., Liao, J.C., Okamoto, M., Hanai, T., Improvement of isopropanol production by metabolically engineered Escherichia coli using gas stripping. J. Biosci. Bioeng. 110, Ismaiel, A.A., Zhu, C.X., Colby, G.D., Chen, J.S., Purification and characterization of a primary-secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii. J. Bacteriol. 175, Jang, Y.S., Malaviya, A., Lee, J., Im, J., Lee, S.Y., Lee, J., Eom, M.H., Cho,J.H., Seung, D.Y., Metabolic engineering of Clostridium acetobutylicum for the enhanced production of isopropanol butanol ethanol fuel mixture. Biotechnol. Progr. 29, Jojima, T., Inui, M., Yukawa, H., Production of isopropanol by metabolically engineered Escherichia coli. Appl. Microbiol. Biotechnol. 77, Junelles, A.M., Janati-Idrissi, R., El Kanouni, A., Petitdemange, H., Gay, R., Acetone-butanol fermentation by mutants selected for resistance to acetate and butyrate halogen analogues. Biotechnol. Lett. 9, Junelles, A.M., Janati-Idrissi, R., Petitdemange, H., Gay, R., Iron effect on acetonebutanol fermentation. Curr. Microbiol. 17,

161 Kadam, K.L., Newman, M.M., Development of a low-cost fermentation medium for ethanol production from biomass. Appl. Microbiol. Biotechnol. 47, Kim, B.H., Bellows, P., Datta, R., Zeikus, J.G., Control of carbon and electron flow in Clostridium acetobutylicum fermentations: utilization of carbon monoxide to inhibit hydrogen production and to enhance butanol yields. Appl. Environ. Microbiol. 48, Klinke, H.B., Ahring, B.K., Schmidt, A.S., Thomsen, A.B., Characterization of degradation products from alkaline wet oxidation of wheat straw. Bioresour. Technol. 82, Kusakabe, T., Tatsuke, T., Tsuruno, K., Hirokawa, Y., Atsumi, S., Liao, J.C., Hanai, T., Engineering a synthetic pathway in cyanobacteria for isopropanol production directly from carbon dioxide and light. Metab. Eng. 20, Lawford, H.G., Rousseau, J.D., Studies on nutrient requirements and cost-effective supplements for ethanol production by recombinant E. coli. Appl. Biochem. Biotechnol. 57, Lee, I., Johnson, L. A., Hammond, E. G., Use of branched-chain esters to reduce the crystallization temperature of biodiesel. J. the Am. Oil Chem. Soc. 72, Lee, J., Jang, Y.S., Choi, S.J., Im, J.A., Song, H., Cho, J.H. Papoutsakis, T., Bennett, G., Lee. S.Y., Metabolic engineering of Clostridium acetobutylicum ATCC 824 for isopropanol-butanol-ethanol fermentation. Appl. Environ. Microbiol. 78, Lee, S.K., Chou, H., Ham, T.S., Lee, T.S., Keasling, J.D., Metabolic engineering of microorganisms for biofuels production: from bugs to synthetic biology to fuels. Curr. Opin. Biotechnol. 19, Lee, S.Y., Park, J.H., Jang, S.H., Nielsen, L.K., Kim, J., Jung, K.S., Fermentative butanol production by Clostridia. Biotechnol. Bioengineering, 101, Lehmann, D., Hönicke, D., Ehrenreich, A., Schmidt, M., Weuster-Botz, D., Bahl, H., Lütke-Eversloh, T., Modifying the product pattern of Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 94, Lehmann, D., Radomski, N., Lütke-Eversloh, T., New insights into the butyric acid metabolism of Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 96, Liggett, R. W., Koffler, H., Corn steep liquor in Microbiol. Bacteriol. Rev. 12,

162 Liu, X., Zhu, Y., Yang, S.T., Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol. Progr. 22, Liu, Z.L., Blaschek, H. P., Biomass conversion inhibitors and in situ detoxification. Biomass to biofuels: strategies for global industries Liu, K., Atiyeh, H.K., Stevenson, B.S., Tanner, R.S., Wilkins, M.R., Huhnke, R.L., Continuous syngas fermentation for the production of ethanol, n-propanol and n- butanol. Bioresour. Technol. 151, Mainguet, S.E., Liao, J.C., Bioengineering of microorganisms for C3 to C5 alcohols production. Biotechnol. J. 5, Matsumura, M., Takehara, S., Kataoka, H., Continuous butanol/isopropanol fermentation in down flow column reactor coupled with pervaporation using supported liquid membrane. Biotechnol. Bioeng. 39, Meyer, C.L., Roos, J.W., Papoutsakis, E.T., Carbon monoxide gasing leads to alcohol production and butyrate uptake without acetone formation in continuous cultures of Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 24, Nakayama, S.I., Kosaka, T., Hirakawa, H., Matsuura, K., Yoshino, S., Furukawa, K., Metabolic engineering for solvent productivity by downregulation of the hydrogenase gene cluster hupcba in Clostridium saccharoperbutylacetonicum strain N1-4. Appl. Microbiol. Biotechnol. 78, Papoutsakis, E.T., Engineering solventogenic clostridia. Curr. Opin. Biotechnol. 19, Parekh, M., Formanek, J., Blaschek, H.P., Pilot-scale production of butanol by Clostridium beijerinckii BA101 using a low-cost fermentation medium based on corn steep water. Appl. Microbiol. Biotechnol. 51, Peguin, S., Delorme, P., Goma, G., Soucaille, P., 1994a. Enhanced alcohol yields in batch cultures of Clostridium acetobutylicum using a three-electrode potentiometric system with methyl viologen as electron carrier. Biotechnol. Lett. 16, Peguin, S., Goma, G., Delorme, P., Soucaille, P., 1994b. Metabolic flexibility of Clostridium acetobutylicum in response to methyl viologen addition. Appl. Microbiol. Biotechnol. 42, Peguin, S., Soucaille, P., Modulation of carbon and electron flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl. Environ. Microbiol. 61,

163 Peralta Yahya, P.P., Keasling, J.D., Advanced biofuel production in microbes. Biotechnol. J. 5, Qureshi, N., Blaschek, H. P Butanol recovery from model solution/fermentation broth by pervaporation: evaluation of membrane performance. Biomass Bioenerg. 17, Qureshi, N., Karcher, P., Cotta, M., Blaschek, H.P., High-productivity continuous biofilm reactor for butanol production. In Proceedings of the Twenty-Fifth Symposium on Biotechnology for Fuels and Chemicals Held May 4-7, 2003, in Breckenridge, CO (pp ). Rao, G., Mutharasan, R., Alcohol production by Clostridium acetobutylicum induced by methyl viologen. Biotechnol. Lett. 8, Rao, G., Mutharasan, R., Altered electron flow in continuous cultures of Clostridium acetobutylicum induced by viologen dyes. Appl. Environ. Microbiol. 53, Rao, G., Ward, P.J., Mutharasan, R., Manipulation of End Product Distribution in Strict Anaerobes. Ann. N. Y. Acad. Sci. 506, Schaffer, S., Isci, N., Zickner, B., Dürre, P., Changes in protein synthesis and identification of proteins specifically induced during solventogenesis in Clostridium acetobutylicum. Electrophoresis, 23, Sillers, R., Al Hinai, M.A., Papoutsakis, E.T., Aldehyde-alcohol dehydrogenase and/or thiolase overexpression coupled with CoA transferase downregulation lead to higher alcohol titers and selectivity in Clostridium acetobutylicum fermentations. Biotechnol. Bioeng. 102, Stephanopoulos, G., Challenges in engineering microbes for biofuels production. Science. 315, Survase, S.A., Jurgens, G., Van Heiningen, A., Granström, T., Continuous production of isopropanol and butanol using Clostridium beijerinckii DSM Appl. Microbiol. Biotechnol. 91, Tamakawa, H., Mita, T., Yokoyama, A., Ikushima, S., Yoshida, S., Metabolic engineering of Candida utilis for isopropanol production. Appl. Microbiol. Biotechnol. 97, Thorneley, R.N., A convenient electrochemical preparation of reduced methyl viologen and a kinetic study of the reaction with oxygen using an anaerobic stoppedflow apparatus. BBA-Bioenergetics. 333,

164 Varga, E., Klinke, H.B., Réczey, K., Thomsen, A.B., High solid simultaneous saccharification and fermentation of wet oxidized corn stover to ethanol. Biotechnol. Bioeng. 88, Vasconcelos, I., Girbal, L., Soucaille, P., 1994.Regulation of carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph on mixtures of glucose and glycerol. J. Bacteriol. 176, Wang, Y., Li, K., Huang, F., Wang, J., Zhao, J., Zhao, X., Zhou, S., Engineering and adaptive evolution of Escherichia coli W for l-lactic acid fermentation from molasses and corn steep liquor without additional nutrients. Bioresour. Technol. 148, Wiesenborn, D.P., Rudolph, F.B., Papoutsakis, E.T., Coenzyme A transferase from Clostridium acetobutylicum ATCC 824 and its role in the uptake of acids. Appl. Environ. Microbiol. 55, Williams, D.R., Young, D.I., Young, M., Conjugative plasmid transfer from Escherichia coli to Clostridium acetobutylicum. J. Gene. Microbiol. 136, Wu, Z., Yang, S.T Extractive fermentation for butyric acid production from glucose by Clostridium tyrobutyricum. Biotechnol. Bioeng. 82, Yerushalmi, L., Volesky, B., Importance of agitation in acetone butanol fermentation. Biotechnol. Bioeng. 27, Zaldivar, J., Ingram, L.O., Effect of organic acids on the growth and fermentation of ethanologenic Escherichia coli LY01. Biotech. Bioeng. 66, Zhang, Y., Yu, M., Yang, S.T., Effects of ptb knockout on butyric acid fermentation by Clostridium tyrobutyricum. Biotechnol. Progr. 28, Zhou, X., Lu, X.H., Li, X.H., Xin, Z.J., Xie, J.R., Zhao, M.R., Wang, L., Du, W.Y., Liang, J.P., Radiation induces acid tolerance of Clostridium tyrobutyricum and enhances bioproduction of butyric acid through a metabolic switch. Biotechnol. Biofuels. 7, Zhu, Y., Liu, X., Yang, S.T., Construction and characterization of pta gene deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotechnol. Bioeng. 90,

165 Table 5.1 Strains and plasmids used in this study. Strain/Plasmid Characteristics Reference/source Strains C. tyrobutyricum ATCC ATCC C. beijerinckii NRRL B593 NRRL Ct ack ack knockout Liu et al., 2006 Ct pta pta knockout Zhu et al., 2005 Ct ptb ptb knockout Zhang et al., 2011 E. coli CA434 E. coli HB101 with plasmid R702 Williams et al., 1990 CtWT-caa ATCC with pmtl82151-caa This study Ct ack-caa Ct ack with pmtl82151-caa This study CtWT-pcaa ATCC with pmtl82151-pcaa This study Ct ack -pcaa Ct ack with pmtl82151-pcaa This study Ct pta -pcaa Ct pta with pmtl82151-pcaa This study Ct ptb -pcaa Ct ptb with pmtl82151-pcaa This study Plasmids pmtl82151 ColE1 ori; Cm r ; pbp1 ori; TarJ Heap et al., 2009 psos95 ColE1 ori, Ap r ; pim13 ori, MLS r ; C. aceto thl promoter, ctfab, adc bla pmtl82151-ca pmtl82151-caa pmtl82151-pcaa pmtl82151; C. aceto thl promoter, ctfab, adc pmtl82151; C. aceto thl promoter, ctfab, adc, adh pmtl82151; C. tyrobutyricum thl promoter, ctfab, adc, adh Soucaille and Papoutsakis, 2002 This study This study This study 148

166 Table 5.2 Comparison of cell specific growth rate and final product titers from various C. tyrobutyricum mutants in serum bottle fermentation using glucose. Strain Specific growth rate (h -1 ) Isopropanol (g/l) Butyrate (g/l) Acetate (g/l) Ethanol (g/l) Ct Wild-type 0.131± ± ± CtWT-caa 0.072± ± ± ± Ct ack-caa 0.056± ± ± ± CtWT-pcaa 0.047± ± ± ± ±0.02 Ct ack-pcaa 0.087± ± ± ± ±0.02 Ct pta-pcaa 0.030± ± ± ± Ct ptb-pcaa 0.070± ± ± ± ±

167 Table 5.3 Comparison of cell specific growth rate and product titers of Ct ack(pcaa) in batch fermentation using different media. Specific growth rate (h -1 ) CGM with glucose CGM with xylose CSL with glucose 0.161± ± ±0.005 Isopropanol (g/l) 2.07± ± Butyrate (g/l) 17.87± ± ±0.75 Acetate (g/l) 4.05± ± ±0.15 Ethanol (g/l) 0.92± ± ±0.48 Butanol (g/l) ± ±0.34 Acetone (g/l) 0.09± ±

