High-Yield and High-Titer n-butanol Production from Lignocellulosic Feedstocks by Metabolically Engineered Clostridium tyrobutyricum

Transcription

1 High-Yield and High-Titer n-butanol Production from Lignocellulosic Feedstocks by Metabolically Engineered Clostridium tyrobutyricum DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Yinming Du, M.S. Graduate Program in Chemical and Biomolecular Engineering The Ohio State University 2013 Dissertation Committee: Professor Shang-Tian Yang, Advisor Professor Jeffrey Chalmers Professor Andre Palmer Professor Thomas Mitchell

2 Copyright by Yinming Du 2013

3 Abstract Due to growing concerns over global warming issues, rapid depletion of crude oils, a hike in gasoline prices, as well as increasing demand on domestic energy security, the development of liquid fuels from abundant, renewable, and inexpensive raw materials has become more and more attractive. Butanol, a four carbon alcohol, is now considered as an excellent alternative transportation fuel to replace petroleum-based gasoline because its properties are very similar to gasoline. Traditionally, butanol is produced via acetonebutanol-ethanol (ABE) fermentation by solventogenic clostridia, which usually suffers from low butanol titer due to low butanol tolerance, low butanol yield due to acetone generation, as well as high substrate cost due to expensive raw materials. Clostridium tyrobutyricum is a gram-positive, rod-shaped, spore-forming, and strictly anaerobic bacterium that can utilize both hexose and pentose such as glucose and xylose for cell growth and metabolism. Recently, it has been demonstrated that C. tyrobutyricum could be an excellent host for heterologous butanol production, which can be easily realized via overexpressing aldehyde/alcohol dehydrogenase (adhe or adhe2). In fact, a highly efficient butanol synthesis pathway is expected in adhe/adhe2-overexpressing mutants because C. tyrobutyricum has a favorable carbon flux from glucose to butyryl- CoA. In addition, high butanol yield is expected in these mutants because C. tyrobutyricum does not produce acetone naturally and butanol is supposed to be the only solvent product. Moreover, previous studies have confirmed that C. tyrobutyricum has a higher butanol tolerance (20.0 g/l with adaptation) than native solventogenic clostridia, ii

4 which normally cannot survive with 15.0 g/l butanol. Most importantly, heterologous butanol synthesis in C. tyrobutyricum is less likely to involve in some key cellular events such as sporulation, cell autolysis, and metabolic shift that have greatly obstructed ABE production in solventogenic clostridia. In this study, the fermentation performances between adhe and adhe2 over-expressing C. tyrobutyricum mutants were first evaluated. Compared to adhe2 over-expressing mutant, which can produce nearly 10.0 g/l butanol from glucose, an extremely low butanol titer (100 mg/l) was obtained in adhe over-expressing mutant, which might be resulted from the fundamental differences between adhe and adhe2 genes. It was confirmed that for heterologous butanol production in C. tyrobutyricum, adhe is not as effective as adhe2. In order to improve butanol production in CtΔack-adhE2 mutant, NADH driving forces through the use of artificial electron carriers including methyl viologen (MV) and benzyl viologen (BV) were created to divert the native electron flow and redirect more carbon flux towards the butanol synthesis pathway. Remarkable improvements in butanol titer (from 3.27 g/l to g/l), butanol yield (from 0.10 g/g to 0.28 g/g), and solvents/acids ratio (from 0.5 mol/mol to 7.4 mol/mol) accompanied with a sharp decline in acetate and butyrate production (from 3.31 g/l to 0.48 g/l and from 6.00 g/l to 1.47 g/l, respectively) were achieved. Metabolic flux analysis revealed that butanol production was consistent with NADH availability; higher NADH flux induced more butanol biosynthesis whereas less butanol was generated at lower NADH flux, confirming that NADH/NAD + ratio plays an essential role in butanol biosynthesis. Artificial electron carriers, however, showed a significant inhibition impact on cell growth, resulting in a lower specific growth rate and a longer lag phase in the presence of MV or BV. iii

5 Corn steep liquor (CSL), a cheap but superior complex nutritional source, was used as a substitute to expensive nitrogen sources in traditional clostridium growth medium (CGM) for enhanced butanol production by C. tyrobutyricum mutant. A higher butanol titer (15.90 g/l vs g/l), yield (0.33 g/g vs g/g), and productivity (0.40 g/l/h vs g/l/h) was successfully achieved in CSL medium than in CGM medium in free-cell fermentation in the presence of 500 μm MV. In addition, it was confirmed that corn steep liquor could not only stimulate cell growth and support high cell density by providing rich nitrogen nutrients, but also increase cell viability, facilitate cell survival, and thus improve fermentation performance by removing inhibitory compounds derived from lignocellulosic materials in the production medium. Adaptation and evolution in a fibrous-bed bioreactor (FBB) with a repeated-batch fermentation strategy was successfully applied to achieve butanol production with a very high titer (~20.0 g/l), yield (~0.35 g/g), and productivity (~0.40 g/l/h) in C. tyrobutyricum mutant from glucose, xylose, glucose-xylose mixture, and various cellulosic and lignocellulosic feedstocks. A steady increase in butanol titer from 14.0 g/l to 20.0 g/l with a consistent butanol productivity (~0.35 g/l/h) and yield (~0.30 g/g) was obtained during the repeated-batch fermentation using glucose as a substrate, providing a stable and reliable long-term performance for over 1,000 hours. In addition, simultaneous consumption of glucose and xylose with high substrate utilization efficiency was observed during the immobilized-cell fermentation in the FBB with glucose and xylose as co-substrates, although the consumption rate of xylose was highly dependent on glucose/xylose ratio. Moreover, compared to free-cell fermentations, higher butanol titers (20.0 g/l vs g/l) and productivities (0.35 g/l/h vs g/l/h) were achieved in the iv

6 FBB, which further confirmed that the FBB could support high cell density, enhance cell viability, and facilitate the achievement of high cell tolerance to toxic metabolites including butanol. Fed-batch fermentation integrated with gas stripping was employed to alleviate butanolinduced inhibition and further improve butanol production via in situ butanol recovery. A continuous butanol production for over 300 hours with a final total butanol titer over 60.0 g/l and a yield nearly 0.35 g/g was successfully achieved in this integrated process. In addition, by combining NADH driving forces, butanol became the only leading product with extremely low accumulation of ethanol and acetate (<0.50 g/l), which can greatly facilitate butanol recovery from fermentation broth. A prolonged stationary phase with a stable cell density was also observed after gas stripping started due to an efficient control on butanol titer (<10.0 g/l) in the culture broth, which minimized product inhibition on cell proliferation. Moreover, this integrated fermentation-gas stripping process was stable and the butanol yield from glucose consumed was almost constant during the extended fermentation period. Finally, the hydrolysates of some cellulosic and lignocellulosic materials including cassava bagasse (CBH), Jerusalem artichoke (JAH), cotton stalk (CSH), sugarcane bagasse (SBH), soybean hull (SHH), and corn fiber (CFH) were considered as alternative feedstocks for high-titer, high-yield, and cost-effective butanol production by C. tyrobutyricum mutant in both free-cell and immobilized-cell fermentations. In the repeated-batch fermentation using CBH or CSH as a substrate, a stable butanol production with a high titer >15.0 g/l, yield >0.30 g/g, and productivity >0.30 g/l/h comparable to those from the control with glucose as substrate was achieved. v

7 Simultaneous consumption of glucose and xylose was also observed during the repeatedbatch fermentation with SBH, SHH, or CFH as a substrate, achieving a high substrate utilization efficiency. However, it should be noted that distinct fermentation performances with significant variations in butanol titer, yield, and productivity were observed in both free-cell and immobilized-cell fermentations when different biomass hydrolysates were used as feeding substrates, which might be caused by the fact that various compounds with significantly different concentrations were released during the pretreatment and hydrolysis processes of these materials. In particular, fermentable sugars including glucose and xylose and various inhibitory chemicals such as ferulic acid and p-coumaric acid presented profound impacts on cell growth, metabolism, and fermentation profiles. Nevertheless, this is the first report on high-titer, high-yield, and cost-effective butanol production from abundant, renewable, and inexpensive raw materials via a heterologous butanol production platform in C. tyrobutyricum, which provides a very promising strategy for economic production of advanced liquid fuels as gasoline substitutes. vi

8 Dedication Dedicated to my wife: Xilian Ouyang my parents: Shuxin Du and Cuilan Yu and my brother: Yincheng Du vii

9 Acknowledgements First, I would like to give my great appreciation to my advisor, Dr. Shang-Tian Yang, for his inspiring suggestions, substantial help, continuous encouragement, and financial support on my doctoral dissertation research. I am very grateful to have an opportunity to work in Dr. Yang s lab, where I have improved professional expertise, expanded technical knowledge, strengthened teamwork ability, and enhanced communication and presentation skills. Dr. Yang also offered me considerable flexibility on my research work so that I could make significant progresses. Most importantly, every time when I was confused and frustrated on my experimental results, Dr. Yang always provided me very insightful advices, which enabled me to understand the issues more deeply and clearly and to solve the problems more quickly and smoothly. Dr. Yang is very nice and gentle. I have learned and benefited tremendously from him, both in academia and in life. I would also like to thank Dr. Jeffrey Chalmers, Dr. Andre Palmer, and Dr. Thomas Mitchell for serving on my dissertation committee, as well as their very valuable and insightful suggestions and recommendations on my research work. My special thanks go to Dr. Mingrui Yu, Dr. Jingbo Zhao, and Dr. Wei-Lun Chang. Dr. Yu taught me a lot of basic operations and essential knowledge in metabolic engineering, genetic modifications, and anaerobic culture during the initial period of my Ph.D. study. Dr. Chang helped me a lot in setting up experiments of free-cell fermentation, fibrousbed bioreactor, immobilized-cell fermentation, fed-batch fermentation, and gas stripping. Dr. Zhao gave me a lot of very useful and insightful suggestions on improving viii

10 fermentation performances and analyzing samples. I would also like to thank all the previous and current labmates, especially Dr. Xiaoguang Liu, Dr. Chuang Xue, Dr. Kun Zhang, Dr. Ru Zang, Dr. Yipin Zhou, Dr. Ying Jin, Dr. Chih-Chin Chen, Milky Agarwal, Saju Varghese, Zhongqiang Wang, Ehab Ammar, Meimei Liu, Wenyan Jiang, and Jie Dong. Financial support from the Graduate School of The Ohio State University, National Science Foundation STTR program, and U.S. Department of Energy ARPA-E program is acknowledged. Finally, I would like to give my special thanks to my wife, Xilian Ouyang, and my parents, Mr. Shuxin Du and Ms. Cuilan Yu, for their enormous support, encouragement, and love in my life. ix

11 Vita June 2001 Xuancheng Senior High September 2001-June 2005 B.S. Fine Chemical Technology, Dalian University of Technology September 2005-June 2007 M.S. Microbial and Biochemical Pharmacy, Zhejiang University July 2007-July Research Associate, National Laboratory of Secondary Resources September 2009-August 2010 Distinguished University Fellowship, The Ohio State University September 2010-August 2012 Graduate Fellow, The Ohio State University September 2012-August 2013 Distinguished University Fellowship, The Ohio State University Publications Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, x

12 gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol 93: Huang J, Du Y, Xu G, Zhang H, Zhu F, Huang L, Xu Z High yield and costeffective production of poly (γ-glutamic acid) in Bacillus subtilis. Eng Life Sci 11: Wu X, Tang L, Du Y, Xu Z Improving glutathione extraction from crude yeast extracts by optimizing aqueous two-phase system composition and operation conditions. Korean J Chem Eng 27: Xu Z, Du Y, Zhang B, Lu Z, Cai J Method for coupling production of Gammapolyglutamic acid by technologies of microbial fermentation and membrane separation. Zhejiang University. Sep. 23, 2009: CN China Patent. Fields of Study Major Field: Chemical and Biomolecular Engineering xi

13 Table of Contents Abstract... ii Dedication... vii Acknowledgements... viii Vita... x Table of Contents... xii List of Tables... xx List of Figures... xxiii Chapter 1: Introduction Project objectives and specific tasks Significance and major impacts References Chapter 2: Literature review Biofuels and biobutanol Butanol production via acetone-butanol-ethanol (ABE) fermentation in solventogenic clostridia Alternative butanol production platforms in heterologous bacteria C. tyrobutyricum and butanol synthesis in C. tyrobutyricum Enhanced butanol production by NADH driving forces Strategies to overcome butanol-induced inhibition Adaptation and evolution in fibrous-bed bioreactor (FBB) xii

14 2.8 Butanol production from alternative feedstocks References Chapter 3: Metabolic engineering of Clostridium tyrobutyricum for enhanced butanol synthesis Introduction Materials and methods Bacterial strain and media Plasmids construction Plasmids transformation Isolation of single knockout mutants Fermentation kinetics in serum bottles Analytical methods Results and discussion Heterologous expression of adhe gene in C. tyrobutyricum Knockout of acetate and butyrate synthesis pathways in C. tyrobutyricum Conclusion References Chapter 4: High-yield and high-titer n-butanol production in Clostridium tyrobutyricum with external driving forces Introduction Materials and methods Bacterial strain and media Effects of methyl viologen or benzyl viologen xiii

15 4.2.3 Effects of nitrogen source Effects of gene inactivation Effects of ph Metabolic flux analysis Fed-batch fermentation with in situ gas stripping Analytical methods Results Effects of methyl viologen on fermentation kinetics Effects of benzyl viologen on fermentation kinetics Effects of nitrogen source Effects of gene inactivation Effects of ph on fermentation kinetics without methyl viologen Effects of ph on fermentation kinetics in the presence of 500 μm methyl viologen Metabolic flux analysis for effects of methyl viologen Metabolic flux analysis for effects of ph with and without methyl viologen addition Fed-batch fermentation with gas stripping Discussion Conclusion References Chapter 5: n-butanol production from glucose and xylose by engineered Clostridium tyrobutyricum in a fibrous-bed bioreactor xiv

16 5.1 Introduction Materials and Methods Strain and culture conditions Effects of methyl viologen or benzyl viologen Free-cell fermentation Immobilized-cell fermentation in FBB Fed-batch fermentation with in situ gas stripping Scanning electron microscopy Analytical methods Results and Discussion Effects of artificial electron carriers Effects of methyl viologen Effects of benzyl viologen Comparison of effects of artificial electron carriers in CGM and CSL medium Free-cell fermentation Butanol production from glucose Butanol production from xylose Immobilized-cell fermentation Butanol production from glucose Butanol production from xylose Butanol production from glucose-xylose mixture Scanning electron microscopy of immobilized cells in FBB xv

17 Fed-batch fermentation with gas stripping for in situ butanol recovery Conclusion References Chapter 6: High-titer and high-yield butanol production from lignocellulosic feedstocks by engineered Clostridium tyrobutyricum Introduction Materials and methods Pretreatment and enzymatic hydrolysis of cellulosic materials Pretreatment and enzymatic hydrolysis of lignocellulosic materials Bacterial strain and culture conditions Effects of methyl viologen Immobilized-cell fermentation in FBB Analytical methods Results Effects of methyl viologen with cellulosic biomass hydrolysates as substrates Effects of methyl viologen on fermentation kinetics using cassava bagasse hydrolysate (CBH) as a substrate Effects of methyl viologen on fermentation kinetics using Jerusalem artichoke hydrolysate (JAH) as a substrate Fermentation kinetics of CtΔack-adhE2 mutant with CBH or JAH as a substrate in the presence of 500 μm MV xvi

18 6.3.2 Effects of methyl viologen with lignocellulosic biomass hydrolysates as substrates Effects of methyl viologen on fermentation kinetics using cotton stalk hydrolysate (CSH) as a substrate Effects of methyl viologen on fermentation kinetics using sugarcane bagasse hydrolysate (SBH) as a substrate Effects of methyl viologen on fermentation kinetics using soybean hull hydrolysate (SHH) as a substrate Effects of methyl viologen on fermentation kinetics using corn fiber hydrolysate (CFH) as a substrate Fermentation kinetics of CtΔack-adhE2 mutant with CSH, SBH, SHH, or CFH as a substrate in the presence of 250 μm MV Comparison of MV effects in glucose, CBH, JAH, CSH, SBH, SHH, and CFH fermentations Immobilized-cell fermentation in FBB Butanol production from cassava bagasse hydrolysate (CBH) in FBB Butanol production from lignocellulosic biomass hydrolysates in FBB Discussion Conclusion References Chapter 7: Conclusions and Recommendations Conclusions Recommendations xvii

19 7.3 References Bibliography Appendix A: Gene sequences A.1 Gene adhe sequence A.2 Gene adhe2 sequence Appendix B: Gas chromatography (GC) and high performance liquid chromatography (HPLC) diagrams B.1 GC standard diagram B.2 GC sample diagrams without and with methyl viologen or benzyl viologen B.3 GC sample diagrams for free-cell and immobilized-cell fermentation in the presence of 25 μm benzyl viologen B.4 GC sample diagrams for fed-batch fermentation integrated with gas tripping in clostridium growth medium (CGM) and corn steep liquor medium (CSL) B.5 GC sample diagrams for immobilized-cell fermentation in FBB using different biomass hydrolysates as substrates B.6 HPLC standard diagram B.7 HPLC sample diagrams for free-cell and immobilized-cell fermentations on glucose B.8 HPLC sample diagrams for free-cell and immobilized-cell fermentations on xylose B.9 HPLC sample diagrams for immobilized-cell fermentation using glucose and xylose mixture as a co-substrate Appendix C: Diagrams for experimental setup xviii

20 C.1 Diagram for experimental setup of free-cell fermentation C.2 Diagrams for experimental setup of repeated-batch fermentation in FBB C.3 Diagram for experimental setup of fed-batch fermentation integrated with gas stripping xix

21 List of Tables Table 2.1 Properties and comparison of butanol, ethanol, and gasoline 80 Table 2.2 Heterologous expression of clostridial butanol pathway in various alternative platforms 81 Table 2.3 Enhanced ABE or IBE production in an integrated fermentation and gas stripping process by various clostridial strains..82 Table 2.4 Major compositions of some typical cellulosic and lignocellulosic biomass 83 Table 2.5 ABE production from various renewable feedstocks by solventogenic clostridia.84 Table 3.1 Fermentation performance of various adhe over-expressed C. tyrobutyricum wild type and ack knockout mutants 114 Table 3.2 Heterologous expression of clostridial butanol pathway in various alternative platforms..115 Table 3.3 Fermentation performance of various C. tyrobutyricum mutants with single knockout of ack, pta, or ptb genes Table 4.1 Effects of methyl viologen on fermentation kinetics of C. tyrobutyricum CtΔack -adhe2 grown on glucose in serum bottles at 37 o C and ~ph Table 4.2 Effects of benzyl viologen on fermentation kinetics of C. tyrobutyricum CtΔack -adhe2 grown on glucose in serum bottles at 37 o C and ~ph Table 4.3 Effects of nitrogen source concentration on fermentation kinetics of CTΔackadhE2 mutant grown on CGM medium supplemented with 500 μm methyl viologen in serum bottles 155 Table 4.4 Effects of methyl viologen on fermentation kinetics of CTWT-adhE2 mutant grown on glucose in serum bottles at 37 o C and ~ph Table 4.5 Effects of methyl viologen on fermentation kinetics of CtΔptb-adhE2 mutant grown on glucose in serum bottles at 37 o C and ~ph Table 4.6 Fermentation performance of CTΔack-adhE2, CTΔptb-adhE2, and CTWTadhE2 mutants in response to different concentrations of methyl viologen grown on glucose.158 xx

22 Table 4.7 Effects of ph and methyl viologen on fermentation kinetics of C. tyrobutyricum CtΔack -adhe2 grown on glucose in bioreactor at 37 o C. The product yields were calculated based on the available data for each culture condition 159 Table 4.8 Metabolic pathway stoichiometric equations used in metabolic flux analysis for glucose fermentation by CtΔack-adhE Table 5.1 Effect of methyl viologen concentration on fermentation kinetics of CTΔackadhE2 mutant in CSL medium with glucose as a substrate 205 Table 5.2 Effect of benzyl viologen concentration on fermentation kinetics of CTΔackadhE2 mutant in CSL medium with glucose as a substrate 206 Table 5.3 Comparison of specific growth rate, solvents/acids ratio, as well as metabolites accumulation using glucose or xylose as a substrate in CSL medium with or without artificial electron carriers.207 Table 6.1 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with cassava bagasse hydrolysate (CBH) as a substrate in serum bottles 257 Table 6.2 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with Jerusalem artichoke hydrolysate (JAH) as a substrate in serum bottles 258 Table 6.3 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with cotton stalk hydrolysate (CSH) as a substrate in serum bottles Table 6.4 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with sugarcane bagasse hydrolysate (SBH) as a substrate in serum bottles 260 Table 6.5 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with soybean hull hydrolysate (SHH) as a substrate in serum bottles 261 Table 6.6 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with corn fiber hydrolysate (CFH) as a substrate in serum bottles..262 Table 6.7 Comparison of some key parameters including butanol titer, butanol yield, specific growth rate, and solvents/acids ratio of CtΔack-adhE2 mutant in response to methyl viologen in CSL medium with various substrates including glucose, CBH, JAH, CSH, SBH, SHH, and CFH.263 Table 6.8 Detection and comparison of various inhibitory compounds presented in various biomass hydrolysates after pretreatment, enzymatic hydrolysis, centrifuge, xxi

23 evaporating concentration, and being sterilized together with CSL (FF, furfural; HMF, hydroxymethylfurfural; FMA, formic acid; FLA, ferulic acid; LA, levulinic acid; p-ca, p-coumaric acid)..264 Table 6.9 Detection and comparison of various inhibitory compounds presented in various biomass hydrolysates after pretreatment, enzymatic hydrolysis, centrifuge, and evaporating concentration (FF, furfural; HMF, hydroxymethylfurfural; FMA, formic acid; FLA, ferulic acid; LA, levulinic acid; p-ca, p-coumaric acid) xxii

24 List of Figures Figure 1.1 Overview of the project objective and specific tasks for this study 23 Figure 2.1 Typical metabolic pathways of glucose in solventogenic clostridia 85 Figure 2.2 Metabolic pathways of glucose in wide type C. tyrobutyricum (PTA, phosphotransacetylase; AK, acetate kinase; PTB, phosphotransbutyrylase; BK, butyrate kinase) 86 Figure 2.3 Putative metabolic pathways of glucose in C. tyrobutyricum mutant with overexpression of clostridial butanol pathway and disruption of acetate and butyrate synthesis pathways Figure 2.4 Modular shuttle plasmids for clostridium-e. coli and modular ClosTron plasmids for gene manipulation within clostridium Figure 2.5 Construction of a FBB system and SEM pictures for cell immobilization on the fibrous matrices 89 Figure 3.1 Construction of recombinant plasmid pmtl82151-thl-adhe (p82ta1) for heterologous butanol synthesis in C. tyrobutyricum 117 Figure 3.2 Enzyme digestion confirmation and colony PCR verification of adhe gene, thl gene, plasmid pmtl82151-adhe and insertion of thl gene (A: Lane 1-2, adhe gene, Lane 3, 1kb marker; B: Lane 1, 1kb marker, Lane 2, plasmid pmtl82151-adhe, Lane 3, thl gene; C: Lane 1 and Lane 12, 1kb marker, Lane 2, negative control, Lane 3, positive control, Lane 4-11, thl gene) 118 Figure 3.3 Construction of plasmid pmtl82151-thl-adhe-2 (p82ta2) by removing adhe2 gene from plasmid pmad22 and directly inserting PCR-amplified adhe gene in the in-fusion cloning system 119 Figure 3.4 Colony PCR confirmation of p82ta2 construction and transformation (A: Lane 1, 1kb marker, Lane 2-3, negative control, Lane 4, positive control, Lane 5-14, adhe gene; B: Lane 1, 1kb marker, Lane 2-3, negative control, Lane 4, positive control, Lane 5-12, adhe gene).120 Figure 4.1 Experimental setup to integrate fed-batch fermentation in a fibrous-bed bioreactor with gas stripping for continuous butanol production and recovery.161 Figure 4.2 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown on CGM medium in serum bottles (A, glucose consumption; B, cell optical xxiii