168 Table 5.4 Effect of methyl viologen concentration on fermentation kinetics of CtΔack (pcaa) mutant in CGM medium with glucose as a substrate. MV concentration (µm) Specific growth rate (h -1 ) Isopropanol (g/l) Butyrate (g/l) ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±0.02 Acetate (g/l) 0.72± ± ± ± ±0.02 Ethanol (g/l) 0.13± ± ± ± ±

169 Figure 5.1 Metabolic pathways in Clostridium tyrobutyricum. The enzymes marked in red were overexpressed in this study. The dotted lines show the introduced isopropanol pathway. Key enzymes and genes: hydrogenase (hyda); pyruvate: ferredoxin oxidoreductase (pfor); ferredoxin NAD + oxidoreductase (fnor); phosphotransacetylase (pta); acetate kinase (ack); thiolase (thl); phosphotransbutyrylase (ptb); butyrate kinase (buk); CoA transferase (ctfab); alcohol decarboxylase (adc); alcohol dehydrogenase (adh). 152

170 Figure 5.2 Construction of plasmids pmtl82151-caa and pmtl82151-pcaa. The ctfabadc fragment was amplified from plasmid psos95 and inserted into pmtl Then the adh gene was obtained from the genome of C. beijerinckii B593 without its promoter and connected to ctfab-adc to generate pmtl82151-caa. The adhe2 on pmtl adhe2 was replaced by ctfab-adc-adh fragment to form pmtl82151-pcaa. 153

171 A B kb 2.4kb 1.1kb 5.3kb 2.4kb 6.7kb C 1 2 D kb 1.1kb Figure 5.3 Agarose gel pictures of plasmid confirmation. (A) Size of ctfab-adc (~ 2.4 kb), adh (~1.1 kb) and pmtl82151 (~5.3 kb); (B) Plasmid pmtl82151-ca confirmation by SacII and XmaI double enzyme digestion; (C) Plasmid pmtl82151-caa confirmation by XmaI and XbaI restriction enzyme digestion; (D) Colony PCR of E. coli DH5α transformed with the plasmid extracted from Ct ack-caa. 154

172 OD600, glucose, butyric acid (g/l) Rest products (g/l) OD600, glucose, butyric acid (g/l) Rest products (g/l) A Butyric acid OD600 Isopropanol Glucose Acetic Acid Time (h) B Butyric acid OD600 Isopropanol Glucose Acetic Acid Acetone Time (h) Figure 5. 4 Fermentation kinetics of CtWT-caa (A) and Ct ack-caa (B) in serum bottles. 155

173 OD600, glucose, butyric acid (g/l) Rest products (g/l) OD600, glucose, butyric acid (g/l) Rest products (g/l) A Butyric acid OD600 Isopropanol Ethanol Glucose Acetic Acid Acetone Time (h) B Butyric acid OD600 Isopropanol Ethanol Glucose Acetic Acid Acetone Time (h) Figure 5.5 Fermentation kinetics of CtWT-pcaa (A), Ct ack-pcaa (B), Ct pta-pcaa (C) and Ct ptb-pcaa (D) in serum bottles. (continued) 156

174 OD600, lucose, butyric acid (g/l) Rest products (g/l) OD600, Glucose, butyric acid (g/l) Rest products (g/l) Figure 5.5 Continued. C Butyric acid OD600 Isopropanol Glucose Acetic Acid Time (h) D Butyric acid OD600 Isopropanol Glucose Acetic Acid Ethanol Time (h) 157

175 Butyrylaldhyde activity (U/mg) A B C Ct ack-caa Butyrylaldehyde Ct ack-pcaa Figure 5.6 Comparison of ADH enzyme activity in Ct ack-caa and Ct ack-pcaa. (A) Liner regression models of NADH absorbance decrease via time upon Ct ack, Ct ack-caa and Ct ack-pcaa cell extract addition. (B) Standard curve for protein concentration calculation. (C) Comparison of butyrylaldehyde-linked NADH dependent ADH activity in Ct ack-caa and Ct ack-pcaa. 158

176 OD600, glucose, butyric acid (g/l) Rest products (g/l) OD600, glucose, butyric acid (g/l) Rest products (g/l) A Butyric acid Glucose OD600 Acetic Acid Isopropanol Acetone Ethanol Time (h) B Butyric acid OD600 Acetone Butanol Glucose Acetic Acid Ethanol Time (h) Figure 5.7 Free cell fermentation of Ct ack-pcaa using CGM (A) and CSL (B) medium in bioreactor with ph controlled at

177 OD600, xylose, butyric acid (g/l) Rest products (g/l) Butyric acid Xylose OD600 Acetic Acid Isopropanol Acetone Ethanol Butanol Time (h) 0 Figure 5.8 Free cell fermentation of Ct ack-pcaa using CGM medium with xylose in bioreactor with ph controlled at

178 OD600 Glucose (g/l) MV 0 MV 10 MV 25 MV 75 MV Time (h) MV 0 MV 10 MV 25 MV 75 MV Time (h) Figure 5.9 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-pcaa in serum bottles. (Continued) 161

179 Ethanol (g/l) Isopropanol (g/l) Figure 5.9 Continued MV 0 MV 10 MV 25 MV 75 MV Time (h) MV 0 MV 10 MV 25 MV 75 MV Time (h) Continued 162

180 Aceetic acid (g/l) Butyric acid (g/l) Figure 5.9 Continued MV 0 MV 10 MV 25 MV 75 MV Time (h) MV 0 MV 10 MV 25 MV 75 MV Time (h) Continued 163

181 Acetone (g/l) Figure 5.9 Continued MV 0 MV 10 MV 25 MV 75 MV Time (h) 164

182 OD600, glucose (g/l) Products (g/l) Glucose OD600 Acetic Acid Butyric acid Isopropanol Acetone Ethanol Time (h) Figure Free cell fermentation kinetics of CtΔack-pcaa in bioreactor with 150 µm MV. 165

183 Chapter 6 : Development of an in vivo fluorescence based gene expression reporter system for Clostridium tyrobutyricum Abstract Clostridium tyrobutyricum mutant strain CtΔack-adhE2 is able to produce butanol with high titer, yield and tolerance, indicating C. tyrobutyricum might be a good host for solvent production. However, the regulations of metabolic pathways in C. tyrobutyricum are not well studied due to the absence of complete genetic information and limited genetic engineering tools. In this study, a flavin mononucleotide (FMN) dependent fluorescent protein Bs2 based gene expression reporter system was developed to explore the in vivo strength and regulation for various promoters in C. tyrobutyricum. Unlike green fluorescent protein and its variants, Bs2 can emit green light without oxygen, which makes it extremely suitable for promoter screening and transformation confirmation in organisms grown anaerobically. The expression levels of Bs2 under thiolase promoters from C. aectobutylicum and C. tyrobutyricum were measured and compared based on fluorescent intensities. The capacities of the two promoters in driving gene transcription in C. tyrobutyricum were distinguished, confirming this reporter system is a convenient, effective and reliable tool for promoter strength assay. 166

184 6.1 Introduction Clostridium tyrobutyricum is an anaerobic bacterium that can consume glucose and xylose to produce acetic acid, butyric acid, carbon dioxide and hydrogen as main products. Unlike solventogenic Clostridium strains which generate acetone, ethanol and butanol via ABE fermentation, engineered C. tyrobutyricum with overexpressed alcohol dehydrogenase (adhe2) is able to produce a high titer of butanol as the only main solvent (Yu et al., 2011; Du, 2013). This result suggested C. tyrobutyricum might be a promising host for industrial production of butanol, as well as other biofuels. As solvent production requires proper enzyme activity and adequate reducing power, the regulatory methods and efficiency of each gene expressed in the pathway need to be profoundly understood. However, this information is largely missing in C. tyrobutyricum because only a few studies have been performed so far and the regulation of heterologous genes in this organism is not well known (Jiang, et al., 2013; Yu et al., 2011; 2012). Therefore, an efficient reporter system to demonstrate the strength of various gene expressions in C. tyrobutyricum would be extremely useful for engineering this strain to generate valuable products in future. The green fluorescent protein (GFP) and its variants are one of the best tools available for this purpose. GFP was first discovered in jelly fish Aequorea victoria (Matz et al., 2002). It is capable of emitting its characteristic green fluorescence when exposed to blue to ultraviolet light (Tsien, 1998). Various fluorescent proteins (FPs) with diverse spectra have been found since then, which could facilitate the monitoring of up to 4-5 substrates at the same time by labelling them with FPs with different emission colors (Chudakov et al., 2005). These FPs are broadly used in almost every aspect of protein related regulation 167

185 including promoter up and down regulation (Liu et al., 1998; Verkhusha et al., 2004), protein folding and localization (Zacharias et al., 2002; Fradkov et al., 2002), proteinprotein interaction (Galperin et al., 2004; He et al., 2005). They serve as imaging probes to demonstrate complex biological activities, from single cell to whole organism (Chudakov et al., 2005). These FPs, however, are not functional under anaerobic conditions as they strictly require molecular O2 as the cofactor to form corresponding chromophores (Tsien, 1998; Shaner et al., 2005). Hence, they cannot be applied to test the promoter activities in C. tyrobutyricum. Recently, Drepper et al reported a series of flavin mononucleotide (FMN)-based fluorescent proteins (FbFPs). Protein YtvA from B. subtilis and SB2 protein from P. putida are bacterial blue-light photoreceptors. Both of them have a light oxygen voltage (LOV) domain, which can non-covalently bind to FMN chromophores (Drepper et al., 2007). When activated by blue light (450 nm), these proteins undergo a photocycle which involves the generation of an FMN-cystine C(4a)-thiol adduct and emit a weak autofluorescence (Drepper et al., 2007). In their study, the conserved photoactive cysteine residues in these two proteins were replaced with non-polar alanines by site-directed mutagenesis. This modification resulted in a ten-fold increase in fluorescence intensity, when the mutated proteins were expressed in E. coli (Drepper et al., 2007). Later, when the codon optimized truncated YtvA gene (encoding only the LOV domain) was transformed into E. coli, the fluorescence intensity was further increased about 2.5-fold as compared to the previous mutants, but with no increase in protein abundance (Drepper et al., 2007). Since these fluorescent proteins are FMN dependent, they could exhibit strong signals under anaerobic 168

186 conditions or when O2 was absent (Drepper et al., 2007, 2010). Compared to YFP, the FbFP mediated florescence was confirmed to have a shorter lag phase in developing reporter signal (Drepper et al., 2010). Thus, FbFPs have been successfully used as a fluorescent label in anaerobic bacteria including Roseobacter clade (Piekarski et al., 2009), Bacteroides fragilis (Lobo et al., 2011), and yeast (Eichhof et al., 2009). In this study, the feasibility of utilizing codon optimized FbFP protein BS2 as a promoter strength reporter in C. tyrobutyricum was examined. Here, a sensitive gene expression reporter system was established to select probable promoters for future metabolic engineering in Clostridia. 6.2 Materials and methods Bacterial strain and media The bacterial strains and plasmids used in this study are listed in Table 6.1. C. tyrobutyricum wild type (C. tyrobutyricum ATCC 25755) served as the host in this study. All the constructed plasmids were first transformed into stellar competent cells (Clontech) for amplification. E. coli CA434 competent cells were utilized as the donor cells in conjugation. The E. coli strains were cultured in Lysogeny broth (LB) medium supplemented with 30 µg/ml chloramphenicol. The C. tyrobutyricum strains were frosted in the reinforced clostridial medium (RCM; Difco, Detroit, MI), anaerobically. 30 µg/ml thiamphenicol was added for mutant selection. The stock cultures of all the strains were conserved anaerobically at -80 C in corresponding medium containing 15% glycerol. 169

187 6.2.2 Plasmids construction The original plasmid containing codon optimized bs2 gene under C. tyrobutyricum thiolase promoter was ordered from Life Technologies (Thermo Fisher Scientific) (See Appendix S1 for detailed sequence information). E. coli plasmid pmk (kanr) was used as the backbone. Sac I and Kpn I were chosen as the cloning sites for the targeted DNA fragment (Fig. 6.1). The whole gene including promoter and bs2 was amplified using forward primer: GAAACAGCTATGACCGCGGCTGAATATTC and reverse primer: CTAGAGGAT- CCCCGGGTACCCTCGAGTTATTC and inserted into pmtl82151 using Sac II and Kpn I as the cloning sites, according to the Infusion cloning system protocol (Clontech). The obtained Ptyr-Bs2 plasmid was confirmed by clony PCR, double restriction enzyme digestion and DNA sequencing. Next, the thiolase promoter from Ptyr-Bs2 was cut out by Sac II and BamH I. Forward primer: GAAACAGCTATGACCGCGGTTATGCCGA- GAAAACTATTGGTTG and reverse primer: AAATATTTATGGATCCCAGATAA- ACCATTTCAATCTATTTCA were used to amplify the C. acetobutylicum thiolase promoter from psos95. The DNA fragment was inserted into promoter-less Ptyr-Bs2 by Infusion Plasmid transformation and confirmation In this study, conjugation (Heap et al., 2009, Yu et al., 2011) was performed to transform the newly constructed plasmids into C. tyrobutyricum wild type. The plasmids Ptyr-Bs2 and Pace-Bs2 were first transformed into donor strain E. coli CA434 competent cells by heat shock (42 C, 40 s). Single colonies were picked and colony PCR and restriction digestion were conducted to confirm the correct transformants. Ptyr-Bs2 and Pace-Bs2 170