25 density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production) Figure 4.3 Effects of benzyl viologen (BV) on fermentation kinetics of CtΔack-adhE2 mutant grown on CGM medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production)..163 Figure 4.4 Effect of nitrogen source concentration on fermentation kinetics of CTΔackadhE2 mutant grown on CGM medium supplemented with 500 μm methyl viologen in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production) 164 Figure 4.5 Effects of methyl viologen (MV) on fermentation kinetics of CTWT-adhE2 mutant grown on CGM medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production) Figure 4.6 Effects of methyl viologen (MV) on fermentation kinetics of CtΔptb-adhE2 mutant grown on CGM medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production)..166 Figure 4.7 Effects of ph on fermentation kinetics of CtΔack-adhE2 mutant grown on CGM medium in a bench-scale stirred-tank bioreactor (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production)..167 Figure 4.8 Effects of ph on fermentation kinetics of CtΔack-adhE2 mutant grown on CGM medium supplemented with 500 μm methyl viologen in a bench-scale stirred-tank bioreactor (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production)..168 Figure 4.9 Metabolic flux analysis for effects of methyl viologen concentration on each key node involved in the metabolic pathways (see Figure 4.10 for metabolic pathways and supplemental material for pathway stoichiometry) Figure 4.10 Metabolic pathways and flux analysis of glucose fermentation by CtΔackadhE2 mutant (A. Metabolic pathways; B. Metabolic flux distributions as affected by ph and methyl viologen) Figure 4.11 Fermentation performance of CtΔack-adhE2 mutant grown on CGM medium supplemented with 500 M methyl viologen and integrated with in situ butanol removal by gas-stripping at ph 6.0 (A, fermentation kinetics; B, product profiles in terms of glucose consumption)..171 Figure 4.12 Fermentation performance of CtΔack-adhE2 mutant grown on glucose supplemented with 500 μm methyl viologen at ph 6.0 in an integrated FBB-gas stripping xxiv

26 process (A, fermentation kinetics; B, product profiles in terms of glucose consumption) 172 Figure 5.1 Experimental setup for repeated-batch fermentation in a fibrous-bed bioreactor for butanol production from glucose, xylose, and glucose-xylose mixture by C. tyrobutyricum-adhe2 mutant Figure 5.2 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown on CSL medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production) Figure 5.3 Effects of benzyl viologen (BV) on fermentation kinetics of CtΔack-adhE2 mutant grown on CSL medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production) Figure 5.4 Comparison of butanol titer, butanol yield, specific growth rate, and solvents/acids ratio by CtΔack-adhE2 mutant in response to methyl viologen grown on glucose in CGM and CSL medium (A, butanol titer; B, butanol yield; C, specific growth rate; D, solvents/acids ratio) 211 Figure 5.5 Comparison of butanol titer, butanol yield, specific growth rate, and solvents/acids ratio by CtΔack-adhE2 mutant in response to benzyl viologen grown on glucose in CGM and CSL medium (A, butanol titer; B, butanol yield; C, specific growth rate; D, solvents/acids ratio) 212 Figure 5.6 Fermentation kinetics for free-cell fermentation of CtΔack-adhE2 mutant grown in CSL medium using glucose as a substrate in the presence of artificial electron carriers (A, no MV or BV; B, 500 μm MV; C, 25 μm BV) 213 Figure 5.7 Fermentation kinetics for free-cell fermentation of CtΔack-adhE2 mutant grown in CSL medium using xylose as a substrate in the presence of artificial electron carriers (A, no MV or BV; B, 10 μm BV) Figure 5.8 Fermentation kinetics for immobilized-cell fermentation with a repeated-batch model in FBB of CtΔack-adhE2 mutant grown in CSL medium using glucose as a substrate in the presence of artificial electron carriers (RBs 1-9, 500 μm MV; RBs 10-13, 25 μm BV) (A, fermentation kinetics; B, comparison of butanol productivity and yield within each repeated batch).215 Figure 5.9 Fermentation kinetics for immobilized-cell fermentation with a repeated-batch model in FBB of CtΔack-adhE2 mutant grown in CSL medium using xylose as a substrate in the presence of artificial electron carriers with or without cysteine (BV concentration: 1 μm BV in RB1, 2 μm BV in RB2, 4 μm BV in RB3, 5 μm BV in RB4, and 10 μm BV in RB5-8; RBs 1-5, no cysteine; RBs 6-8, 0.5 g/l cysteine) (A, fermentation kinetics; B, comparison of butanol productivity and yield within each repeated batch).216 xxv

27 Figure 5.10 Fermentation kinetics for immobilized-cell fermentation with a repeatedbatch model in FBB of CtΔack-adhE2 mutant grown in CSL medium using glucosexylose mixture as a co-substrate in the presence of artificial electron carriers with different G/X ratios (BV concentration: from RB1 to RB4, 0, 5, 10, and 20 μm BV, respectively, RBs 5-9, 25 μm BV; G/X ratio: RBs 1-6, G/X=1; RB7, G/X=2; RB8, G/X=4; RB9, G/X=1/2) (A, fermentation kinetics; B, comparison of butanol productivity and yield within each repeated batch)..217 Figure 5.11 Scanning electron microscopy of immobilized cells in FBB with different magnifications (A, 10 μm; B, 20 μm; C, 50 μm).218 Figure 5.12 Fermentation performance of CtΔack-adhE2 mutant grown in CSL medium using glucose as a substrate supplemented with 500 μm methyl viologen at ph 6.0 in an integrated fed-batch fermentation and gas stripping process (A, fermentation kinetics; B, product profiles based on glucose consumption).219 Figure 6.1 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using cassava bagasse hydrolysate (CBH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production) 266 Figure 6.2 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using Jerusalem artichoke hydrolysate (JAH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production) Figure 6.3 Fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium in serum bottles in the presence of 500 μm methyl viologen using cassava bagasse hydrolysate (CBH) or Jerusalem artichoke hydrolysate (JAH) as a substrate (A, CBH; B, JAH) 268 Figure 6.4 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using cotton stalk hydrolysate (CSH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production)..269 Figure 6.5 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using sugarcane bagasse hydrolysate (SBH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production)..270 Figure 6.6 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using soybean hull hydrolysate (SHH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production)..271 xxvi

28 Figure 6.7 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using corn fiber hydrolysate (CFH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production) Figure 6.8 Fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium in serum bottles in the presence of 250 μm methyl viologen using cotton stalk hydrolysate (CSH), sugarcane bagasse hydrolysate (SBH), soybean hull hydrolysate (SHH), or corn fiber hydrolysate (CFH) as a substrate (A, CSH; B, SBH; C, SHH; D, CFH) 273 Figure 6.9 Fermentation kinetics for immobilized-cell fermentation with a repeated-batch model in FBB of CtΔack-adhE2 mutant grown in CSL medium using cassava bagasse hydrolysate (CBH) as a substrate in the presence of artificial electron carriers (RB1, glucose as a control; RB 2-7, CBH as a substrate; RB 1-2, MV500; RB 3-5, MV250; RB 6-7, BV25) (A, fermentation kinetics; B, comparison of butanol productivity and yield within each repeated batch).275 Figure 6.10 Fermentation kinetics for immobilized-cell fermentation with a repeatedbatch model in FBB of CtΔack-adhE2 mutant grown in CSL medium using various lignocellulosic feedstocks as substrates including cotton stalk hydrolysate (CSH), sugarcane bagasse hydrolysate (SBH), soybean hull hydrolysate (SHH), or corn fiber hydrolysate (CFH) in the presence of artificial electron carriers (RB1: xylose as a control, BV10; RB2: CSH, MV250; RB3: CSH, BV250; RB4: SBH, MV250; RB5: SBH, BV25; RB6: SHH, MV250; RB7: SHH, BV25; RB8: CFH, MV250; RB9: CFH, BV25) (A, fermentation kinetics; B, comparison of butanol productivity and yield within each repeated batch).276 Figure B.1 GC standard diagram for analysis of acetone, ethanol, butanol, acetic acid, and butyric acid using isobutanol and isobutyric acid as inner standard (10.0 g/l for each chemical, samples were diluted by 20-fold) 316 Figure B.2 GC diagrams for analysis of samples without and with MV1000. Samples were taken at the same time and diluted by 20-fold. (A, without MV; B, with MV1000; C, BV50)..317 Figure B.3 GC diagrams for samples analysis in free-cell and immobilized-cell fermentation in the presence of 25 μm benzyl viologen. Samples were diluted by 20-fold (A, free-cell fermentation; B, Immobilized-cell fermentation)..318 Figure B.4 GC diagrams for samples analysis of butanol condensate recovered by gas stripping in an integrated fed-batch fermentation and gas stripping process in CGM or CSL medium. Samples were diluted by 200-fold (A, CGM medium; B, CSL medium) Figure B.5 GC diagrams for samples analysis in immobilized-cell fermentations in FBB using biomass hydrolysates as substrates. Samples were diluted by 20-fold (A, Cassava bagasse; B, Jerusalem artichoke; C, Cotton stalk; D, Sugarcane bagasse; E, Soybean hull; F, Corn fiber) xxvii

29 Figure B.6 HPLC standard diagram for analysis of glucose, xylose, lactate, ethanol, butanol, acetic acid, and butyric acid (2.0 g/l for each chemical)..323 Figure B.7 HPLC diagrams for sample analysis of free-cell and immobilized-cell fermentations grown on glucose (A, initial sample; B, free-cell fermentation; C, immobilized-cell fermentation) Figure B.8 HPLC diagrams for sample analysis of free-cell and immobilized-cell fermentations grown on xylose (A, initial sample; B, free-cell fermentation; C, immobilized-cell fermentation) Figure B.9 HPLC diagrams for sample analysis of immobilized-cell fermentation in FBB using glucose and xylose mixture as a co-substrate (A, initial sample; B, end sample).326 Figure C.1 Diagram for experimental setup of free-cell fermentation 327 Figure C.2 Diagrams for experimental setup of repeated-batch fermentation in FBB (A, an overview of the whole process; B, a close look of the FBB)..328 Figure C.3 Diagram for experimental setup of fed-batch fermentation integrated with gas stripping xxviii

30 Chapter 1: Introduction Due to growing concerns over global warming issues, rapid depletion of crude oils, a hike in gasoline prices, as well as increasing demand on domestic energy security, the development of biofuels from abundant, renewable, and sustainable biological materials has become more and more important and attractive [Durre, 2007]. First generation biofuels are derived from food crops, mainly sugarcane and cereal grains, which have a potential to compete with food supply, cause food shortages, and increase food prices [Kumar and Gayen, 2011]. In addition, limited cropland is another issue that may obstruct the development of biofuels from food crops [Searchinger et al., 2008]. As alternative feedstock, lignocellulosic biomass, such as agricultural, industrial, forest, and wood waste residues, is the most promising substrate for biofuels production because they are plentiful, cheap, widely available, and non-edible materials [Buschke et al., 2011]. Bioethanol is now widely used as an additive in gasoline in a couple of countries, including United States and Brazil. However, various concerns such as the sourcing of feedstocks, carbon balance, land use and competition with food crops exist [Naik et al., 2010]. The utilization of bioethanol might also be incompatible with current petroleum refining, fuel distribution, refueling, and motor vehicle infrastructure [Cascone, 2008]. Butanol, an important industrial chemical and solvent, is now considered as a superior transportation fuel over bioethanol because the properties of butanol are very similar to those of gasoline, including heating value, energy density, and octane numbers. In 1

31 addition, compared to bioethanol, biobutanol also presents some other advantages, such as convenient pipeline transportation in current petroleum infrastructures, blending with either gasoline or diesel fuel at any ratio, and low solubility in water [Cascone, 2008]. Actually, butanol can be directly used in traditional engines without any modification. Biobutanol production via acetone-butanol-ethanol (ABE) fermentation by solventogenic clostridia, including Clostridium acetobutylicum and Clostridium beijerinckii, was once the second largest industrial fermentation [Jones and Woods, 1986]. However, the biological process was gradually replaced by petrochemical routes during the 1950s due to the significant increase in substrate costs and remarkable developments in the petrochemical industry [Lee et al., 2008]. Recently, with a potential to replace gasoline, butanol production via fermentation has gained more and more interest because of the diminishing fossil reserves, increasing demand for green energy, as well as astonishing advances in biotechnology, bioengineering, and bioprocessing [Lee et al., 2008]. Tremendous efforts have been made to overcome poor solvent tolerance, improve butanol titer, yield, and productivity, decrease by-products accumulation, and reduce substrate costs at genetic, molecular, strain, and process levels [Lutke-Eversloh and Bahl, 2011]. However, solventogenic clostridia such as C. acetobutylicum and C. beijerinckii have a couple of inherent drawbacks that make them unfavorable hosts for butanol production, including low butanol yield due to acetone accumulation, low butanol titer and reactor productivity due to low butanol tolerance, and difficult genetic modifications due to complicated ABE metabolic pathways [Yu et al., 2011, Ezeji et al., 2010].The biggest problem is that the genetic regulation and metabolic shift from acidogenic phase (acetate and butyrate formation pathway) to solventogenic phase (ABE formation pathway) in 2

32 solventogenic clostridia is still not well understood, which has significantly increased the uncertainty in process control [Lee et al., 2008; Papoutsakis, 2008]. Heterologous expression of butanol synthesis pathway in other hosts, such as E. coli and yeast, might be a promising strategy to overcome these issues [Lutke-Eversloh and Bahl, 2011; Yu et al., 2011]. However, the efficiency is usually low and the mutants are very unstable due to the unpredicted disruption at genetic, molecular, and metabolic levels. Low butanol tolerance might be another problem for butanol synthesis in heterologous platforms [Fischer et al., 2008; Knoshaug and Zhang, 2009]. Clostridium tyrobutyricum is a gram-positive, rod-shaped, spore-forming, and strictly anaerobic bacterium, which can consume glucose and xylose to produce acetic acid, butyric acid, hydrogen, and carbon dioxide as its main products [Wu and Yang, 2003]. Recently, it has been considered as a suitable host for heterologous butanol production because the metabolic pathways in C. tyrobutyricum are very similar to those in solventogenic clostridia. Heterologous butanol synthesis in C. tyrobutyricum can be easily realized via the overexpression of aldehyde/alcohol dehydrogenase (adhe or adhe2) from C. acetobutylicum [Yu et al., 2011; Yu et al., 2012]. In addition, it has been demonstrated that C. tyrobutyricum has a favorable metabolic pathway from glucose to butyryl-coa, which would suggest a highly efficient butanol synthesis pathway in adhe/adhe2-overexpressing mutants [Zhu et al., 2004; Liu et al., 2006a, Yu et al., 2011]. Moreover, wild type C. tyrobutyricum does not produce acetone, indicating that butanol yield in the mutants could be high because butanol is expected to be the primary solvent product. Furthermore, previous studies have confirmed that C. tyrobutyricum has a high butanol tolerance, 15 g/l without adaptation and 20 g/l with adaptation, a superior 3

33 characteristic over solventogenic clostridia, which normally cannot survive at a butanol concentration of 15 g/l [Yu et al., 2011]. Most importantly, heterologous butanol production in C. tyrobutyricum is less likely to be involved in sporulation, cell autolysis, and metabolic shift between acidogenic and solventogenic phases, the major factors that could limit butanol production in native solventogenic clostridia [Ezeji et al., 2010]. Therefore, it is highly possible that high-yield and high-titer butanol production with a relatively simple process control and more stable and reliable production rate can be achieved via integrating a heterologous butanol synthesis pathway into C. tyrobutyricum. In order to confirm the butanol-producing ability of C. tyrobutyricum, aldehyde/alcohol dehydrogenase 2 (adhe2) from C. acetobutylicum ATCC824 was successfully introduced into C. tyrobutyricum, and a significant amount of butanol (~10.0 g/l) was produced in the adhe2-overexpressing mutants [Yu et al., 2011]. However, previous results have demonstrated that butanol yield in adhe2-overexpressed C. tyrobutyricum mutants was similar to or even lower than that in native solventogenic clostridia due to the fact that acetic and butyric acids were still generated as the major by-products in these mutants [Yu et al., 2012]. Knock-out of acetate and butyrate synthesis pathways in C. tyrobutyricum has a potential to improve butanol yield by directing more carbon flux towards butanol synthesis. It has been reported that inactivation of acetic acid formation route in C. tyrobutyricum could significantly improve butyric acid titer and yield whereas a lower butyrate concentration and B/A ratio (butyrate/acetate ratio) was obtained in the ptb/buk knockout mutants [Zhu et al., 2004; Liu et al., 2006b]. In addition, C. tyrobutyricum mutants with adhe2-overexpression and ack/pta or ptb/buk knockout presented a significantly higher butanol production than the control with only adhe2 gene 4

34 [Yu et al., 2011]. Unfortunately, the production of acetic and butyric acids in C. tyrobutyricum cannot be completely eliminated due to the presence of some unknown pathways that can synthesize acetate and butyrate instead of using ack/pta and ptb/buk pathways. Actually, considerable amounts of acetic and butyric acids are still generated as the main by-products in butanol-producing C. tyrobutyricum mutants, which could not only limit butanol production, but also increase the cost for butanol recovery. By investigating the metabolic pathways in adhe2-overexpressed C. tyrobutyricum mutants, it was noted that NADH availability should be a limiting step for butanol production because in order to make one molecule of butanol from glucose, a total of four NADH molecules are needed [Shen et al., 2011]. The metabolic reaction from glucose to pyruvate, however, can only generate two molecules of NADH [Peguin et al., 1994a]. In addition, it has been demonstrated that the expression of adhe2 gene is highly dependent on NADH level [Fontaine et al., 2002]. Therefore, providing more reducing power and thus increasing the availability of NADH should be a promising strategy to improve butanol production at the expense of acetate and butyrate by directing more carbon flux towards the biosynthesis pathway of butanol, the most reducing end-product in the metabolic network [Lutke-Eversloh and Bahl, 2011]. Various approaches have been applied to increase NADH availability via inhibiting the in vivo activity of hydrogenase, diverting electron flow from hydrogen generation to NADH accumulation, and maximizing metabolic flux towards more reduced products [Lutke-Eversloh and Bahl, 2011]. NADH driving forces usually include an increase in hydrogen partial pressure [Doremus et al., 1985; Yerushaimi and Volesky, 1985], carbon monoxide flushing [Datta and Zeikus, 1985; Meyer et al., 1986], the addition of artificial electron carriers [Kim and 5

35 Kim, 1988; Peguin et al., 1994a; Peguin and Soucaille, 1995, 1996; Rao and Mutharasan, 1986, 1987; Girbal et al., 1995], a limitation in iron concentration [Junelles et al., 1988; Peguin and Soucaille, 1995], as well as utilization of more reduced substrates such as glycerol and mannitol [Vasconcelos et al., 1994; Andrade and Vasconcelos, 2003; Yu et al., 2011]. Internal NADH driving forces based on enzyme mechanism or gene manipulation such as utilization of irreversible reaction, enzymatic kinetic control strategy, and overexpression of NAD + -dependent formate dehydrogenase have also been applied for enhanced butanol production [Nakayama et al. 2008; Berrios-Rivera et al., 2002; Nielsen et al., 2009; Shen et al., 2011; Bond-Watts et al., 2011]. Low butanol titer due to product inhibition is one of the most crucial challenges in fermentative butanol production [Nicolaou et al., 2010]. Actually, very few solventogenic clostridia can tolerate more than 15 g/l butanol [Liu and Qureshi, 2009; Kumar and Gayen, 2011]. Low butanol titer does not only result in low butanol yield and reactor productivity, but also significantly increase the cost for butanol recovery. It is estimated that the cost for butanol separation will be cut by 50% if the final butanol concentration can be pushed from 12 g/l to 19 g/l [Papoutsakis et al., 2005]. Considerable efforts have been made to overcome poor solvent resistance and improve butanol titer in solventogenic clostridia, including strain improvement and process development [Ezeji et al., 2010]. For strain improvement, directed and non-directed mutagenesis as well as genetic modifications such as overexpression or inactivation of specific genes associated with solvent tolerance have been widely used to develop hyper-butanol-tolerant mutants [Lee et al., 2008; Lutke-Eversloh and Bahl, 2011]. However, these mutants with high butanol tolerance and production ability are usually not very stable because butanol 6

36 synthesis is not a favorable cellular event for cell survival, ATP generation, and metabolic activities. Actually, a reduction in butanol tolerance and titer or an increase in acids generation or even a loss in butanol-producing ability was frequently observed in solventogenic clostridia mutants [Nicolaou et al., 2010]. In addition, the progress in butanol tolerance study has been limited by the complexity of cellular activities and insufficient knowledge about the genetic and metabolic regulations involved in solvent tolerance [Kumar and Gayen, 2011]. Adaptation and evolution in the fibrous-bed bioreactor (FBB) is another advanced fermentation strategy to improve solvent tolerance and butanol titer by following the principle of survival of the fittest in nature [Yang, 1996]. The highly porous fibrous matrix has large surface area and void volume to allow high densities of immobilized cells, which can facilitate the achievement of high cell tolerance to toxic metabolites, such as butanol [Yang, 1996]. In addition, the adapted cells are forced to contact with gradually increased butanol concentrations, which in turn could provide a selection pressure to drive the evolution towards higher butanol titers. Moreover, as a non-directed mutagenesis and evolution, it does not require extensive information at metabolic and physiological levels and is not dependent on available genetic modifications and functional knowledge. FBB technology has been successfully applied for enhanced production of various value-added chemicals and biofuels including propionic acid, butyric acid, and butanol with a remarkable increase in titer, yield and productivity [Huang et al., 2004; Zhu and Yang, 2003; Shim et al., 2002; Suwannakham and Yang, 2005, Jiang et al., 2009; Jiang et al., 2011; Huang et al., 2011; Wei et al., 2013, Wang and Yang, 2013]. However, the maintenance of the superior abilities such as high butanol 7