188 transformed E. coli CA434 strains were cultured in 15 ml LB medium with 30 µg/ml chloramphenicol overnight at 37 C, 250 rpm until the OD600 reached about 1.5. Then the medium was divided into five portions. Cells were harvested from each 3 ml portion by centrifuging at 8,000 g for 3 min and washed twice with 0.5 ml sterile phosphate-buffered saline (PBS) to remove trace antibiotics. The donor cell pellets were moved into anaerobic chamber and re-suspended in 75, 150, 200, 250, 300 μl of mid-log phase recipient cells separately. The recipient was C. tyrobutyricum wild type cells cultured overnight anaerobically in RCM at 37 C until the OD600 reached about 2.5. The mixture of each combination ratio of donor and recipient cells was pipetted onto a plain RCM plate dropby-drop and incubated at 37 C anaerobically for h. The cells on each plate were then washed off with 1 ml RCM using inoculation loop. All five resuspended cell solutions were combined and inoculated into 10 ml fresh RCM supplemented with 30 µg/ml thiamphenicol and 250 µg/ml D-cycloserine for selection. The culture was grown at 37 C under anaerobic condition for 3-5 days until an increase in OD and generation of gas were observed. Then 150 μl cell culture was plated onto a RCM plate with 30 µg/ml thiamphenicol and incubated until the appearance of single colonies. Colonies were picked and inoculated into purged and sterilized (121 C, 15 psig, 30 min) tubes containing 7 ml RCM supplemented with 30 µg/ml thiamphenicol for 24 h. Then, the cells were centrifuged down and resuspended in 250 μl Buffer P1 (Qiagen, Mineprep kit) with 10 mg/ml lysozyme. The solution was incubated at 37 C for 2 h and followed by the steps in the commercial protocol (Qiagen, Mineprep kit). The obtained plasmids were measured with Nanodrop (ND-1000 UV-Vis Spectrophotometer) and transformed into E. coli DH5. 171

189 Chloramphenicol was used as the selection marker. The single colonies were picked after 24 h for colony PCR confirmation of the inserted DNA fragments. Restriction enzyme digestion and DNA sequencing were also performed to verify the plasmids extracted from the mutants Fluorescence microscope analysis C. tyrobutyricum containing plasmid pmtl82151, Ptyr-Bs2 or Pace-Bs2 were observed under a fluorescence microscope. 10 µl of bacterial cultures in the exponential phase in RCM was added to each slide and spread to the diameter of a dime. The smear was allowed to air-dry and fixed by lightly passing it through a gentle flame. The coverslips were mounted with PVA-DABCO. The slides were examined under a fluorescence microscope (Olympus BX61) with 40 objective lens. 450 nm excitation light was used along with an emission filter in the range of nm to catch fluorescent signals Real-time monitoring The correlation of fluorescent intensity with cell density for each strain was measured using TECAN GENiosProTM at an excitation wavelength of 485 nm with an emission wavelength of 535 nm. C. tyrobutyricum harboring plasmid pmtl82151, Ptyr-Bs2 or Pace-Bs2 was cultured to OD600 around 0.125, 0.25, 0.5 and 1. One ml of bacterial cultures was harvested at each time and centrifuged at 5000 g for 3 min. Cells were washed once with PBS (4.3 mm dibasic sodium phosphate, 137 mm sodium chloride, 1.47 mm monobasic potassium phosphate, 2.7 mm potassium chloride, ph 7.4) and resuspended with the same buffer to OD , 0.25, 0.5 and 1, accordingly. 150 µl of each sample 172

190 was added to each well in a 96-well plate. The measurement was taken from bottom with gain manually set at Results and discussion To examine the possibility of utilizing the FMN-based fluorescent protein Bs2 as a reporter for promoter screening in C. tyrobutyricum, two plasmids with thiolase promoter from different Clostridium strains were constructed. Figure 6.1 shows the plasmid construction strategies. The bs2 gene fragment under C. tyrobutyricum thiolase promoter was first inserted into E. coli-c. tyrobutyricum shuttle plasmid pmtl82151 using Sac II and Kpn I restriction enzyme sites. Then, the original promoter was replaced with the thiolase promoter from C. acetobutylicum. These two plasmids were transformed successfully into C. tyrobutyricum by conjugation (Fig. 6.2). Figure 6.3 illustrates the fluorescence microscope analysis of C. tyrobutyricum containing pmtl82151, Ptyr-Bs2 or Pace-Bs2. Fig. 6.3A, 6.3B and 6.3C demonstrate the cells under regular optical microscope and 3D, 3E and 3F represent the fluorescent images of the same fields. Bright green fluorescence was observed in both C. tyrobutyricum with Ptyr-Bs2 and Pace-Bs2, while there was no signal from the strain carrying the empty plasmid. The colocolization of the cells in left and right panel indicated that the Bs2 protein was successfully expressed and was capable of emitting fluorescent signals in the absence of oxygen in C. tyrobutyricum. Based on these results, it is clear that Bs2 could be used as an effective in vivo reporter for plasmid transformation. As C. tyrobutyricum is Gram-positive with a thick cell wall, the confirmation of transformation always take time and effort (as 173

191 described in method). By inserting Bs2 in the original shuttle plasmid pmtl82151, successful transformants could be easily detected under a fluorescence microscope. Compared to the mutant with Ptyr-Bs2, a longer exposure time was required for C. tyrobutyricum Pace-Bs2 to receive clear images with a high contrast, which implied that thiolase promoter from C. acetobutylicum is weaker in C. tyrobutyricum regulation system. In order to quantify the strength of these two promoters, the changes in fluorescence intensity of these two mutants during the exponential phase were measured by in vivo monitoring (Fig. 6.4). Earlier, it was reported that the thla gene is constitutively expressed in both acidogenic and solventogenic phases in Clostridium acetobutylicum (Winzer et al., 2000; Miriam et al., 2012). According to our results, the thiolase promoter from C. tyrobutyricum was also functional from the beginning of cell growth. In addition, the promoter from C. tyrobutyricum thiolase was shown to be stronger in promoting Bs2 expression. The fluorescence of Bs2 under C. tyrobutyricum thiolase promoter demonstrated a 4.8-fold higher intensity than the one under C. acetobutylicum thiolase promoter at the same OD600 value. In the enzyme activity assay performed in Chapter 3, the butyrylaldehyde-linked NADH-dependent ADH activity was about 2-fold higher when C. tyrobutyricum thiolase promoter was utilized, compared to the one from C. acetobutylicum. Combined with data obtained in this study, it could be concluded that this Bs2-based reporter system was convenient and reliable in measuring the relative promoter strength in C. tyrobutyricum. Compared to other reporter systems established in the Clostidium family, this Bs2-based reporter method has its advantages. A vector with chloramphenicol acetyltransferase (catp) 174

192 gene was first constructed by Matsushita et al for analyzing the promoters in C. perfringens (Matsushita et al., 1994). The strength of the promoters was measured based on the activity of chloramphenicol acetyltransferase in vitro. The same strategy was utilized by Bullifent et al, and a transcriptional terminator was added to prevent read-through (Bullifent et al., 1995). However, due to the practical issues associated with CatP measurements, limited samples could be obtained during the experimental time, which made it inefficient in monitoring gene expression levels (Phillips-Jones, 2000). Later, Tummala et al built a reporter system (pht3) for C. acetobutylicum using lacz as the reporter gene, in which the promoter activity was determined by β-galactosidase activity in cell crude extract (Tummala et al 1999). Another reporter system was developed in C. beijerinckii based on β-1, 4-endoglucanase gene (egla) cloned from C. acetobutylicum P262. This gene encoded a secretory endoglucanase and its activity could be analyzed by specific reaction extracellularly (Quixley and Reid, 2000). However, all these gene expression reporter systems required in vitro enzyme activity assays to exhibit promoter strength, which were both time consuming and inefficient. Then, a luxa and luxb system was reported to be suitable for real-time measurement of gene expression in Clostridium perfringens (Phillips- Jones, 1993; 2000). These two genes encoded a luciferase which could catalyze a bioluminescence reaction. The bioluminescence could be easily determined by adding decyl aldehyde in the medium. Although this method was sensitive and available for in vivo study, the reaction required oxygen, which was strictly excluded in C. tyrobutyricum fermentation. Therefore, the Bs2-based gene expression reporter system developed in this study is more convenient and suitable for in vivo determination of promoter strength and 175

193 transcriptional regulation. With the fast development in genome-wide gene expression analysis and cloning techniques, more and more promoter regulation strategies in various Clostrdium strains are unveiled (Kosaka et al., 2007; Grimmler et al., 2011; Miriam et al., 2012). However, regulatory mechanisms of the same promoter may vary from one bacterium to another. The native promoter of the target gene might not be compatible, or even functional, in the gene expression system in the host strain. Thus, this bs2 based promoterless system for qualitative and quantitative gene expression analysis would be extremely useful for gene manipulation in anaerobic microorganisms. 6.4 Conclusions In this study, a FMN-dependent fluorescent protein Bs2 based gene expression reporter system was developed. In this system, the difference in promoter strength and optimum times can be easily determined by measuring the fluorescence intensity in vivo. This system is promising in providing insights into transcriptional regulation in C. tyrobutyricum and facilitating future metabolic engineering of various anaerobic bacterial strains to produce value-added fuels and chemicals. Reference Bullifent, H.L., Moir, A., Titball, R.W., The construction of a reporter system and use for the investigation of Clostridium perfringens gene expression. FEMS Microbiol. Lett. 131, Drepper, T., Huber, R., Heck, A., Circolone, F., Hillmer, A. K., Büchs, J., Jaeger, K. E., Flavin mononucleotide-based fluorescent reporter proteins outperform green 176

194 fluorescent protein-like proteins as quantitative in vivo real-time reporters. Appl. Environ. Microbiol. 76, Fradkov, A.F., Verkhusha, V.V., Staroverov, D.B., Bulina, M.E. Yanushevich, Y.G. Martynov, V.I., Lukyanov, S., Lukyanov. K.A., Far-red fluorescent tag for protein labelling. Biochem. J. 368, Galperin, E., Verkhusha, V.V., Sorkin, A., Three-chromophore FRET microscopy to analyze multiprotein interactions in living cells. Nat. Methods. 1, He, L., Wu, X., Simone, J., Hewgill, D., Lipsky, P.E., Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP YFP mrfp FRET detected by flow cytometry. Nucleic Acids Res. 33, e61-e61. Kosaka, T., Nakayama, S., Nakaya, K., Yoshino, S., Furukawa, K., Characterization of the sol operon in butanol-hyperproducing Clostridium saccharoperbutylacetonicum strain N1-4 and its degeneration mechanism. Biosci. Biotechno. Biochem. 71, Li, X., Zhao, X., Fang, Y., Jiang, X., Duong, T., Fan, C., Huang, C.C., Kain, S.R., Generation of destabilized green fluorescent protein as a transcription reporter. J. Biol. Chem. 273, Lobo, L.A., Smith, C.J., Rocha, E.R., Flavin mononucleotide (FMN) based fluorescent protein (FbFP) as reporter for gene expression in the anaerobe Bacteroides fragilis. FEMS Microbiol. Lett. 317, Matsushita, C., Matsushita, O., Koyama, M., Okabe, A., A Clostridium perfringens vector for the selection of promoters. Plasmid. 31, Matz, M.V., Lukyanov, K.A., Lukyanov, S.A., Family of the green fluorescent protein: journey to the end of the rainbow. Bioessays. 24, Piekarski, T., Buchholz, I., Drepper, T., Schobert, M., Wagner-Doebler, I., Tielen, P., Jahn, D., Genetic tools for the investigation of Roseobacter clade bacteria. BMC Microbiol. 9, Phillips Jones, M.K., Use of a lux reporter system for monitoring rapid changes in α toxin gene expression in Clostridium perfringens during growth. FEMS Microbiol. Lett. 188, Phillips-Jones, M. K., Bioluminescence (lux) expression in the anaerobe Clostridium perfringens. FEMS Microbiol. Lett. 106, Panitz, J.C., Zverlov, V.V., Pham, V.T.T., Stürzl, S., Schieder, D., Schwarz, W.H., Isolation of a solventogenic Clostridium sp. strain: Fermentation of glycerol to n- 177

195 butanol, analysis of the bcs operon region and its potential regulatory elements. Syst. Appl. Microbiol. 37, 1-9. Quixley, K.W., Reid, S.J., Construction of a reporter gene vector for Clostridium beijerinckii using a Clostridium endoglucanase gene. J. mol. Microbiol. Biotechnol. 2, Shaner, N.C., Steinbach, P.A., Tsien, R.Y., A guide to choosing fluorescent proteins. Nat. Methods, 2, Tielker, D., Eichhof, I., Jaeger, K. E., Ernst, J. F., Flavin mononucleotide-based fluorescent protein as an oxygen-independent reporter in Candida albicans and Saccharomyces cerevisiae. Eukary. Cell, 8, Tummala, S.B., Welker, N.E., & Papoutsakis, E.T., Development and characterization of a gene expression reporter system for Clostridium acetobutylicum ATCC 824. App. Environ. Microbiol. 65, Verkhusha, V.V., Chudakov, D.M., Gurskaya, N.G., Lukyanov, S., Lukyanov, K.A., Common pathway for the red chromophore formation in fluorescent proteins and chromoproteins. Chem. Biol. 11, Williams, D.R., Young, D.I., Young, M., Conjugative plasmid transfer from Escherichia coli to Clostridium acetobutylicum. J. Gene. Microbiol. 136, Winzer K, Lorenz K, Zickner B, Dürre P. 2000, Differential regulation of two thiolase genes from Clostidium acetobutylicum DSM 792. J. Mol. Microbiol. Biotechnol. 2, Yu, M., Zhang, Y., Tang, I., Yang, S.T., Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab. Eng. 13, Zacharias, D.A., Violin, J.D., Newton, A.C., Tsien, R.Y., Partitioning of lipidmodified monomeric GFPs into membrane microdomains of live cells. Science. 296,

196 Table 6.1 Strains and plasmids used in this study. Strain/Plasmid Characteristics Reference/source Strains C. tyrobutyricum ATCC ATCC E. coli CA434 E. coli HB101 with plasmid R702 Williams et al., 1990 Ct-PaceBs2 ATCC with PaceBs2 This study Ct-PtyrBs2 ATCC with PtyrBs2 This study Plasmids pmtl82151 ColE1 ori; Cm r ; pbp1 ori; TarJ Heap et al., 2009 psos95 ColE1 ori; Ap r ; pim13 ori, MLS r ; C. aceto thl promoter, ctfab, adc Soucaille and Papoutsakis, 2002 Pace-Bs2 pmtl82151; C. acetobutylicum thl promoter, bs2 This study pmtl82151; C. tyrobutyricum thl promoter, This study Ptyr-Bs2 bs2 adc: alcohol decarboxylase; ctfab: acetoacetyl-coa transferase; thl: thiolase 179

197 Figure 6.1 Construction of recombinant plasmids Ptyr-bs2 and Pace-bs2. 180

198 A 1 2 B kb 0.6kb Figure 6.2 Confirmation of plasmid construction and transformation of Ptyr-bs2 and Pacebs2. (A) PCR confirms bs2 on Ptyr-bs2 (Lane 1) and Pace-bs2 (Lane 2). (B) Colony PCR confirmation of bs2 on plasmids extracted from Ct-PtyrBs2 (Lane 1-8). 181

199 A E B F C G Figure 6.3 Microscopic images for gene expression analysis of Ct-pMTL82151, Ct- PaceBs2 and Ct-PtyrBs2. (A), (B), (C) are light microscopic images of Ct-pMTL82151, Ct-PaceBs2 and Ct-PtyrBs2, respectively. (D), (E), (F) are fluorescence microscopic images under the same fields. The scale bar represents 50 µm. 182

200 Figure 6.4 Promoter strength assay. The liner regression equations represent the correlation of cell density and fluorescence intensity for Ct-pMTL82151, Ct-PaceBs2 and Ct-PtyrBs2 during the exponential phase. 183

201 Chapter 7: Conclusions and recommendations 7.1 Conclusions In this study, the production of n-butanol, a widely used industrial chemical and promising transportation fuel, from abundant, low-cost substrates, such as sugarcane juice, in acetone butanol ethanol (ABE) fermentation was studied with Clostridium acetobutylicum JB200. JB200 is a mutant obtained from evolutionary mutagenesis and screening, which was proved to be high butanol tolerant and capable of producing high-titer (>20 g/l) n-butanol from glucose. Although JB200 is a favorable host for industrial bio-butanol production, its fermentation performance with sucrose and sugarcane juice as substrates has not been well studied. In this study, long-term n-butanol production from sucrose by JB200 was evaluated with cells immobilized in a fibrous-bed bioreactor (FBB), showing stable performance with high titer (16 20 g/l), yield (~0.21 g/g sucrose) and productivity (~0.32 g/l h) for 16 consecutive batches over 800 h. Sugarcane thick juice as low-cost substrate was then tested in 3 consecutive batches, which gave similar n-butanol production, demonstrating that JB200 is a robust and promising strain for industrial ABE fermentation. Besides the native butanol producer JB200, the feasibility of utilizing CtΔack-adhE2, a metabolic engineered Clostidium tyrobutyricum strain in commercializing bio-butanol was also examined. Butanol produced by wild type solventogenic Clostridia via ABE 184

202 fermentation suffers from low titer and selectivity, which lead to high cost in following recovery and separation processes. The CtΔack-adhE2 mutant, achieved by overexpressing an alcohol dehydrogenase gene (adhe2) in Clostidium tyrobutyricum acetate knockout strain, was able to produce 10 g/l butanol as the main solvent product with no acetone and minimal ethanol. In this study, in order to further boost butanol production in CtΔackadhE2, extra NADH driving forces provided by artificial electron carriers like methyl viologen (MV) and benzyl viologen (BV) were generated to direct more electron and carbon towards butanol synthesis. Compared to the batches without MV and BV, significant increases in butanol titers and yields and decreases in acids and H2 generation were observed with MV or BV addition. Butanol titer as high as g/l with a yield of 0.27 g/g was fulfilled with 10 µm BV and 0.5 g/l cysteine supplement in CtΔack-adhE2 fermentation using xylose as the substrate. Changes in oxidation / reduction potential (ORP) in experimental and control fermentation batches were compared, illustrating that maintenance of the redox balance was essential for cell metabolism and butanol production. Proper ORP ranges for butanol synthesis in glucose and xylose fermentation by CtΔackadhE2 were proposed for further enhancement in butanol titer, yield and productivity through redox engineering. Isopropanol, a secondary alcohol widely used in daily life as a solvent, is also proposed to be a good candidate for direct or partial replacement of gasoline. Since the metabolic pathways and regulations of natural isopropanol producing strains are not well known, the final isopropanol titer cannot satisfy rapidly increasing market demands. In this work, we tested the feasibility of engineering Clostridium tyrobutyricum to produce isopropanol. 185

203 Plasmids harboring isopropanol synthetic pathway genes were transformed into various C. tyrobutyricum strains. The abilities of isopropanol production of obtained mutants were compared. The C. tyrobutyricum butyrate kinase knockout strain with pmtl82151-pcaa plasmid had the highest isopropanol titer of 1.79 g/l. Meanwhile, the effects of artificial electron carriers (MV or BV) on isopropanol production were also tested. By adding MV to provide extra driving force, C. tyrobutyricum acetate kinase knockout strain with pmtl82151-pcaa was able to generate 4.28 g/l isopropanol in batch fermentation. To better understand the regulations of metabolic pathways in C. tyrobutyricum, a FMNdependent fluorescent protein Bs2 based gene expression reporter system was developed to explore the in vivo strength and onset time for various promoters. The expression levels of Bs2 under thiolase promoters from C. aectobutylicum and C. tyrobutyricum were measured and compared according to their fluorescent intensities. The capacities of the two promoters in driving gene transcription in C. tyrobutyricum exponential growth phase were distinguished, demonstrating the potential of using system in screening suitable promoters for further metabolic and systematic engineering of anaerobic microorganisms. 7.2 Recommendations Mutants obtained from the mutagenesis and screening method always suffer from strain degeneration and lose their desirable features (Zhao et al., 2013). Nevertheless, Clostridium acetobutylicum JB200 exhibited outstanding capacities in butanol production after 16 consecutive repeated batch fermentation of sucrose for over 30 days or 140 generations with no sign of degeneration. Meanwhile, the strain sustained its ability of producing more 186

204 than ~21 g/l from glucose in free-cell and ~ 25 g/l in FBB fermentation after 12 months of storage in -80 o C. These results confirmed that JB200 is stable for industrial application. However, the reason for this stability remains unknown. Comparative genomic analysis of JB200 and its parental strain ATCC unclosed a point mutation on a gene encoding a signal transduction histidine kinase, resulting in a large C-terminal portion truncation of this protein in JB200 (unpublished data). Since this mutation might be the reason for the remarkable improvement in the fermentation performance of JB200, a genetic knockout and rescue experiment would be necessary to validate the loss of function of this protein is sufficient in increasing butanol tolerance and production in Clostridium acetobutylicum. This study would not only demonstrate another regulatory mechanism of butanol synthesis in solventogenic Clostridia, but also provide new gene targets for future metabolic engineering. While adding external electron carriers was confirmed to be an easy way to manipulate the intracellular redox balance and create an extra NADH driving force towards butanol generation, its detailed mechanism is still not fully understood. Although it is agreed that MV is able to increase the level of NADH in cell metabolism, there are two mechanisms proposed to explain the detailed procedure. Rao and Mutharasan claimed that the MV could competitively inhibit the activity of hydrogenase. Therefore, the electrons carried by reduced ferredoxin were redirected to ferredoxin NAD + reductase to synthesize NADH. On the other hand, Peguin et al. demonstrated that instead of reducing the activity of hydrogenase, MV could create an artificial electron transport chain linked between pyruvate-ferredoxin oxidoreductase, methyl viologen, ferredoxin-nad(p) reductase and 187

205 NAD(P) + and increase the activity of ferredoxin-nad(p) reductase by 60-fold (Peguin et al., 1994b). Further studies of the active sites and catalytic properties of hydrogenase and ferredoxin-nad(p) reductase might provide more information about MV s function on NADH generation and intercellular redox balance. Equipped with this knowledge, targeted mutation and protein engineering can be applied to modulate the enzyme structures to mimic the protein configuration upon MV addition and obtain strains with intrinsic enhanced NADH generation. These strains will have extreme industrial importance, as they can reduce the cost for MV, and produce butanol as the only main product with high titer and yield. In order to use C. tyrobutyricum as an industrial isopropanol producer, further pathway manipulation to boost the titer, yield and productivity is required. And, there a couple of strategies seem promising. Firstly, a more specific and efficient CoA transferase could be used to convert acetoacetyl-coa to acetoacetate. The CoA transferase from C. acetobutylicum was responsible for transferring CoA moiety among many substrates; therefore, it might not be ideal for targeted isopropanol production. The ctfab (H16_A1331 and H16_A1332) from C. necator seems to be a good candidate, because it utilized the succinate from the TCA cycle as the substrate. And, the research in Grousseau s group showed that this CoA tranferase has high enzyme activity towards isopropanol formation (Grousseau et al., 2014). Secondly, reactions coupled with cofactor NADPH generation should be strengthened. The accumulation of acetone in the fermentation medium implied that there were insufficient NADPH equivalents to promote the diversion of acetone to isopropanol. Meanwhile, the increased production of ethanol when MV was used indicates 188

206 that the conversion of NADH to NADPH might be the speed limiting step. Therefore, overexpression of a NAD kinase along with a transhydrogenase might be beneficial in this case. It had been reported that by modulating two genes yjfb and pntab coding a NAD kinase and a membrane-bound transhydrogenase in E. coli, the final isobutanol titer and yield were enhanced by 28% and 22%, respectively (Shi et al., 2013). However, codon optimization would need to be performed first, to make sure these two proteins would work functionally in C. tyrobutyricum. Thirdly, a stronger promoter or more gene copies might contribute to increasing the enzyme activities in the isopropanol pathway. It was demonstrated that the gene closest to the promoter its encoding protein seemed to have the best activity (Lim et al., 2011) Therefore, adding a promoter to each individual gene, including ctfab, adc and adh, or applying a stronger promoter might lead to a better expression of these enzymes. Fourthly, since the physiology of C. tyrobutyricum was so complicated and there were limited gene manipulation tools available, utilizing genome scale modeling might provide us a systematic solution to enhance the isopropanol production, rather than by operating individual genes. Finally, improving fermentation strategies might also direct to more isopropanol generation. Fibrous-bed bioreactor (FBB) could be coupled with current spinner flask, because it had been proved to have excellent performance in increasing cell density, and boosting product titers and yields (Zhu and Yang, 2004; Bai and Yang, 2005). 189