37 tolerance and butanol production rate of the mutants developed via adaptation and evolution is very difficult because they are very likely to lose their acquired abilities during subculture. Integration of fermentation and separation processes provides an effective strategy to alleviate butanol-induced inhibition via in situ butanol recovery, which can minimize the toxicity of butanol on cell proliferation [Ezeji et al., 2010; Kumar and Gayen, 2011]. Various separation techniques including adsorption, liquid-liquid extraction, perstraction, pervaporation, reverse osmosis, and gas stripping have been proposed and applied to facilitate butanol production and recovery by online butanol removal from fermentation broth [Zheng et al., 2009]. However, loss of nutrients and fermentation intermediate products, membrane fouling, complexity in operation, and high equipment investments are usually observed in the separation methods involving extra chemicals and materials such as adsorbents, extractants and membranes, making these processes not economically competitive [Ezeji et al., 2010; Kumar and Gayen, 2011]. Among these integrated processes, gas stripping is the most simple but an efficient technique to minimize butanol inhibition, improve fermentation performance, and facilitate butanol recovery without disrupting cell culture, nutrient supply, and intermediate product accumulation [Ezeji et al., 2010; Lee et al., 2008; Kumar and Gayen, 2011]. In addition, gas tripping also has a couple of advantages over other separation techniques, including easier operation, lower capital investment and energy input [Oudshoorn et al., 2009]. In fact, gas stripping has been widely used in batch, fed-batch, and continuous processes for ABE production by solventogenic clostridia [Ezeji et al., 2003; Ezeji et al., 2004a; Ezeji et al., 2004b; Ezeji et al., 2007; Ezeji et al., 2013; Lu et al., 2012; Xue et al., 2012; Xue et al., 2013]. 8

38 High substrate cost and the availability of raw materials is another big challenge in the development of biofuels [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. It has been estimated that the cost of raw materials accounts for more than 50% of the total production cost in ABE fermentation [Dürre, 2007; Garćia et al., 2011; Lu, 2011]. In addition to traditional substrates including sugarcane and cereal grains, the utilization of which has been criticized for causing food shortages and increasing food prices, lignocellulosic materials such as agricultural residues, woody biomass, and industrial and municipal wastes have recently been considered as alternative feedstocks because they are abundant, renewable, inexpensive, and widely available [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. Clostridium spp. are able to efficiently consume a variety of carbohydrates including simple and complex sugars such as pentose and hexose, an essential characteristic for economical production of biofuels from lignocellulosic materials [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. Actually, cost-effective butanol production from various biomass hydrolysates or industrial wastes including corn fiber, corn stover, corncob, wheat straw, switchgrass, cassava bagasse, rice bran, domestic organic waste (DOW), dried distiller s grains and soluble (DDGS), whey permeate, cane molasses, oil palm decanter cake, and sago pith residues has been extensively studied [Claassen et al., 2000; Lopez-contreras et al., 2000; Qureshi et al., 2010a; Qureshi et al., 2010b; Guo et al., 2013; Du et al., 2013; Zhang et al., 2013; Al-Shorgani et al., 2012; Ezeji and Blaschek, 2008; Wang et al., 2013; Razak et al., 2013; Survase et al., 2013; Raganati et al., 2013; Linggang et al., 2013; Li et al., 2013; Ni et al., 2012; Lu et al., 2012]. However, in order to get access to the cellulosic structures and release fermentable sugars, physical, chemical, or biological pretreatment and 9

39 enzymatic hydrolysis are usually required for the utilization of lignocellulosic materials as fermentation substrates. Pretreatment process does not only significantly contribute to the high cost in biofuels development, but also generate numerous inhibitory compounds such as furfural, furan, acetic, ferulic, glucuronic, p-coumaric acids, phenolic compounds, and aldehydes, which can severely affect cell growth and metabolism, substrate utilization efficiency, as well as fermentation performance [Ezeji et al., 2007; Jang et al., 2012]. Therefore, development of advanced pretreatment and hydrolysis processes that can limit the generation of inhibitory compounds as well as development of superior strains that can tolerate lignocellulosic materials derived inhibitors has become the primary concerns for economically competitive production of butanol from lignocellulosic biomass hydrolysates [Jang et al., 2012]. Nevertheless, butanol production from lignocellulosic materials by Clostridium spp. has been considered as the most promising strategy in the development of inexpensive, renewable, and sustainable liquid fuels to replace petroleum-based gasoline. 1.1 Project objectives and specific tasks Overall, the objective of this project was to develop a stable and reliable process for hightiter, high-yield, and cost-effective butanol production from lignocellulosic biomass hydrolysates by engineered C. tyrobutyricum mutants through metabolic engineering for enhanced butanol synthesis, application of NADH driving force to improve butanol yield and reduce by-products, utilization of a fibrous-bed bioreactor to overcome butanol tolerance and achieve a high butanol titer, as well as integration of fed-batch fermentation and gas stripping to alleviate butanol-induced inhibition and realize in situ butanol 10

40 recovery. Figure 1.1 gives an overview of this project; and the specific tasks for this study are provided in detail below. Task 1: Metabolic engineering of C. tyrobutyricum for enhanced butanol synthesis Previously, adhe2 gene under the control of native thiolase (thl) promoter has been successfully cloned and transferred into C. tyrobutyricum and various butanol-producing C. tyrobutyricum mutants have been obtained in our lab [Yu et al., 2011]. Currently, two types of aldehyde/alcohol dehydrogenase genes including adhe and adhe2 have been identified in solventogenic clostridia, both of which are able to convert butyryl-coa to butanol and also acetyl-coa to ethanol [Nair et al., 1994; Fontaine et al., 2002]. In order to compare the butanol-producing abilities and fermentation performances of adhe and adhe2 overexpressed mutants, heterologous expression of adhe gene in C. tyrobutyricum for enhanced butanol synthesis was performed in this study (Chapter 3). In addition, inactivation of the key genes involved in acetic acid and butyric acid synthesis pathways including ack/pta gene or ptb gene was carried out to reduce the generation of byproducts and improve butanol production (Chapter 3). Task 2: High-yield and high-titer butanol production in C. tyrobutyricum with external driving forces Although adhe2-overexpressed C. tyrobutyricum mutants have demonstrated the ability to produce significant amount of butanol, acetic and butyric acids are still generated as the major by-products in these mutants, resulting in a low butanol yield (< 0.20 g/g) and titer (~ 5.0 g/l). It has been confirmed that biosynthesis of butanol in solventogenic clostridia is usually limited by NADH availability. In order to overcome this limitation, 11

41 artificial electron carriers including methyl viologen (MV) and benzyl viologen (BV) were applied to divert electron flow and redirect carbon flux towards the synthesis pathway of butanol, the most reducing end-product. In Chapter 4, the effects of MV or BV on cell growth, metabolic flux distribution and butanol production was investigated at various ph values, with different nitrogen source concentrations, and in different C. tyrobutyricum mutants. In addition, metabolic flux analysis was applied to better understand the carbon flux distribution and electron flow in response to different concentrations of methyl viologen and medium ph. Moreover, high-titer butanol production with further improvement in butanol yield was achieved by integrating fedbatch fermentation with in situ gas stripping to alleviate butanol-induced inhibition. Task 3: High-titer and high-yield butanol production from glucose and xylose by engineered C. tyrobutyricum in a fibrous-bed bioreactor Fermentative butanol production usually suffers from low butanol titer due to butanol toxicity. In Chapter 5, adaptation and evolution mutagenesis combined with NADH driving force was used to improve butanol tolerance, minimize by-products generation, as well as facilitate xylose utilization. First, corn steep liquor (CSL) medium, a low-cost but superior complex nitrogen source, was used to replace the expensive CGM medium to make butanol production more economically competitive. Then, free-cell fermentation was utilized to determine the optimal culture conditions for fermentative butanol production from glucose and xylose by C. tyrobutyricum in the presence of artificial electron carriers. Adaptation and evolution with immobilized-cell fermentation using glucose or xylose or glucose-xylose mixture as substrates in FBB was applied to obtain high cell density, improve solvent resistance, and achieve high butanol titer with an 12

42 emphasis on process development, performance, and evaluation. Finally, fed-batch fermentation and gas stripping was integrated to minimize butanol-induced inhibition via in situ butanol recovery with a further improvement in butanol titer and yield. Task 4: High-titer and high-yield butanol production from lignocellulosic biomass hydrolysates by engineered C. tyrobutyricum In order to make the biobutanol production more economically competitive, cellulosic biomass including Jerusalem artichoke and cassava bagasse and lignocellulosic materials including cotton stalk, corn fiber, sugarcane bagasse, and soybean hull were used as alternative abundant, renewable, and inexpensive feedstocks for high-titer, high-yield, and cost-effective butanol production in Chapter 6. After pretreatment, enzymatic hydrolysis, centrifugation, and concentration by evaporation, these biomass hydrolysates containing both pentose and hexose including glucose and xylose were utilized for fermentative butanol production by engineered C. tyrobutyricum. First, free-cell fermentations with these hydrolysates as substrates were carried out to determine an optimal culture condition with a focus on maximizing butanol titer and yield while minimizing the generation of by-products. Then, immobilized-cell fermentations in FBB with a repeated-batch mode were investigated for high-titer and high-yield butanol production from lignocellulosic materials with a focus on evaluating the stability, reliability, and long-term performance of the process. The effects of inhibitory compounds released during pretreatment, hydrolysis, and concentration of lignocellulosic biomass on cell growth and fermentation performance were also evaluated in this chapter. Moreover, the fermentation kinetics using different hydrolysates as substrates were compared and discussed. 13

43 1.2 Significance and major impacts US average gasoline price has been steadily increasing since 2008 with a current average price of $3.50-$4.00 per gallon, and even higher gasoline prices can be found in European and Asian countries due to instability supply of crude oil as well as rapid depletion of fossil fuels reserves. Worldwide consumption of fossil fuels including petroleum and coal has caused severe environmental issues such as global warming, greenhouse gases emissions, climate change, air and water pollution, as well as loss of biodiversity [Naylor et al., 2007]. Moreover, domestic energy security is another major concern since a stable energy supply is the prerequisite for the development and security of a country. Based on the Energy Independence and Security Act (EISA 2007), US government has put a considerable effort in developing biofuels with an objective of 36 billion gallons biofuels per year by Butanol has been considered as a superior liquid fuel to replace gasoline because their properties are very similar. Currently, butanol is used as an important industrial chemical and solvent with an average selling price of $3.75 per gallon and 370 million gallons per year global market [ Fermentative butanol production from local lignocellulosic biomass to replace petroleum-based transportation fuels has become the most promising strategy to solve energy crisis problems, alleviate global warming issues, and strengthen domestic energy security because lignocellulosic materials are the most abundant, renewable, and inexpensive feedstocks on the earth. Plentiful lignocellulosic materials including agricultural residues, woody biomass, and industrial wastes are readily available in US nationwide. In particular, bioconversion of corn stover, probably the most abundant agricultural residue in US, has a potential to 14

44 produce 8.27 billion gallons butanol per year, which can partially relieve the high dependence on gasoline supply [Swana et al., 2011]. C. tyrobutyricum is a superior host over traditional solventogenic clostridia for fermentative butanol production because it has a more favorable metabolic pathway from glucose to butyryl-coa, higher solvent resistance, no acetone generation, and less interactions with some fundamental cellular events including sporulation, cell autolysis, and metabolic shift. NADH driving forces and online butanol recovery strategy were applied to maximize butanol titer and yield and minimize the generation of by-products by manipulating electron flow and carbon flux and alleviating butanol-induced inhibition. Adaptation and evolution in FBB was implemented to overcome poor solvent resistance, realize simultaneous utilization of pentose and hexose, and evaluate the long-term performance of the process. Finally, fermentative butanol production from various biomass hydrolysates was investigated to demonstrate the feasibility of developing biofuels from abundant, renewable, and inexpensive raw materials. In summary, hightiter, high-yield, and cost-effective butanol production from lignocellulosic feedstocks by engineered C. tyrobutyricum was achieved in an efficient, economic, stable, and reliable process, which has provided a very promising strategy for large-scale production of butanol as a superior liquid fuel to replace petroleum-based gasoline, solve energy crisis problems, relieve environmental issues, and improve domestic energy security. 1.3 References Al-Shorgani NK, Kalil MS, Yusoff WM Biobutanol production from rice bran and de-oiled rice bran by Clostridium saccharoperbutylacetonicum N1-4. Bioproc Biosyst Eng 35:

45 Andrade JC, Vasconcelos I Continuous cultures of Clostridium acetobutylicum: culture stability and low-grade glycerol utilisation. Biotechnol Lett 25: Berrios-Rivera SJ, Bennett GN, San KY The effect of increasing NADH availability on the redistribution of metabolic fluxes in Escherichia coli chemostat cultures. Metab Eng 4: Bond-Watts BB, Bellerose RJ, Chang MCY Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways. Nat Chem Biol 7: Buschke N, Schroder H, Wittmann C Metabolic engineering of Corynebacterium glutamicum for production of 1,5-diaminopentane from hemicellulose. Biotechnol. J. 6: Cascone R Biobutanol-A replacement for bioethanol? Chem Eng Prog 104:S4-S8. Claassen PAM, Budde MAW, Contreras AML Acetone, butanol and ethanol production from domestic organic waste by solventogenic Clostridia. J Microbiol Biotechnol 2: Datta R, Zeikus JG Modulation of acetone butanol ethanol fermentation: utilization of carbon monoxide to inhibit hydrogen production and to enhance butanol yields. Appl Environ Microbiol 48: Doremus MG, Linden JC, Moreira AR Agitation and pressure effect on acetone butanol fermentation. Biotechnol Bioeng 27: Du T, He A, Wu H, Chen J, Kong X, Liu J, Jiang M, Ouyang P Butanol production from acid hydrolyzed corn fiber with Clostridium beijerinckii mutant. Bioresour Technol 135: Durre P Biobutanol: An attractive biofuel. Biotechnol J 2: Ezeji T, Blaschek HP Fermentation of dried distillers' grains and solubles (DDGS) hydrolysates to solvents and value-added products by solventogenic clostridia. Bioresour Technol 99: Ezeji T, Milne C, Price ND, Blaschek HP Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl Microbiol Biotechnol 85: Ezeji TC, Qureshi N, Blaschek HP Production of butanol by Clostridium beijerinckii BA101 and in-situ recovery by gas stripping. World J Microbiol Biotechnol 19: Ezeji TC, Qureshi N, Blaschek HP. 2004a. Acetone butanolethanol (ABE) production from concentrated substrate: Reduction in substrate inhibition by fed-batch technique and product inhibition by gas stripping. Appl Microbiol Biotechnol 63:

46 Ezeji TC, Qureshi N, Blaschek HP. 2004b. Butanol fermentation research: upstream and downstream manipulations. Chem Rec 4: Ezeji TC, Qureshi N, Blaschek HP Butanol production from agricultural residues: Impact of degradation products on Clostridium beijerinckii growth and butanol fermentation. Biotechnol Bioeng 97: Ezeji TC, Qureshi N, Blaschek HP Microbial production of a biofuel (acetonebutanol-ethanol) in a continuous bioreactor: impact of bleed and simultaneous product removal. Bioproc Biosys Eng 36: Fischer CR, Klein-Marcuschamer D, Stephanopoulos G Selection and optimization of microbial hosts for biofuels production. Metab Eng 10: Fontaine L, Meynial-Salles I, Girbal L, Yang XH, Croux C, Soucaille P Molecular characterization and transcriptional analysis of adhe2, the gene encoding the NADHdependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol 184: Garćia V, PäkkiläJ, Ojamo H, Muurinen E, Keiski RL Challenges in biobutanol production: How to improve the efficiency. Renew Sustain Ener Reviews 15: Girbal L, Vasconcelos I, Saint-Amans S, Soucaille P How neutral red modified carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph. FEMS Microbiol Rev 16: Guo T, He A, Du T, Zhu D, Liang D, Jiang M, Wei P, Ouyang P Butanol production from hemicellulosic hydrolysate of corn fiber by a Clostridium beijerinckii mutant with high inhibitor-tolerance. Bioresour Technol 135: Huang J, Cai J, Wang J, Zhu X, Huang L, Yang ST, Xu Z Efficient production of butyric acid from Jerusalem artichoke by immobilized Clostridium tyrobutyricum in a fibrous-bed bioreactor. Bioresour Technol 102: Huang WC, Ramey DE, Yang ST Continuous production of butanol by Clostridium acetobutylicum immobilized in a fibrous bed bioreactor. Appl Biochem Biotechnol 113: Jang YS, Malaviya A, Cho C, Lee J, Lee SY Butanol production from renewable biomass by clostridia. BioresourcTechnol 123: Jiang L, Wang J, Liang S, Cai J, Xu Z, Cen P, Yang S, Li S Enhanced butyric acid tolerance and bioproduction by Clostridium tyrobutyricum immobilized in a fibrous bed bioreactor. Biotechnol Bioeng 108:

47 Jiang L, Wang J, Liang S, Wang X, Cen P, Xu Z Butyric acid fermentation in a fibrous bed bioreactor with immobilized Clostridium tyrobutyricum from cane molasses. Bioresour Technol 100: Jones DT, Woods DR Acetone butanol fermentation revisited. Microbiol Rev 50: Junelles AM, Janiti-Idrissi R, Petitdemange H, Gay R Iron effect on acetonebutanol fermentation. Curr Microbiol 17: Kim TS, Kim BH Electron flow shift in Clostridium acetobutylicum fermentation by electrochemically introduced reducing equivalent. Biotechnol Lett 10: Knoshaug EP, Zhang M Butanol tolerance in a selection of microorganisms. Appl Biochem Biotechnol 153: Kumar M, Gayen K Developments in biobutanol production: New insights. Appl Energy 88: Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung SK Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: Li H, Luo W, Gu Q, Wang Q, Hu W, Yu X Acetone, butanol, and ethanol production from cane molasses using Clostridium beijerinckii mutant obtained by combined low-energy ion beam implantation and N-methyl-N-nitro-Nnitrosoguanidine induction. Bioresour Technol 137: Linggang S, Phang LY, Wasoh H, Abd-Aziz S Acetone-Butanol-Ethanol Production by Clostridium acetobutylicum ATCC 824 Using Sago Pith Residues Hydrolysate. Bioenergy Research 6: Liu S, Qureshi N How microbes tolerate ethanol and butanol. New Biotechnol 26: Liu X, Zhu Y, Yang ST. 2006a. Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Progr 22: Liu X, Zhu Y, Yang ST. 2006b. Butyric acid and hydrogen production by Clostridium tyrobutyricum ATCC and mutants. Enz Microb Technol 38: Lopez-Contreras AM, Claassen PA, Mooibroek H, De Vos WM, Utilization of saccharides in extruded domestic organic waste by Clostridium acetobutylicum ATCC 824 for production of acetone, butanol and ethanol. Appl Microbiol Biotechnol 54:

48 Lu C, Zhao J, Yang ST, Wei D Fed-batch fermentation for n-butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour Technol 104: Lu C Butanol production from lignocellulosic feedstocks by acetone-butanolethanol fermentation with integrated product recovery. Ph.D. Thesis, The Ohio State University. Lutke-Eversloh T, Bahl H Metabolic engineering of Clostridium acetobutylicum: recent advances to improve butanol production. Curr Opin Biotechnol 22: Meyer CL, Roos JW, Papoutsakis ET Carbon monoxide gasing leads to alcohol production and butyrate uptake without acetone formation in continuous cultures of Clostridium acetobutylicum. Appl Microbiol Biotechnol 24: Naik SN, Goud VV, Rout PK, Dalai AK Production of first and second generation biofuels: a comprehensive review. Renew Sustain Energy Rev 14: Nakayama S, Kosaka T, Hirakawa H, Matsuura K, Yoshino S, Furukawa K Metabolic engineering for solvent productivity by downregulation of the hydrogenase gene cluster hupcba in Clostridium saccharoperbutylacetonicum strain N1-4. Appl Microbiol Biotechnol 78: Naylor RL, Liska AJ, Burke MB, Falcon WP, Gaskell JC, Rozelle SD, Cassman KG The ripple effect: biofuels, food security, and the environment. Environ 49: Ni Y, Xia Z, Wang Y, Sun Z Continuous butanol fermentation from inexpensive sugar-based feedstocks by Clostridium saccharobutylicum DSM Bioresour Technol 129: Nicolaou SA, Gaida SM, Papoutsakis ET A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: From biofuels and chemicals, to biocatalysis and bioremediation. Metab Eng 12: Nielsen DR, Leonard E, Yoon SH, Tseng HC, Yuan C, Prather KLJ Engineering alternative butanol production platforms in heterologous bacteria. Metab Eng 11: Oudshoorn A, van der Wielen LAM, Straathof AJJ Assessment of options for selective 1-butanol recovery from aqueous solution. Ind Eng Chem Res 48: Papoutsakis ET, Tomas CA, Tesic M, Santiago JY, Increased cell resistance to toxic organic substances. US Patent Papoutsakis ET Engineering solventogenic clostridia. Curr Opin Biotechnol 19:

49 Peguin S, Goma S, Delorme P, Soucaille P. 1994a. Metabolic flexibility of Clostridium acetobutylicum in response to methyl viologen. Appl Microbiol Biotechnol 42: Peguin S, Soucaille P Modulation of carbon and electron flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl Environ Microbiol 61: Peguin S, Soucaille P Modulation of metabolism of Clostridium acetobutylicum grown in chemostat culture in a three-electrode potentiostatic system with methyl viologen as electron carrier. Biotech Bioeng 51: Qureshi N, Saha BC, Dien B, Hector RE, Cotta MA. 2010b. Production of butanol (a biofuel) from agricultural residues: part I use of barley straw hydrolysate. Biomass Bioenergy 34: Qureshi N, Saha BC, Hector RE, Dien B, Hughes S, Liu S, Iten L, Bowman MJ, Sarath G, Cott MA. 2010a. Production of butanol (a biofuel) from agricultural residues: part II use of corn stover and switchgrass hydrolysates. Biomass Bioenergy 34: Raganati F, Olivieri G, Procentese A, Russo ME, Salatino P, Marzocchella A Butanol production by bioconversion of cheese whey in a continuous packed bed reactor. Bioresour Technol 138: Rao G, Mutharasan R Alcohol production by Clostridium acetobutylicum induced by methyl viologen. Biotechnol Lett 8: Rao G, Mutharasan R Altered electron flow in continuous cultures of Clostridium acetobutylicum induced by viologen dyes. Appl Environ Microbiol 53: Razak MNA, Ibrahim MF, Yee PL, Hassan MA, Abd-Aziz S Statistical Optimization of Biobutanol Production from Oil Palm Decanter Cake Hydrolysate by Clostridium acetobutylicum ATCC 824. Bioresour 8: Searchinger T, Heimlich R, Houghton RA, Dong F, Elobeid A, Fabiosa J, Tokgoz S, Hayes D, Yu TH Use of U.S. croplands for biofuels increases greenhouse gases through emissions from land-use change. Science 319: Shen CR, Lan EI, Dekishima Y, Baez A, Cho KM, Liao JC Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl Environ Microbiol 77: Shim H, Shin E, Yang ST A continuous fibrous-bed bioreactor for BTEX biodegradation by a coculture of Pseudomonas putida and Pseudomonas fluorescens. Adv Environ Res7:

50 Survase SA, van Heiningen A, Granstrom T Wood pulp as an immobilization matrix for the continuous production of isopropanol and butanol. J Ind Microbiol Biotechnol 40: Suwannakham S, Yang ST Enhanced propionic acid fermentation by Propionibacterium acidipropionici mutant obtained by adaptation in a fibrous-bed bioreactor. Biotechnol Bioeng 91: Swana J, Yang Y, Behnam M, Thompson R An analysis of net energy production and feedstock availability for biobutanol and bioethanol. Bioresour Technol 102: Tracy BP, Jones SW, Fast AG, Indurthi DC, Papoutsakis ET Clostridia: the importance of their exceptional substrate and metabolite diversity for biofuel and biorefinery applications. Curr Opin Biotechnol 23: Vasconcelos I, Girbal L, Soucaille P Regulation of carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph on mixtures of glucose and glycerol. J Bacteriol 176: Wang X, Wang Y, Wang B, Blaschek H, Feng H, Li Z Biobutanol production from fiber-enhanced DDGS pretreated with electrolyzed water. Renewable Energy 52: Wang Z, Yang ST Propionic acid production in glycerol/glucose co-fermentation by Propionibacterium freudenreichii subsp. shermanii. Bioresour Technol 137: Wei D, Liu X, Yang ST Butyric acid production from sugarcane bagasse hydrolysate by Clostridium tyrobutyricum immobilized in a fibrous-bed bioreactor. Bioresour Technol 129: Wu ZT, Yang ST Extractive fermentation for butyric acid production from glucose by Clostridium tyrobutyricum. Biotech. Bioeng. 82: Xue C, Zhao J, Liu F, Lu C, Yang S-T, Bai F-W Two-stage in situ gas stripping for enhanced butanol fermentation and energy-saving product recovery. Bioresour Technol 135: Xue C, Zhao J, Lu C, Yang ST, Bai F, Tang IC High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping. Biotechnol Bioeng 109: Yang ST Extractive fermentation using convoluted fibrous bed bioreactor. United States Patent Application Publication. US Patent Yerushaimi L, Volesky B Importance of agitation in acetone butanol fermentation. Biotechnol Bioeng 27:

51 Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol 93: Yu M, Zhang Y, Tang IC, Yang ST Metabolic engineeringof Clostridium tyrobutyricum for n-butanol production. Metab Eng 13: Zhang J, Wang M, Gao M, Fang X, Yano S, Qin S, Xia R Efficient acetonebutanol-ethanol production from corncob with a new pretreatment technology-wet disk milling. Bioenergy Research 6: Zheng YN, Li LZ, Xian M, Ma YJ, Yang JM, Xu X, He DZ Problems with the microbial production of butanol. J Ind Microbiol Biotechnol 36: Zhu Y, Liu X, Yang ST Construction and characterization of pta gene-deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotech Bioeng 90: Zhu Y, Yang ST Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Progr 19:

52 23 Objective High-titer, high-yield, and cost-effective butanol production from lignocellulosic biomass by engineered C. tyrobutyricum Task 1 Chapter 3 Metabolic engineering of C. tyrobutyricum for enhanced butanol production Task 2 Chapter 4 Implementation of NADH driving force and online butanol recovery strategy to maximize butanol titer and yield, minimize byproducts generation, and alleviate product inhibition Task 3 Chapter 5 Application of adaptation and evolution in FBB to increase butanol tolerance and evaluate the longterm performance of the process Task 4 Chapter 6 Utilization of various lignocellulosic biomass hydrolysates for high-titer, highyield, and costeffective butanol production Figure 1.1 Overview of the project objective and specific tasks for this study. 23

53 Chapter 2: Literature review 2.1 Biofuels and biobutanol Worldwide consumption of fossil fuels including petroleum, coal, and natural gas has caused severe environmental issues, rapid depletion of natural reserves of these resources, and domestic energy security concerns [Durre, 2007]. It has been reported that 3.2 billion tons of additional carbon dioxide can be generated annually, which has contributed significantly to greenhouse gases emissions [ In addition, abnormal climate changes, severe air and water pollutions, loss of ozone, raises of sea levels, and loss of biodiversity resulted from burning fossil fuels have also been frequently observed around the world [Bose, 2010]. Moreover, more than 7 billion barrels of oil and more than one million tons of coal and natural gas have been consumed in US, contributing more than four-fifths of the total energy consumption, which has a potential to induce energy crisis [U.S. Energy Information Administration]. Most importantly, domestic energy security issue has attracted more and more attention due to depleting fossil fuels reserves, instable supply of crude oils, as well as world politics problems. In 2007, Energy Independence and Security Act (EISA 2007) was passed and supported by US government, which aimed at an annual production of 36 billion gallons biofuels by Therefore, the development of environmentally friendly and sustainable energy from abundant, renewable, and inexpensive materials, such as hydroelectricity, wind energy, 24

54 solar power, and biofuels, has become more and more important. The conversion of biomass into liquid fuels including biodiesel, ethanol, and butanol is of special interest since these bio-based chemicals have a potential to replace gasoline as transportation fuels and solve the issues mentioned above [Durre, 2007]. Bioethanol produced from sugarcane and cereal grains is now widely used as an additive in gasoline in a couple of countries; and biodiesel produced from vegetable oil or animal fat feedstock can be directly used or blended with petro-diesel. The use of bioethanol as an alternative liquid fuel has been criticized for a couple of reasons. First, large-scale production and supply of bioethanol from sugarcane and cereal grains can potentially increase food prices, cause food shortage, and influence food markets [Naik et al., 2010]. Second, the energy density of bioethanol is significantly lower than that of gasoline, which means a greatly larger oil tank is needed for the same driving distance. Third, bioethanol can be dissolved with water at any ratio, making it incompatible with current petroleum infrastructures including refining, fuel distribution, and refueling. Finally, bioethanol cannot be directly used in the traditional engines; in order to use pure bioethanol as a liquid fuel, necessary modifications of motor vehicles are needed [Cascone, 2008]. Butanol is a four carbon alcohol with a distinct odor and is currently used as an important industrial chemical or solvent with a variety of applications, including latex surface coating, enamels, lacquers, as well as production of antibiotics, vitamins and hormones [Lee et al., 2008]. Recently, butanol has been considered as an alternative transportation fuel to replace gasoline because its properties are very similar to gasoline, as shown in Table 2.1 [Cascone, 2008]. For example, the energy density, vaporization heat, air-fuel ratio, research octane number, and motor octane number of butanol are very close to 25

55 gasoline (Table 2.1). In addition, butanol can be conveniently transported in current petroleum infrastructures due to its low solubility in water. Butanol can also be blended with either gasoline or diesel fuel at any ratio due to the fact that butanol is an excellent solvent. Moreover, the vehicle fuel economy (mpg) of butanol is very similar to gasoline, making butanol a desirable substitute to petroleum-based liquid fuels. Actually, butanol can be directly used in the traditional engines without any modification. Finally, butanol can be consumed and reused by microorganisms, which can limit its negative impact on the environment in case of leaking accidents [Cascone, 2008]. 2.2 Butanol production via acetone-butanol-ethanol (ABE) fermentation in solventogenic clostridia Fermentative butanol production has a long history, which can retrospect to 1861 when Pasteur first discovered and reported butanol production through anaerobic cultivation [Jones and Woods, 1986]. For the first half of the 20th century, acetone-butanol-ethanol (ABE) fermentation process was the dominant route to produce acetone and butanol as important industrial chemicals and solvents in the world, which played a critical role in World War I [Dürre, 2007; Lee et al., 2008; Garćia et al., 2011]. However, high costs of fermentation substrates and remarkable developments in petrochemical industry have made the biological route not economically competitive to petroleum-based process, resulting in a rapid decline in ABE fermentation industry [Jones and Woods, 1986; Lee et al., 2008]. Along with the replacement of ABE fermentation process in South Africa and Russia by petrochemical industry in early 1990s, almost all butanol has been produced based on petroleum so far [Zverlov et al., 2006; Lee et al., 2008]. Recently, a renewed interest in biological production of butanol as a potential liquid fuel to replace gasoline 26

56 has been gained due to various environmental issues, higher and higher gasoline prices, increasing demand on green energy, and domestic energy security requirement [Dürre, 2007]. Butanol can be naturally produced by a variety of clostridia species, named solventogenic clostridia, including acetobutylicum, beijerinckii, saccaroperbutylacetonicum, saccharoacetobutylicum, aurantibutyricum, pasteurianum, sporogenes, and tetanomorphum with C. acetobutylicum, C. beijerinckii, C. saccharoacetobutylicum, and C. saccaroperbutylacetonicum being the primary butanol-producing strains due to their relatively high butanol titers and yields [Lee et al., 2008; Kumar and Gayen, 2011]. Butanol production via ABE fermentation is a typical biphasic process, including acidogenic phase in which acetate, butyrate, carbon dioxide, and hydrogen are produced during the exponential phase through the activation of acids synthesis pathways, and solventogenic phase in which acetone, butanol, and ethanol are produced during stationary phase via the reassimilation and reutilization of acetic and butyric acids [Lee et al., 2008]. A general scheme of major metabolic pathways involved in solventogenic clostridia is given in Figure 2.1 [Lutke-Eversloh and Bahl, 2011]. It is well known that there is a metabolic shift between acidogenic and solventogenic phases in solventogenic clostridia, during which a significant change in gene expression and regulation has been observed [Durre et al., 1987]. However, the detailed information and mechanism involved in this metabolic shift is still not well understood, which has significantly increased the uncertainty and difficulty in the control of fermentation process [Papoutsakis, 2008]. Therefore, extensive studies have been conducted to understand the regulation of metabolic shift in solventogenic clostridia based on genomic, proteomic, 27

57 and transcriptional views [Durre et al., 2002; Janssen et al., 2010; Nolling et al., 2001; Lutke-Eversloh and Bahl, 2011]. Clostridium acetobutylicum and Clostridium beijerinckii are the two primary solventogenic clostridial species that have been evaluated for ABE production. C. acetobutylicum, whose genome has been sequenced and annotated, was considered as the genomic model to investigate the effects of gene overexpression or knock-out on fermentation kinetics [Nolling et al., 2001]. Genome sequencing reveals that C. acetobutylicum contains a 3.94 Mb chromosome and a 192 kb megaplasmid psol1 which is responsible for sporulation and solvent generation [Tomas et al., 2003a]. Metabolic engineering of C. acetobutylicum has been studied extensively to better understand the gene expression and regulation for enhanced butanol production [Lutke- Eversloh and Bahl, 2011]. Various genes involved in central metabolic pathways including adc, adhe1/adhe2, bdha/bdhb, ctfa/ctfb, ldh, hyda, ptb/buk, pta/ack, psol1, solr, Spo0A, thl, and groesl have been overexpressed or inactivated to evaluate their effects on fermentation kinetics [Lee et al., 2008]. It has been demonstrated that the overexpression of adhe1/adhe2, bdha/bdhb, thl, and groesl gene and disruption of adc, ptb/buk, pta/ack, and solr gene can significantly improve butanol production [Nair et al. 1994; Green et al. 1996; Nair et al. 1999; Harris et al. 2000; Harris et al. 2001; Tomas et al. 2003b; Lehmann et al., 2012; Kuit et al., 2012]. The down-regulation of psol1 and ctfa/ctfb genes, however, has dramatically reduced butanol production, suggesting that they are essential for butanol biosynthesis in solventogenic clostridia [Nair and Papoutsakis 1994; Tummala et al. 2003]. It is widely accepted that Spo0A, a sporulation regulator, plays a critical role in the initiation of endospore and solvent synthesis in 28