207 Reference Bai, Y., Yang, S.T., Biotransformation of R 2-hydroxy-4-phenylbutyric acid by D- lactate dehydrogenase and Candida boidinii cells containing formate dehydrogenase coimmobilized in a fibrous bed bioreactor. Biotechnol. Bioeng. 92, Grousseau, E., Lu, J., Gorret, N., Guillouet, S.E., Sinskey, A.J., Isopropanol production with engineered Cupriavidus necator as bioproduction platform. Appl. Microbiol. Biotechnol. 98, Lim, H.N., Lee, Y., Hussein, R., Fundamental relationship between operon organization and gene expression. Proceedings of the National Academy of Sciences. 108, Peguin, S., Goma, G., Delorme, P., Soucaille, P., Metabolic flexibility of Clostridium acetobutylicum in response to methyl viologen addition. Appl. Microbiol. Biotechnol. 42, Shi, A., Zhu, X., Lu, J., Zhang, X., Ma, Y., Activating transhydrogenase and NAD kinase in combination for improving isobutanol production. Metab. Eng. 16, Zhao, J., Lu, C., Chen, C.C., Yang, S.T., Biological production of butanol and higher alcohols. Bioprocessing Technologies in Biorefinery for Sustainable Production of Fuels, Chemicals, and Polymers, Wiley, Chapter 13, pp Zhu, Y., Yang, S.T., Effect of ph on metabolic pathway shift in fermentation of xylose by Clostridium tyrobutyricum. J. Biotechnol. 110,

208 Bibliography Alsaker, K.V., Papoutsakis, E.T., Transcriptional program of early sporulation and stationary-phase events in Clostridium acetobutylicum. J. Bacteriol., 187, Alsaker, K. V., Paredes, C., Papoutsakis, E.T., 2010, Metabolite stress and tolerance in the production of biofuels and chemicals: Gene-expression-based systems analysis of butanol, butyrate, and acetate stresses in the anaerobe Clostridium acetobutylicum. Biotechnol. Bioeng. 105, Alsaker, K, Spitzer, T, Papoutsakis, E.T., Transcriptional analysis of spo0a over expression in Clostridium acetobutylicum and its effect on the cell's response to butanol stress. J. Bacteriol. 186, Al-Shorgani, N.K., Kalil, M.R., Yusoff, W.M., Biobutanol production from rice bran and de-oiled rice bran by Clostridium saccharoperbutylacetonicum N1-4. Bioproc. Biosyst. Eng. 35, Atsumi, S., Cann, A.F., Connor, M.R., Shen, C.R., Smith, K.M., Brynildsen, M.P., Chou, K.J.Y., Hanai, T., Liao, J.C., 2008a. Metabolic engineering of Escherichia coli for 1- butanol production, Metab. Eng. 10, Atsumi, S., Hanai, T. and Liao, J., 2008b. Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature 451, Atsumi, S., Higashide, W., Liao, J., Direct photosynthetic recycling of carbon dioxide to isobutyraldehyde. Nat. Biotechnol. 27, Baez, A., Cho, K., Liao, J., High-flux isobutanol production using engineered Escherichia coli: a bioreactor study with in situ product removal, Appl. Microbiol. Biotechnol. 90, Bahl, H., Gottwald, M., Kuhn, A., Rale, V., Andersch, W., Gottschalk, G., Nutritional factors affecting the ratio of solvents produced by Clostridium acetobutylicum. Appl Environ. Microbiol. 52,

209 Baker, M. A., Lawen, A., Plasma membrane NADH-oxidoreductase system: a critical review of the structural and functional data. Antioxid. Redox Signal. 2, Berezina, O.V., Zakharova, N.V., Brandt, A., Yarotsky, S.V., Schwarz, W.H., Zverlov, V.V., Reconstructing the clostridial n-butanol metabolic pathway in Lactobacillus brevis. Appl. Microbiol. Biotechnol. 87, Bianco, P., Haladjian, J., Tobiana, G., Forget, P., Bruschi, M., Voltammetric determination of the redox potential of bacterial ferredoxins: Clostridium thermocellum ferredoxin. Bioelectroch. Bioener. 12, Blaschek, H.P Method of producing butanol using a mutant strain of Clostridium beijerinckii. US Blombach, B., Riester, T., Wieschalka, S., Ziert, C., Youn, J.W., Wendisch, V.F., Eikmanns, B., Corynebacterium glutamicum tailored for efficient isobutanol production. Appl. Environ. Microbiol. 77, Bond-Watts, B.B., Bellerose, R.J., Chang, M.C., Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways. Nat. Chem. Biol. 7, Borden, J.R., Papoutsakis, E.T., 2007, Dynamics of genomic-library enrichment and identification of solvent tolerance genes for Clostridium acetobutylicum. Appl. Environ. Microbiol. 73, Brekasis, D., Paget, M. S., A novel sensor of NADH/NAD+ redox poise in Streptomyces coelicolor A3 (2). The EMBO J. 22, Bullifent, H.L., Moir, A., Titball, R.W., The construction of a reporter system and use for the investigation of Clostridium perfringens gene expression. FEMS Microbiol. Lett. 131, Campos, E.J., Qureshi, N., Blaschek, H.P., Production of acetone butanol ethanol from degermed corn using Clostridium beijerinckii BA101. Appl. Biochem. Biotechnol. - Part A Enz. Eng. Biotechnol , Cann, A.F. Liao J.C., Production of 2-methyl-1-butanol in engineered Escherichia coli, Appl. Microbiol. Biotehnol. 81, Cascone R., Biobutanol-A replacement for bioethanol? Chem. Eng. Prog. 104, S4- S8. 192

210 Green, E.M., Fermentative production of butanol-the industrial perspective. Curr. Opin. Biotech. 22, Chang, W., Acetone-butanol-ethanol fermentation by engineered Clostridium beijerinckii and Clostridium tyrobutyricum, PhD dissertation, Ohio State University, Columbus, OH, USA. Chemier, J.A., Fowler, Z.L., Koffas, M.A., Leonard, E., Trends in microbial synthesis of natural products and biofuels. Advances in Enzymology Related Areas of Molecular Biology. 76, 151. Chen, W.H., Chen, Y.C., Lin, J.G., Evaluation of biobutanol production from nonpretreated rice straw hydrolysate under non-sterile environmental conditions. Bioresour. Technol. 135, Chen, J.S., Alcohol dehydrogenase: multiplicity and relatedness in the solventproducing clostridia. FEMS Microbiol. Rev. 17, Chen, X., Jiang, S., Zheng, Z., Pan, L., Luo, S., Effects of culture redox potential on succinic acid production by Corynebacterium crenatum under anaerobic conditions. Process Biochem. 47(8), Chudakov, D.M., Lukyanov, S., Lukyanov K.A., Fluorescent proteins as a toolkit for in vivo imaging. Trends Biotechnol. 23, Clark, S.W., Bennett, G.N., Rudolph, F.B., Isolation and characterization of mutants of Clostridium acetobutylicum ATCC 824 deficient in acetoacetyl-coenzyme A: acetate/butyrate: coenzyme A-transferase (EC ) and in other solvent pathway enzymes. Appl. Environ. Microbiol. 55, Collas, F., Kuit, W., Clément, B., Marchal, R., López-Contreras, A.M., Monot, F., Simultaneous production of isopropanol, butanol, ethanol and 2, 3-butanediol by Clostridium acetobutylicum ATCC 824 engineered strains. AMB Express, 2, Connor, M. R., Liao, J. C., Microbial production of advanced transportation fuels in non-natural hosts. Curr. Opin. Biotechnol. 20, Dai, Z., Dong, H., Zhu, Y., Zhang, Y., Li, Y., Ma, Y., Introducing a single secondary alcohol dehydrogenase into butanol-tolerant Clostridium acetobutylicum Rh8 switches ABE fermentation to high level IBE fermentation. Biotechnol. Biofuels. 5(1), De Graef, M. R., Alexeeva, S., Snoep, J.L., de Mattos, M.J.T., The steady-state internal redox state (NADH/NAD) reflects the external redox state and is correlated with catabolic adaptation in Escherichia coli. J. Bacteriol. 181(8),

211 Dellomonaco, C., Clomburg, J.M., Miller, E.N., Gonzalez, R., Engineered reversal of the beta-oxidation cycle for the synthesis of fuels and chemicals. Nature 476, Desai, R.P., Papoutsakis, E.T., Antisense RNA strategies for metabolic engineering of Clostridium acetobutylicum. Appl. Environ. Microbiol. 65, Doremus, M.G., Linden, J.C., Moreira, A. R., Agitation and pressure effects on acetone butanol fermentation. Biotechnol. Bioeng. 27, Drepper, T., Eggert, T., Circolone, F., Heck, A., Krauß, U., Guterl, J.K., Wendorff, M., Losi, A., Gärtner, W. Jaeger, K.E., Reporter proteins for in vivo fluorescence without oxygen. Nat. Biotechnol. 25, Drepper, T., Huber, R., Heck, A., Circolone, F., Hillmer, A.K., Büchs, J., Jaeger, K.E., Flavin mononucleotide-based fluorescent reporter proteins outperform green fluorescent protein-like proteins as quantitative in vivo real-time reporters. Appl. Environ. Microbiol. 76, Du, Y., High-yield and high-titer n-butanol producttion from lignocellulosic feedstocks by metabolically engineered Clostridium tyrobutyricum. PhD dissertation, Ohio State University, Columbus, OH, USA. Du, T,. He, A., Wu, H., Chen, J., Kong, X., Liu, J., Jiang, M., Ouyang, P., Butanol production from acid hydrolyzed corn fiber with Clostridium beijerinckii mutant. Bioresour. Technol. 135, Djelal, H., Larher, F., Martin, G., Amrane, A., Effect of the dissolved oxygen on the bioproduction of glycerol and ethanol by Hansenula anomala growing under salt stress conditions. J. Biotechnol. 125(1), Dürre, P., New insights and novel developments in clostridial acetone/butanol/isopropanol fermentation. Appl. Microbiol. Biotechnol. 49, Dürre, P., Biobutanol: an attractive biofuel. Biotechnol. J. 2, Dürre, P., Kuhn, A., Gottschalk, G., Treatment with allyl alcohol selects specifically for mutants of Clostridium acetobutylicum defective in butanol synthesis. FEMS Microbiol. Lett. 36(1), Dürre, P., Kuhn, A., Gottwald, M., Gottschalk, G., Enzymatic investigations on butanol dehydrogenase and butyraldehyde dehydrogenase in extracts of Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 26,

212 Dürre, P., Fischer, R. J., Kuhn, A., Lorenz, K., Schreiber, W., Stürzenhofecker, B., Ullmann, S., Winzer, K., Sauer, U., Solventogenic enzymes of Clostridium acetobutylicum: catalytic properties, genetic organization, and transcriptional regulation. FEMS Microbiol. Rev., 17, Dusséaux S., Croux C., Soucaille P., Meynial-Salles I., Metabolic engineering of Clostridium acetobutylicum ATCC 824 for the high-yield production of a biofuel composed of an isopropanol/butanol/ethanol mixture. Metab. Eng., 18, 1-8. Evans, P.J, Wang, H.W., Enhancement of butanol fermentation by Clostridium acetobutylicumin the presence of decanol-oleyl alcohol mixed extractants. 54, Ezeji T.C., Milne, C., Price, N.D., Blaschek, H.P Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl. Microbiol. Biotechnol. 85, Ezeji, T.C., Groberg, M., Qureshi, N., Blaschek, H.P., 2003a. Continuous production of butanol from starch-based packing peanuts. Appl. Biochem. Biotechnol. - Part A Enz. Eng. Biotechnol. 106, Ezeji, T.C., Qureshi, N., Blaschek, H.P., 2003b. Production of acetone, butanol and ethanol by Clostridium beijerinckii BA101 and in situ recovery by gas stripping. World J. Microbiol. Biotechnol. 19, Ezeji, T.C., Qureshi, N., Blaschek, H.P., 2004a. Acetone butanol ethanol (ABE) production from concentrated substrate: Reduction in substrate inhibition by fed-batch technique and product inhibition by gas stripping. Appl. Microbiol. Biotechnol. 63, Ezeji, T.C., Qureshi, N., Blaschek, H.P., 2004b. Butanol fermentation research: Upstream and downstream manipulations. Chem. Rec. 4, Ezeji, T.C, Qureshi, N., Blaschek, H.P., Production of acetone butanol (AB) from liquefied corn starch, a commercial substrate, using Clostridium beijerinckii coupled with product recovery by gas stripping. J. Ind. Microbiol. Biotechnol. 34, Ezeji, T.C, Qureshi N, Blaschek H.P., Microbial production of a biofuel (acetonebutanol-ethanol) in a continuous bioreactor: impact of bleed and simultaneous product removal. Bioproc. Biosys. Eng. 36, Ezeji T.C., Qureshi N, Karcher P.M., Blaschek H.P, Improving the performance of a gas stripping-based recovery system to remove butanol from Clostridium beijerinckii fermentation. Bioproc. Biosys. Eng. 27,

213 Ezeji, T., Qureshi, N., Blaschek, H.P., Butanol production from agricultural residues: impact of degradation products on Clostridium beijerinckii growth and butanol fermentation. Biotechnol. Bioeng. 97, Filho, M.V., Araujo, C., Bonfa, A., Porto, W., Chemistry based on renewable raw materials: perspectives for a sugar cane-based biorefinery. Enzyme Res. 11, Fischer, C., Klein-Marcuschamer, D., Stephanopoulos, G., Selection and optimization of microbial hosts for biofuels production. Metab. Eng. 10, Formanek, J., Mackie, R., Blaschek, H.P, Enhanced butanol production by Clostridium beijerinckii BA101 grown in semidefined P2 medium containing 6 percent maltodextrin or glucose. Appl. Environ. Microbiol. 63, Fradkov, A.F., Verkhusha, V.V., Staroverov, D.B., Bulina, M.E. Yanushevich, Y.G. Martynov, V.I., Lukyanov, S., Lukyanov. K.A., Far-red fluorescent tag for protein labelling. Biochem. J. 368, García, V., Päkkilä, J., Ojamo, H., Muurinen, E., Keiski, R.L., Challenges in biobutanol production: How to improve the efficiency? Renewable and Sustainable Energy Rev. 15, Galperin, E., Verkhusha, V.V., Sorkin, A., Three-chromophore FRET microscopy to analyze multiprotein interactions in living cells. Nat. Methods, 1, George, H.A., Johnson, J.L., Moore, W.E.C., Holdeman, L.V., Chen, J.S., Acetone, isopropanol, and butanol production by Clostridium beijerinckii (syn. Clostridium butylicum) and Clostridium aurantibutyricum. Appl. Environ. Microbiol. 45(3), Gheshlaghi, R., Scharer, J.M., Moo-Young, M., Chou, C.P., Metabolic pathways of clostridia for producing butanol. Biotechnol. Adv. 27, Green, E.M., Fermentative production of butanol-the industrial perspective. Curr. Opin. Biotechnol. 22, Grimmler, C., Janssen, H., Krauβe, D., Fischer, R.J., Bahl, H., Dürre, P., Liebl, W., Ehrenreich, A., Genome-wide gene expression analysis of the switch between acidogenesis and solventogenesis in continuous cultures of Clostridium acetobutylicum. J. Mol. Microbiol. Biotechnol. 20, Groot, W.J., van den Oever, C.E., Kossen N.W.F., 1984, Pervaporation for simultaneous product recovery in the butanol/isopropanol batch fermentation. Biotechnol. Lett. 6,

214 Grousseau, E., Lu, J., Gorret, N., Guillouet, S. E., Sinskey, A. J., Isopropanol production with engineered Cupriavidus necator as bioproduction platform. Appl. Microbiol. Biotechnol. 98, Grupe, H., Gottschalk, G., Physiological events in Clostridium acetobutylicum during the shift from acidogenesis to solventogenesis in continuous culture and presentation of a model for shift induction. Appl. and environmental Microbiol. 58(12), Guo, T., He, A., Du, T., Zhu, D., Liang, D., Jiang, M., Wei, P., Ouyang, P., Butanol production from hemicellulosic hydrolysate of corn fiber by a Clostridium beijerinckii mutant with high inhibitor-tolerance. Bioresour. Technol. 135, Hanai, T., Atsumi, S., Liao, J.C., Engineered synthetic pathway for isopropanol production in Escherichia coli. Appl. Environ. Microbiol. 73, Harris, L., Blank, L., Desai, R.P., Welker, N.E., Papoutsakis, E.T., Fermentation characterization and flux analysis of recombinant strains of Clostridium acetobutylicum with an inactivated gene. J. Ind. Microbiol. Biotechnol. 27, Harris, L.M., Desai, R.P., Welker, N.E., Papoutsakis, E.T., Characterization of recombinant strains of the Clostridium acetobutylicum butyrate kinase inactivation mutant: Need for new phenomenological models for solventogenesis and butanol inhibition? Biotechnol. Bioeng. 67, Hartmanis, M.G., Gatenbeck, S., Intermediary metabolism in Clostridium acetobutylicum: levels of enzymes involved in the formation of acetate and butyrate. Appl. Environ. Microbiol. 47, Hazelwood, L.A., Daran, J.M., Van Maris, A.J.A., Pronk, J.T., Dickinson, J.R The Ehrlich pathway for fusel alcohol production: A century of research on Saccharomyces cerevisiae metabolism. Appl. Environ. Microbiol. 74, He, L., Wu, X., Simone, J., Hewgill, D., Lipsky, P.E., Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP YFP mrfp FRET detected by flow cytometry. Nucleic Acids Res. 33, e61-e61. He, Q., Chen, H., Improved efficiency of butanol production by absorbed lignocellulose fermentation. J. Biosci. Bioeng. 115, Heap, J.T., Pennington, O.J., Cartman, S.T., Carter, G.P., Minton, N.P The ClosTron: A universal gene knock-out system for the genus Clostridium. J. Microbiol. Methods 70,

215 Heap, J.T., Pennington, O.J., Cartman, S.T., Minton, N.P., A modular system for Clostridium shuttle plasmids. J. Microbiolo. Meth. 78, Heap, J.T., Kuehne, S.A., Ehsaan, M., Cartman, S.T., Cooksley, C.M., Scott, J.C., Minton, N.P., The ClosTron: Mutagenesis in Clostridium refined and streamlined. J. Microbiol. Methods 80, Huang, H., Liu, H., Gan, Y.R., Genetic modification of critical enzymes and involved genes in butanol biosynthesis from biomass. Biotechnol. Adv. 28, Huang, W.C., Ramey, D.E., Yang, S.T., Continuous production of butanol by Clostridium acetobutylicum immobilized in a fibrous bed bioreactor. Appl. Biochem. Biotechnol , Inokuma, K., Liao, J.C., Okamoto, M., Hanai, T., Improvement of isopropanol production by metabolically engineered Escherichia coli using gas stripping. J. Biosci. Bioeng, 110, Ismaiel, A.A., Zhu, C.X., Colby, G.D., Chen, J.S., Purification and characterization of a primary-secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii. J. Bacteriol. 175, Jain, M.K., Mutant strain of C. acetobutylicum and process for making butanol, US Patent Jang Y.S., Malaviya, A., Cho, C., Lee, J., Lee, S., Butanol production from renewable biomass by clostridia. Bioresourc. Technol. 123, Jang, Y.S., Malaviya, A., Lee, J., Im, J., Lee, S.Y., Lee, J., Seung, D.Y., Metabolic engineering of Clostridium acetobutylicum for the enhanced production of isopropanol butanol ethanol fuel mixture. Biotechnol. Progr. 29, Jesse, T.W., Ezeji, T.C., Qureshi, N., Blaschek, H.P., Production of butanol from starch-based waste packing peanuts and agricultural waste. J. Ind. Microbiol. Biotechnol. 29, Jiang, Y., Xu, C.M., Dong, F., Yang, Y.L., Jiang, W.H., Yang, S., Disruption of the acetoacetate decarboxylase gene in solvent-producing Clostridium acetobutylicum increases the butanol ratio. Metab. Eng. 11, Jojima, T., Inui, M., Yukawa, H., Production of isopropanol by metabolically engineered Escherichia coli. Appl. Microbiol. Biotechnol. 77,

216 Jones, S.W., Paredes, C.J., Tracy, B., Cheng, N. et al., The transcriptional program underlying the physiology of clostridial sporulation. Genome Biol. 9, R114. Jiang, L., Wang, J., Liang, S., Cai, J., Xu, Z., Cen, P., Yang, S.T., Li, S., Enhanced butyric acid tolerance and bioproduction by Clostridium tyrobutyricum immobilized in a fibrous bed bioreactor. Biotechnol. Bioeng. 108, Jones, D.T., Woods, D.R., Acetone-butanol fermentation revisited. Microbiol. Rev. 50, Jang, Y. S., Cho, J. H., Seung, D., Lee, S. Y., Papoutsakis, E. T., Bennett, G. N., Song, H., Characterization and evaluation of corn steep liquid in acetone-butanol-ethanol production by Clostridium acetobutylicum. Biotechnol. Bioprocess Eng. 18(2), Junelles, A.M., Janati-Idrissi, R., El Kanouni, A., Petitdemange, H., Gay, R., Acetone-butanol fermentation by mutants selected for resistance to acetate and butyrate halogen analogues. Biotechnol. Lett. 9, Junelles, A.M., Janati-Idrissi, R., Petitdemange, H., Gay, R., Iron effect on acetonebutanol fermentation. Curr. Microbiol. 17, Kadam, K.L., Newman, M.M., Development of a low-cost fermentation medium for ethanol production from biomass. Appl. Microbiol. Biotechnol. 47, Karp, Gerald, Cell and Molecular Biology, 5th Ed. Wiley, Keis, S., Shaheen, R., Jones, D.T., Emended description of Clostridium acetobutylicum and Clostridium beijerinckii, and description of Clostridium saccharoperbutylacetonicum sp. nov. and Clostridium saccharobutylicum sp. nov. Int. J. Syst. Evol. Microbiol. 51, Khan, Q.A., Hadi, S.M., Inactivation and repair of bacteriophage lambda by furfural. Biochem. Mol. Biol. Int. 32, Kim, B.H., Bellows, P., Datta, R., Zeikus, J.G., Control of carbon and electron flow in Clostridium acetobutylicum fermentations: utilization of carbon monoxide to inhibit hydrogen production and to enhance butanol yields. Appl. Environ. Microbiol. 48, Klinke, H.B., Ahring, B.K., Schmidt, A.S., Thomsen, A.B., Characterization of degradation products from alkaline wet oxidation of wheat straw. Bioresour. Technol. 82,

217 Knoshaug, E.P. and Zhang, M., Butanol tolerance in a selection of microorganisms. Appl. Biochem. Biotechnol. 153, Kosaka, T., Nakayama, S., Nakaya, K., Yoshino, S., Furukawa, K., Characterization of the sol operon in butanol-hyperproducing Clostridium saccharoperbutylacetonicum strain N1-4 and its degeneration mechanism. Biosci. Biotechno. Biochem. 71, Kumar, M., Gayen K., Developments in biobutanol production: New insights. Appl. Energy. 88, Krivoruchko, A., Serrano-Amatriain, C., Chen, Y., Siewers, V., Nielsen, J., Improving biobutanol production in engineered Saccharomyces cerevisiae by manipulation of acetyl-coa metabolism. J. Ind. Microbiol. Biotechnol. 40, Kültz, D., Molecular and evolutionary basis of the cellular stress response. Annu. Rev. Physiol., 67, Kusakabe, T., Tatsuke, T., Tsuruno, K., Hirokawa, Y., Atsumi, S., Liao, J.C., Hanai, T., Engineering a synthetic pathway in cyanobacteria for isopropanol production directly from carbon dioxide and light. Metab. Eng., 20, Lawford, H.G., Rousseau, J.D., Studies on nutrient requirements and cost-effective supplements for ethanol production by recombinant E. coli. Appl. Biochem. Biotechnol. 57, Lee, I., Johnson, L. A., Hammond, E. G., Use of branched-chain esters to reduce the crystallization temperature of biodiesel. J. the Am. Oil Chem. Soc. 72, Lee, J., Jang, Y.S., Choi, S.J., Im, J.A., Song, H., Cho, J.H. Papoutsakis, T., Bennett, G., Lee. S.Y., Metabolic engineering of Clostridium acetobutylicum ATCC 824 for isopropanol-butanol-ethanol fermentation. Appl. Environ. Microbiol. 78, Lee, S. K., Chou, H., Ham, T. S., Lee, T. S., Keasling, J. D., Metabolic engineering of microorganisms for biofuels production: from bugs to synthetic biology to fuels. Curr. Opin. Biotechnol. 19, Lee, S.Y., Park, J.H., Jang, S.H., Nielsen, L.K., Kim, J., Jung, K.S., Fermentative butanol production by Clostridia. Biotechnol. Bioeng. 101, Lehmann, D., Hönicke, D., Ehrenreich, A., Schmidt, M., Weuster-Botz, D., Bahl, H., Lütke-Eversloh, T., Modifying the product pattern of Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 94,

218 Lehmann, D., Radomski, N., Lütke-Eversloh, T., New insights into the butyric acid metabolism of Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 96, Liggett, R.W., Koffler, H., Corn steep liquor in Microbiol. Bacteriol. Rev. 12, 297. Lim, H.N., Lee, Y., Hussein, R., Fundamental relationship between operon organization and gene expression. Proceedings of the National Academy of Sciences. 108, Li, X., Zhao, X., Fang, Y., Jiang, X., Duong, T., Fan, C., Huang, C.C., Kain, S.R., Generation of destabilized green fluorescent protein as a transcription reporter. J. Biol. Chem. 273, Liu, C.G., Xue, C., Lin, Y.H., Bai, F.W., Redox potential control and applications in microaerobic and anaerobic fermentations. Biotechnol. Adv. 31, Liu, D., Chen, Y., Li, A., Ding, F., Zhou, T., He, Y., Li, B., Niu, H., Lin, X., Chen, X., Wu. J., Ying, H., Enhanced butanol production by modulation of electron flow in Clostridium acetobutylicum B3 immobilized by surface adsorption. Bioresour. Technol. 129, Liu, F., Feng, X., Separation of acetone-butanol-ethanol (ABE) from dilute aqueous solutions by pervaporation. Sep. Purif. Technol. 42, Liu, K., Atiyeh, H.K., Stevenson, B.S., Tanner, R.S., Wilkins, M.R., Huhnke, R.L., Continuous syngas fermentation for the production of ethanol, n-propanol and n- butanol. Bioresour. Technol. 151, Liu, S., Qureshi, N., How microbes tolerate ethanol and butanol. New Biotechnol. 26, Liu, X., Zhu, Y., Yang, S.T., Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol. Progr. 22, Liu, Z., Ying, Y., Li, F., Ma, C., Xu, P., Butanol production by Clostridium beijerinckii ATCC from wheat bran. J. Ind. Microbiol. Biotechnol. 37, Liu, Z.L., Blaschek, H.P., Biomass conversion inhibitors and in situ detoxification. Biomass to biofuels: strategies for global industries Liyanage, H., Young, M., Kashket, E., Butanol tolerance of Clostridium beijerinckii NCIMB 8052 associated with down-regulation of glda by antisense RNA. J. Mol. Microbiol. Biotechnol. 2,

219 Lobo, L.A., Smith, C.J., Rocha, E.R., Flavin mononucleotide (FMN) based fluorescent protein (FbFP) as reporter for gene expression in the anaerobe Bacteroides fragilis. FEMS Microbiol. Lett. 317, Lu, C., Zhao, J., Yang, S.T., Wei, D Fed-batch fermentation for butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour. Technol. 104, Lu, C., Dong, J., Yang, S.T., Butanol production from wood pulping hydrolysate in an integrated fermentation-gas stripping process. Bioresour. Technol. 143, Mainguet, S.E. Liao, J.C., Bioengineering of microorganisms for C3 to C5 alcohols production. Biotechnol. J. 5, Mao, S., Luo, Y., Zhang, T., Li, J., Bao, G., Zhu, Y., Chen, Z., Zhang, Y., Li, Y., Ma, Y., Proteome reference map and comparative proteomic analysis between a wild type Clostridium acetobutylicum DSM 1731 and its mutant with enhanced butanol tolerance and butanol yield. J. Proteome Research 9, Marchal, R., Blanchet, D., Vandecasteele, J.P., Industrial optimization of acetonebutanol fermentation: a study of the utilization of Jerusalem artichokes. Appl. Microbiol. Biotechnol. 23, Mariano, A.P., Dias, M.O.S., Junqueira, T.L., Cunha, M.P., Bonomi, A., Filho, R.M., Butanol production in a first-generation Brazilian sugarcane biorefinery: Technical aspects and economics of greenfield projects. Bioresour. Technol. 135, Matsushita, C., Matsushita, O., Koyama, M., Okabe, A., A Clostridium perfringens vector for the selection of promoters. Plasmid, 31, Matsumura, M., Takehara, S., Kataoka, H., Continuous butanol/isopropanol fermentation in down flow column reactor coupled with pervaporation using supported liquid membrane. Biotechnol. Bioeng. 39, Matz, M.V., Lukyanov, K.A., Lukyanov, S.A., Family of the green fluorescent protein: journey to the end of the rainbow. Bioessays. 24, Meyer, C.L., Roos, J.W., Papoutsakis, E.T., Carbon monoxide gasing leads to alcohol production and butyrate uptake without acetone formation in continuous cultures ofclostridium acetobutylicum. Appl. Microbiol. Biotechnol. 24, Michaelis, L., Hill, E.S., The viologen indicators. J. Gen. Physiol, 16,

220 Murray, D.B., Haynes, K., Tomita, M., Redox regulation in respiring Saccharomyces cerevisiae. Biochim. Biophys. Acta. 1810, Nair, R.V., Green, E.M., Watson, D.E., Bennett, G.N., Papoutsakis, E.T Regulation of the sol locus genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 by a putative transcriptional repressor. J. Bacteriol. 181, Nakashimada, Y., Rachman, M.A., Kakizono, T., Nishio, N., Hydrogen production of Enterobacter aerogenes altered by extracellular and intracellular redox states. Int. J. Hydrogen Energy. 27, Nakayama, S.I., Kosaka, T., Hirakawa, H., Matsuura, K., Yoshino, S., Furukawa, K., Metabolic engineering for solvent productivity by downregulation of the hydrogenase gene cluster hupcba in Clostridium saccharoperbutylacetonicum strain N1-4. Appl. Microbiol. Biotechnol. 78, Ni, Y., Sun, Z., Recent progress on industrial fermentative production of acetonebutanol-ethanol by Clostridium acetobutylicum in China. Appl. Microbiol. Biotechnol. 83, Ni, Y., Wang, Y., Sun, Z., Butanol production from cane molasses by Clostridium saccharobutylicum DSM 13864: batch and semicontinuous fermentation. Appl. Biochem. Biotechnol. 166, Ni Y, Xia Z, Wang Y, Sun Z., Continuous butanol fermentation from inexpensive sugar-based feedstocks by Clostridium saccharobutylicum DSM Bioresour. Technol. 129, Nicolaou, S.A., Gaida, S.M., Papoutsakis, E.T A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: From biofuels and chemicals, to biocatalysis and bioremediation. Metab. Eng. 12, Nielson, L., Larsson, M., Holst, O., Mattiasson, B., Adsorbents for extractive bioconversion applied to the acetone butanol fermentation. Appl. Microbiol. Biotechnol. 28, Nielsen, D.R., Leonard, E., Yoon, S.H., Tseng, H.C., Yuan, C., Prather, K.J. 2009a. Engineering alternative butanol production platforms in heterologous bacteria. Metab. Eng. 11, Nielsen, D.R. and Prather, K.J. 2009b. In situ product recovery of n-butanol using polymeric resins. Biotechnol. Bioeng. 102,

221 Nolling, J., Breton, G., Omelchenko, M.V., Makarova, K.S., Zeng, Q., Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J. Bacteriol. 183, Oudshoorn, A., Van der Wielen, L.A.M., Straathof, A.J.J., Assessment of options for selective 1-butanol recovery from aqueous solutions. Ind. Eng. Chem. Res. 48, Panitz, J.C., Zverlov, V.V., Pham, V.T.T., Stürzl, S., Schieder, D., Schwarz, W.H., Isolation of a solventogenic Clostridium sp. strain: Fermentation of glycerol to n- butanol, analysis of the bcs operon region and its potential regulatory elements. Sys. Appl. Microbiol. 37, 1-9. Papoutsakis, E.T Engineering solventogenic clostridia. Curr. Opin. Biotechnol. 19, Papoutsakis, E.T., Santiago, J.Y., Tesic, M., Tomas, C.A., U.S. Patent No Papoutsakis, E.T., Tomas, C.A., Tesic, M., Santiago, J.Y., Increased cell resistance to toxic organic substances. US Patent No Parekh, M., Blaschek, H.P Butanol production by hypersolvent-producing mutant Clostridium beijerinckii BA101 in corn steep water medium containing maltodextrin. Biotechnol. Lett. 21, Parekh, M., Formanek, J., Blaschek, H. P., Pilot-scale production of butanol by Clostridium beijerinckii BA101 using a low-cost fermentation medium based on corn steep water. Appl. Microbiol. Biotechnol. 51, Pei, J., Zhou, Q., Jing, Q., Li, L., Dai, C., Li, H., Wiegel, J., Shao, W., The mechanism for regulating ethanol fermentation by redox levels in Thermoanaerobacter ethanolicus. Metab. Eng. 13, Peguin, S., Goma, G., Delorme, P., Soucaille, P., Metabolic flexibility of Clostridium acetobutylicum in response to methyl viologen addition. Appl. Microbiol. Biotechnol. 42, Peguin, S., Delorme, P., Goma, G., Soucaille, P., Enhanced alcohol yields in batch cultures of Clostridium acetobutylicum using a three-electrode potentiometric system with methyl viologen as electron carrier. Biotechnol. Lett. 16, Peguin, S., Soucaille, P., Modulation of carbon and electron flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl. Environ. Microbiol. 61(1),

222 Peralta Yahya, P.P., Keasling, J.D., Advanced biofuel production in microbes. Biotechnol. J. 5, Phillips-Jones, M. K., Bioluminescence (lux) expression in the anaerobe Clostridium perfringens. FEMS Microbiol. Lett. 106, Phillips-Jones, M.K., Use of a lux reporter system for monitoring rapid changes in α-toxin gene expression in Clostridium perfringens during growth. FEMS Microbiol. Lett. 188, Pham, T.H., Mauvais, G., Vergoignan, C., De Coninck, J., Dumont, F., Lherminier, J., Lherminier, J., Cachon R., Feron, G., Gaseous environments modify physiology in the brewing yeast Saccharomyces cerevisiae during batch alcoholic fermentation. J. Appl. Microbiol. 105, Piekarski, T., Buchholz, I., Drepper, T., Schobert, M., Wagner-Doebler, I., Tielen, P., Jahn, D., Genetic tools for the investigation of Roseobacter clade bacteria. BMC Microbiol. 9, Pierrot, P., Fick, M., Engasser, J.M., Continuous acetone-butanol fermentation with high productivity by cell ultrafiltration and recycling. Biotechnol. Lett. 8, Qureshi, N., Blaschek, H.P Butanol recovery from model solution/fermentation broth by pervaporation: evaluation of membrane performance. Biomass. Bioenerg, 17, Qureshi, N., Blaschek, H.P , Butanol production using Clostridium beijerinckii BA101 hyper-butanol producing mutant strain and recovery by pervaporation. Appl. Biochem. Biotechnol. 84, Qureshi, N., Blaschek, H.P., Recent advances in ABE fermentation: hyper-butanol producing Clostridium beijerinckii BA101. J. Ind. Microbiol. Biotechnol. 27, Qureshi, N. Ezeji, T.C., Butanol, a superior biofuel production from agricultural residues (renewable biomass): recent progress in technology. Biofuels, Bioprod. Bioref. 2, Qureshi, N., Ezeji, T.C., Ebener, J., Dien, B.S., Cotta, M.A., Blaschek, H.P., Butanol production by Clostridium beijerinckii. Part I: Use of acid and enzyme hydrolyzed corn fiber. Bioresour. Technol. 99, Qureshi, N., Lolas, A., Blaschek, H.P., Soy molasses as fermentation substrate for production of butanol using Clostridium beijerinckii BA101. J. Ind. Microbiol. Biotechnol. 26,

223 Qureshi, N., Saha, B. C., Dien, B., Hector, R. E., Cotta, M.A., Production of butanol (a biofuel) from agricultural residues: Part I - Use of barley straw hydrolysate. Biomass Bioenergy. 34, Qureshi, N., Saha, B.C., Cotta, M.A., Butanol production from wheat straw hydrolysate using Clostridium beijerinckii. Bioproc. Biosyst. Eng. 30, Qureshi, N., Saha, B.C., Hector, R.E., Dien, B., Hughes, S., Liu, S., Iten, L., Bowman, M.J., Sarath, G., Cott, M.A., Production of butanol (a biofuel) from agricultural residues: part II - use of corn stover and switchgrass hydrolysates. Biomass Bioenergy. 34, Qureshi, N., Saha, B. C., Hector, R. E., Cotta, M.A., Removal of fermentation inhibitors from alkaline peroxide pretreated and enzymatically hydrolyzed wheat straw: Production of butanol from hydrolysate using Clostridium beijerinckii in batch reactors. Biomass Bioenergy. 32, Qureshi, N., Karcher, P., Cotta, M., Blaschek, H. P., High-productivity continuous biofilm reactor for butanol production. In Proceedings of the Twenty-Fifth Symposium on Biotechnology for Fuels and Chemicals Held May 4-7, 2003, in Breckenridge, CO (pp ). Quixley, K.W., Reid, S.J., Construction of a reporter gene vector for Clostridium beijerinckii using a Clostridium endoglucanase gene. J. Mol. Microbiol. Biotechnol. 2, Qureshi, N., Maddox, I.S., Friedl, A., Application of continuous substrate feeding to the ABE fermentation: relief of product inhibition using extraction, perstraction, stripping and pervaporation. Biotechnol. Prog. 8, Roffler, S.R., Blanch, H.W., Wilke, C.R., 1987a. In-situ recovery of butanol during fermentation, part 1: batch extractive fermentation. Bioprocess Eng. 2, Roffler, S.R., Blanch, H.W., Wilke, C.R., 1987b. In-situ recovery of butanol during fermentation, part 2: fed-batch extractive fermentation. Bioprocess Eng. 2, Rao, G., Mutharasan, R., Alcohol production by Clostridium acetobutylicum induced by methyl viologen. Biotechnol. Lett. 8, Rao, G., Mutharasan, R., Altered electron flow in continuous cultures of Clostridium acetobutylicum induced by viologen dyes. Appl. Environ. Microbiol. 53, Rao, G., Ward, P.J., Mutharasan, R., Manipulation of End Product Distribution in Strict Anaerobes. Ann. N. Y. Acad. Sci. 506,

224 Schaffer, S., Isci, N., Zickner, B., Dürre, P., Changes in protein synthesis and identification of proteins specifically induced during solventogenesis in Clostridium acetobutylicum. Electrophoresis. 23, Searchinger, T., Heimlich, R., Houghton, R.A., Dong, F., Elobeid, A., Fabiosa, J., Tokgoz, S., Hayes, D., Yu, T.H., Use of U.S. croplands for biofuels increases greenhouse gases through emissions from land-use change. Science. 319, Servinsky, M.D., Kiel, J.T., Dupuy, N.F., Sund, C.J., Transcriptional analysis of differential carbohydrate utilization by Clostridium acetobutylicum. Microbiol. 156, Shaheen, R., Shirley, M., Jones, D.T., Comparative fermentation studies of industrial strains belonging to four species of solvent-producing clostridia. J. Mol. Microbiol. Biotechnol. 2, Shaner, N.C., Steinbach, P.A., Tsien, R.Y., A guide to choosing fluorescent proteins. Nat. Methods. 2, Shao, P., Huang, R.Y.M., Polymeric membrane pervaporation. J. Membr. Sci. 287, Shen, C.R., Lan, E.I., Dekishima, Y., Baez, A., Cho, K.M., Liao, J.C., Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl. Environ. Microbiol. 77, Shen, C.R., Liao, J.C., Metabolic engineering of Escherichia coli for 1-butanol and 1-propanol production via the keto-acid pathways. Metab. Eng. 10, Shi, Z., Blaschek, H.P., Transcriptional analysis of Clostridium beijerinckii NCIMB 8052 and the hyper-butanol-producing mutant BA101 during the shift from acidogenesis to solventogenesis. Appl. Environ. Microbiol. 74, Si, T., Luo, Y., Xiao, H., Zhao, H., Utilizing an endogenous pathway for 1-butanol production in Saccharomyces cerevisiae. Metab. Eng. 451, Sikkema, J., de Bont, J. A., Poolman, B., Mechanisms of membrane toxicity of hydrocarbons. Microbiol. Rev. 59, Sillers, R., Chow, A., Tracy, B., Papoutsakis, E.T., Metabolic engineering of the non-sporulating, non-solventogenic Clostridium acetobutylicum strain M5 to produce butanol without acetone demonstrate the robustness of the acid-formation pathways and the importance of the electron balance. Metab. Eng. 10,

225 Sillers, R., A-Hinai, M.A., Papoutsakis, E.T., Aldehyde-alcohol dehydrogenase and/or thiolase overexpression coupled with CoA transferase downregulation lead to higher alcohol titers and selectivity in Clostridium acetobutylicum fermentations. Biotechnol. Bioeng. 102, Smith, K.M., Cho, K., Liao, J. C., Engineering Corynebacterium glutamicumfor isobutanol production. Appl. Microbiol. Biotechnol. 87, Soucaille, P., Joliff, G., Izard, A., Goma, G., Butanol tolerance and autobacteriocin production by Clostridium acetobutylicum. Curr. Microbiol. 14, Steen, E.J., Chan, R., Prasad, N., Myers, S., Petzold, C.J., Redding, A., Ouellet, M., Keasling, J.D., Metabolic engineering of Saccharomyces cerevisiae for the production of n-butanol. Microb. Cell. Fact. 7, Stephanopoulos, G., Challenges in engineering microbes for biofuels production. Science. 315, Stombaugh, N.A., Sundquist, J.E., Burris, R.H., Orme-Johnson, W.H., Oxidationreduction properties of several low potential iron-sulfur proteins and of methylviologen. Biochem. 15, Survase, S.A., Jurgens, G., Van Heiningen, A., Granström, T., Continuous production of isopropanol and butanol using Clostridium beijerinckii DSM Appl. Microbiol. Biotechnol. 91, Tamakawa, H., Mita, T., Yokoyama, A., Ikushima, S., Yoshida, S., Metabolic engineering of Candida utilis for isopropanol production. Appl. Microbiol. Biotechnol. 97, Tashiro, Y., Takeda, K., Kobayashi, G., Sonomoto, K., Ishizaki, A., Yoshino, S., High butanol production by Clostridium saccharoperbutylacetonicum N1-4 in fedbatch culture with ph-stat continuous butyric acid and glucose feeding method. J. Biosci. Bioeng. 98: Thang, V.H., Kanda, K., Kobayashi. G., Production of acetone-butanol-ethanol (ABE) in direct fermentation of cassava by Clostridium saccharoperbutylacetonicum N1-4. Appl. Biochem. Biotechnol. 161, Thongsukmaka, A., and Sirkar, K.K., Pervaporation membranes highly selective for solvents present in fermentation broths. J. Membr. Sci. 302,

226 Thorneley, R.N A convenient electrochemical preparation of reduced methyl viologen and a kinetic study of the reaction with oxygen using an anaerobic stoppedflow apparatus. Biochim. Biophys. Acta. 333, Tielker, D., Eichhof, I., Jaeger, K. E., Ernst, J. F., Flavin mononucleotide-based fluorescent protein as an oxygen-independent reporter in Candida albicans and Saccharomyces cerevisiae. Eukaryot. Cell. 8, Tomas, C.A., Welker, N.E., Papoutsakis, E.T., Overexpression of groesl in Clostridium acetobutylicum results in increased solvent production and tolerance, prolonged metabolism, and changes in the cell's transcriptional program. Appl. Environ. Microbiol. 69, Tong, C.C., Bai, Y.X., Wu, J.P., Zhang, L., Yang, L.R., Qian, J.W., Pervaporation recovery of acetone-butanol from aqueous solution and fermentation broth using HTPB-based polyurethaneurea membranes. Sep. Sci. Technol. 45, Tracy, B.P., Jones, S.W., Fast, A.G., Indurthi, D.C., Papoutsakis, E.T., Clostridia: the importance of their exceptional substrate and metabolite diversity for biofuel and biorefinery applications. Curr. Opin. Biotechnol. 23, Tsien, R. Y., The green fluorescent protein. Annu. Rev. Biochem. 67, Tummala, S.B., Welker, N.E., Papoutsakis, E.T., Development and Characterization of a Gene Expression Reporter System for Clostridium acetobutylicum ATCC 824. App. Environ. Microbiol. 65, Vane, L.M., Review: A review of pervaporation for product recovery from biomass fermentation processes. J. Chem. Technol. Biotechnol. 80, Vane, L.M., Separation technologies for the recovery and dehydration of alcohols from fermentation broths. Biofuels. Bioprod. Bioref. 2, Varga, E., Klinke, H.B., Réczey, K., Thomsen, A.B High solid simultaneous saccharification and fermentation of wet oxidized corn stover to ethanol. Biotechnol. Bioeng. 88, Vasconcelos, I., Girbal, L., Soucaille, P., Regulation of carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph on mixtures of glucose and glycerol. J. Bacteriol. 176, Vemuri, G.N., Altman, E., Sangurdekar, D.P., Khodursky, A.B., Eiteman, M.A., Overflow metabolism in Escherichia coli during steady-state growth: transcriptional regulation and effect of the redox ratio. Appl. Environ. Microbiol. 72,

227 Verkhusha, V.V., Chudakov, D.M., Gurskaya, N.G., Lukyanov, S., Lukyanov, K.A., Common pathway for the red chromophore formation in fluorescent proteins and chromoproteins. Chem. Biol. 11, Wang, Q., Venkataramanan, K.P., Huang, H., Papoutsakis, E.T., Wu, C.H., Transcription factors and genetic circuits orchestrating the complex, multilayered response of Clostridium acetobutylicum to butanol and butyrate stress. BMC Syst. Biol. 7, 120. Wang, S., Zhu, Y., Zhang, Y., Li, Y., Controlling the oxidoreduction potential of the culture of Clostridium acetobutylicum leads to an earlier initiation of solventogenesis, thus increasing solvent productivity. Appl. Microbiol. Biotechnol. 93, Wang, Y., Li, K., Huang, F., Wang, J., Zhao, J., Zhao, X., Zhou, S., Engineering and adaptive evolution of Escherichia coli W for l-lactic acid fermentation from molasses and corn steep liquor without additional nutrients. Bioresour. Technol. 148, Weber, C., Farwick, A., Benisch, F., Brat, D., Dietz, H., Subtil, T., Boles, E., Trends and challenges in the microbial production of lignocellulosic bioalcohol fuels. Appl. Microbiol. Biotecnol. 87, Wietzke, M., Bahl, H., The redox-sensing protein Rex, a transcriptional regulator of solventogenesis in Clostridium acetobutylicum.appl. Microbiol. Biotechnol. 96(3), Wiesenborn, D.P., Rudolph, F.B., Papoutsakis, E.T., Coenzyme A transferase from Clostridium acetobutylicum ATCC 824 and its role in the uptake of acids. Appl. Environ. Microbiol. 55, Williams, D.R., Young, D.I., Young, M., Conjugative plasmid transfer from Escherichia coli to Clostridium acetobutylicum. J. Gene. Microbiol. 136, Wu, Z., Yang, S.T Extractive fermentation for butyric acid production from glucose by Clostridium tyrobutyricum. Biotechnol. Bioeng. 82, Xue, C., Zhao, J., Lu, C., Yang, S.T., Bai, F., Tang, L.C., High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping, Biotechnol. Bioeng. 109, Xue, C., Zhao, J., Liu, F., Lu, C., Yang, S.T., Bai, F.W., Two-stage in situ gas stripping for enhanced butanol fermentation and energy-saving product recovery. Bioresour. Technol. 135,

228 Xue, C., Zhao, J., Lu, C., Yang, S.T., Bai, F., Tang, I.C., High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping. Biotechnol. Bioeng. 109, Yang, S.T., Extractive fermentation using convoluted fibrous bed bioreactor. USP Yang, S.T., Zhao, J., Adaptive engineering of Clostridium for increased butanol production, US Patent No Yerushalmi, L., Volesky, B., Importance of agitation in acetone butanol fermentation. Biotechnol. Bioeng. 27, Yerushalmi, L., Volesky, B., Szczesny, T., Effect of increased hydrogen partial pressure on the acetone-butanol fermentation by Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 22, Yu, M., Du, Y., Jiang, W., Chang, W.L., Yang, S.T., Tang, L.C., Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum, Appl. Microbiol. Biotechnol. 93, Yu, M., Zhang, Y., Tang, I., Yang, S.T., Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab. Eng. 13, Zacharias, D.A., Violin, J.D., Newton, A.C., Tsien, R.Y., Partitioning of lipidmodified monomeric GFPs into membrane microdomains of live cells. Science. 296, Zaldivar, J., Ingram, L.O., Effect of organic acids on the growth and fermentation of ethanologenic Escherichia coli LY01. Biotech. Bioeng. 66, Zhang, J., Wang, M., Gao, M., Fang, X., Yano, S., Qin, S., Xia, R., Efficient acetonebutanol-ethanol production from corncob with a new pretreatment technologywet disk milling. Bioenergy Research 6, Zhang, Y., Ma, Y., Yang, F., Zhang, C., Continuous acetone-butanol-ethanol production by corn stalk immobilized cells. J. Ind. Microbiol. Biotechnol. 36, Zhang, Y., Yu, M., Yang, S.T., Effects of ptb knockout on butyric acid fermentation by Clostridium tyrobutyricum. Biotechnol. Progr. 28,

229 Zhao, J. and Yang, S.T., Evolution of solvent-producing Clostridium beijerinckii toward high butanol tolerance. ACS 238th Annual Meeting (BIOT 305). Zhao, J., Lu, C., Chen, C.C., Yang, S.T., Biological production of butanol and higher alcohols. Bioprocessing Technologies in Biorefinery for Sustainable Production of Fuels, Chemicals, and Polymers. Wiley, Chapter 13, pp Zhou, X., Lu, X. H., Li, X. H., Xin, Z. J., Xie, J. R., Zhao, M. R., Wang, L., Du, W.Y. Liang, J. P., Radiation induces acid tolerance of Clostridium tyrobutyricum and enhances bioproduction of butyric acid through a metabolic switch. Biotechnol. Biofuels. 7, Zhu, Y., Liu, X., Yang, S. T., Construction and characterization of pta gene deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotechnol. Bioeng. 90,

230 Appendix A: Thl-bs2 gene sequence 213

231 Appendix B: In-Fusion HD Cloning Kit User Manual Figure B.1 In-Fusion HD Protocol Overview. 214

232 Figure B.2 Universal primer design for the In-Fusion System.Successful insertion of a PCR fragment requires that the PCR insert share 15 bases of homology with the ends of the linearized vector. This sequence homology is added to the insert through the PCR primers. For vectors with sticky ends, bases complementary to 5 overhangs are included in the primer sequence; bases in the 3 overhangs are not. See Figure 3 for specific examples. An online tool is also provided to assist in primer design and can be found at 215