58 solventogenic clostridia [Lee et al., 2008; Lutke-Eversloh and Bahl, 2011]. It has been reported that disruption of Spo0A gene can significantly reduce butanol synthesis (1.0 g/l) whereas an improvement in butanol production (10.2 g/l) was observed by overexpressing Spo0A, indicating that Spo0A gene is closely coupled with solvent synthesis pathways in solventogenic clostridia [Harris et al., 2002]. However, due to the lack of efficient genetic tools for gene manipulations and insufficient knowledge about the key cellular events including metabolic shift between acidogenic phase and solventogenic phase, sporulation, and cell autolysis, the progress in metabolic engineering of solventogenic clostridia has been very slow. The recently developed ClosTron gene knockout system has provided a promising strategy for directed gene disruption/overexpression with a more reliable, efficient, and simple platform [Heap et al., 2009]. In addition, developing clostridial mutants with multiple knockouts of targeted genes can be easily realized by using flippase-mediated marker rescue system [Heap et al., 2010]. Recently, a comparative study based on genomic, proteomic, and transcriptional views has been proposed to better understand clostridial sporulation and physiology [Durre et al., 2002; Janssen et al., 2010; Nolling et al., 2001; Paredes et al., 2005; Janssen et al., 2012; Nicolaou et al., 2010]. C. beijerinckii BA101, another primary choice for fermentative butanol production at industrial level, is derived from C. beijerinckii NCIMB 8052 by random mutagenesis with an over twofold increase in butanol and acetone production compared to its parental strain [Formanek et al., 1997; Lee et al., 2008]. C. beijerinckii BA101 also shows distinct fermentation performance, including a different metabolic shift mechanism between acidogenic and solventogenic phases characterized by butanol generation during 29

59 exponential phase, and the ability to use both PTS and non-pts transport systems for delivery of carbon sources into the cells [Bahl et al., 1982; Formanek et al., 1997; Lee et al., 2008]. Butanol production by C. beijerinckii BA101 has been focused on investigation of potential alternative raw materials, such as barley straw, wheat straw, corn fiber, corn stover, switchgrass, domestic organic waste (DOW), dried distiller s grains and soluble (DDGS), wood pulp, cane molasses, and rice straw [Qureshi et al., 2008a, 2008b, 2008c, 2010a, 2010b; Survase et al., 2013; Li et al., 2013; Chen et al., 2013], and development of advanced fermentation techniques, such as immobilized-cell fermentation, membrane cell recycle, as well as integration of fermentation and separation [Qureshi et al., 2000; Pierrot et al., 1986; Evans and Wang, 1988; Ezeji et al., 2003, 2004a, 2004b ]. However, C. acetobutylicum and C. beijerinckii have a couple of inherent deficiencies that make them unfavorable hosts for butanol production. First, solventogenic clostridia usually suffer from low butanol yield (< 0.25 g/g substrate) because significant amount of acetone can be generated as a major by-product, which could not only greatly hamper butanol production, but also dramatically increase the costs for separation and purification. In fact, a typical molar ratio of acetone, butanol, and ethanol is 3:6:1 in ABE fermentation by solventogenic clostridia [Jones and Woods, 1986]. In addition, low solvent resistance is another big limitation for butanol production in solventogenic clostridia because butanol titer and reactor productivity cannot be very high due to product inhibition [Yu et al., 2011, Ezeji et al., 2010]. Moreover, the progress in gene manipulations and metabolic engineering of solventogenic clostridia has been greatly limited by the lack of efficient genetic tools for gene manipulations and insufficient 30

60 knowledge about the key cellular events including metabolic shift between acidogenic phase and solventogenic phase, sporulation, and cell autolysis [Heap et al., 2007; Lee et al., 2008]. Most importantly, process control within ABE fermentation is very strict and relatively difficult because of the typical biphasic fermentation characteristics and initiation of sporulation, both of which can be profoundly affected by various process control parameters including ph, temperature, redox, medium components, as well as substrate and product inhibition [Papoutsakis, 2008]. For example, acid crash with no solvent generation due to poor process control such as ph instability can be frequently observed during ABE fermentation by solventogenic clostridia [Sillers et al., 2008]. 2.3 Alternative butanol production platforms in heterologous bacteria Heterologous expression of clostridial butanol pathway in various bacterial hosts has also been considered to verify the possibility of producing butanol by bacteria other than clostridium spp. and expand the platforms for fermentative butanol production. E. coli is the mostly well-studied microorganism for heterologous butanol synthesis because of its well-understood metabolic pathways and abundant and readily available genetic tools. Iuni et al. reported a recombinant butanol pathway in E. coli from C. acetobutylicum ATCC 824 and obtained 4 and 16 mm butanol by mutants BUT1 with adhe1 and BUT2 with adhe2, respectively [Inui et al., 2008]. In order to improve butanol specificity and productivity, Atsumi et al. engineered a synthetic pathway and realized heterologous butanol synthesis in E. coli with a titer of 552mg/L in a rich medium (TB medium) [Atsumi et al., 2008]. They also found that E. coli mutants have a comparable butanol tolerance (up to 15 g/l) to native solventogenic clostridia, such as C. acetobutylicum [Atsumi et al., 2008]. Shen and Liao demonstrated the potential of producing butanol and 31

61 propanol (nearly 1:1 ratio) with a titer of ~ 1.0 g/l by introducing keto-acid pathways and eliminating competing pathways in E. coli [Shen and Liao, 2008]. Later on, butanol synthetic pathway of C. acetobutylicum with co-expression of S. cerevisiae formate dehydrogenase and E. coli glyceraldehyde 3-phosphate dehydrogenase was reconstructed in E. coli and finally 580 mg/l butanol was produced [Nielsen et al., 2009]. Based on an enzymatic chemical reaction mechanism, Bond-Watts et al. constructed a chimeric pathway assembled from three different organisms as a kinetic control element to achieve high-titer (4,650 ± 720 mg/l) and high-yield (28%) n-butanol production from glucose in E. coli [Bond-Watts et al., 2011]. By creating an irreversible reaction catalyzed by Ter (trans-enoyl-coenzyme A reductase) and implementing NADH and acetyl-coa driving forces, Shen et al. successfully achieved the highest butanol titer so far (15 g/l without butanol removal technique and 30 g/l with in situ butanol recovery by gas stripping) in E. coli, which was comparable to butanol production by native solventogenic clostridia [Shen et al., 2011]. In addition to E. coli, heterologous expression of clostridial butanol pathway in other bacterial hosts including Bacillus subtilis, Lactobacillus brevis, Pseudomonas putida, Saccharomyces cerevisiae as well as cyanobacteria was also considered [Nielsen et al., 2009; Berezina et al., 2010; Steen et al., 2008; Lan and Liao, 2011; Branduardi et al., 2013]. The attempts of heterologous butanol production in various alternative platforms are summarized in Table 2.2. Although all of these heterologous butanol producers demonstrated the ability to produce butanol, the titers of target products were extremely low, ranging from 2.5 mg/l to 300 mg/l, which were apparently not competitive to butanol production via ABE fermentation by solventogenic clostridia [Lutke-Eversloh 32

62 and Bahl, 2011]. In addition, the efficiency for butanol production in non-clostridial hosts is usually low and the mutants are very unstable due to the unpredicted disruption at genetic, molecular, and metabolic levels. Low butanol tolerance might be another problem for butanol synthesis in heterologous platforms [Fischer et al., 2008; Knoshaug and Zhang, 2009]. Recently, synthetic biology approaches have been proposed for biofuels production, providing a promising strategy to improve heterologous butanol synthesis [Fischer et al., 2008; Ranganathan and Maranas, 2010; Ghim et al., 2010; Dellomonaco et al., 2010]. In addition, by using the native amino acid biosynthetic pathways and 2-keto acid intermediates, high-yield and high-specificity production of higher alcohols such as n-butanol and isobutanol from glucose was achieved in E. coli, suggesting the possibility of producing butanol via non-natural pathways [Atsumi et al., 2008; Atsumi and Liao, 2008]. 2.4 C. tyrobutyricum and butanol synthesis in C. tyrobutyricum C. tyrobutyricum is a gram-positive, rod-shaped, spore-forming, and strictly anaerobic bacterium, which can consume glucose and xylose to produce acetic acid, butyric acid, hydrogen, and carbon dioxide as its main products [Wu and Yang, 2003]. C. tyrobutyricum has been widely used to produce butyric acid because of its high-titer, high-yield, and high-specificity as well as high butyrate tolerance [Zhu et al., 2004]. Metabolic engineering of C. tyrobutyricum for enhanced butyric acid production was realized via the disruption of ack/pta gene involved in acetic acid synthesis pathway or overexpression of buk/ptb gene involved in butyric acid synthesis pathway [Zhu et al., 2005; Liu et al., 2006; Zhang, 2009]. Adaptation and evolution in fibrous-bed bioreactor (FBB) is another efficient technique for high-titer and high-yield butyric acid production 33

63 by wild-type or metabolically engineered C. tyrobutyricum [Wei et al., 2013; Jiang et al., 2012; Jiang et al., 2011; Huang et al., 2011]. Butyric acid production with improved titer and yield from various alternative feedstocks including cane molasses, Jerusalem artichoke, and sugarcane bagasse was also investigated in previous studies [Jiang et al., 2009; Huang et al., 2011; Wei et al., 2013]. Recently, a co-culture of a novel Bacillus strain with C. tyrobutyricum was applied for butyric acid production from sucrose with a final butyrate concentration of 35 g/l, a yield of 0.35 g (butyrate)/g (sucrose) and a maximum productivity of 0.3 g/l/h [Dwidar et al., 2013]. Recently, C. tyrobutyricum has been considered as an alternative heterologous platform for butanol production because the metabolic pathways in C. tyrobutyricum are very similar to those in solventogenic clostridia, as shown in Figure 2.2. Heterologous butanol synthesis in C. tyrobutyricum can be easily realized via the overexpression of aldehyde/alcohol dehydrogenase (adhe or adhe2) from C. acetobutylicum [Yu et al., 2011; Yu et al., 2012]. In addition, it has been demonstrated that C. tyrobutyricum has a favorable metabolic pathway from glucose to butyryl-coa, which would suggest a highly efficient butanol synthesis pathway in adhe/adhe2-overexpressed mutants [Zhu et al., 2004; Liu et al., 2006a, Yu et al., 2011]. Moreover, wild type C. tyrobutyricum does not produce acetone, indicating that butanol yield in the mutants could be high because butanol is expected to be the primary solvent product. Furthermore, previous studies have confirmed that C. tyrobutyricum has a high butanol tolerance, 15 g/l without adaptation and 20 g/l with adaptation, a superior characteristic over solventogenic clostridia, which normally cannot survive at a butanol concentration of 15 g/l [Yu et al., 2011]. Most importantly, heterologous butanol production in C. tyrobutyricum is less likely to be 34

64 coupled with sporulation, cell autolysis, and metabolic shift between acidogenic and solventogenic phases, the major factors that could limit butanol production in native solventogenic clostridia [Ezeji et al., 2010]. Therefore, it is highly possible that highyield and high-titer butanol production with a relatively simple process control and more stable and reliable production rate can be achieved via integrating clostridial butanol synthesis pathway into C. tyrobutyricum. In order to confirm the butanol-producing ability of C. tyrobutyricum, aldehyde/alcohol dehydrogenase 2 (adhe2) from C. acetobutylicum ATCC824, which carries the function of converting butyryl-coa to butanol under the control of native thiolase (thl) promoter, was successfully cloned and transferred into C. tyrobutyricum and various mutants have been obtained, including C. tyrobutyricum-adhe2 (CtpMAD72), C. tyrobutyricumackko-adhe2 (ackkopmad72), C. tyrobutyricum-ptako-adhe2 (ptakopmad72), and C. tyrobutyricum-ptbko-adhe2 (ptbkopmad72) [Yu et al., 2011]. Compared to wild type, all of the adhe2-carrying C. tyrobutyricum mutants demonstrated the ability to produce butanol, although different levels of butanol are produced in different mutants. It is clear that CT-ackKO-adhE2 mutant presented the highest butanol producing ability among the various adhe2-overexpressed C. tyrobutyricum mutants [Yu et al., 2011]. These results would suggest that heterologous expression of solvent-producing enzymes in C. tyrobutyricum is highly feasible. However, previous results have demonstrated that butanol yield in adhe2-overexpressed C. tyrobutyricum mutants was similar to or even lower than that in native solventogenic clostridia due to the fact that acetic and butyric acids were still generated as the major byproducts in these mutants [Yu et al., 2011]. Knock-out of acetate and butyrate synthesis 35

65 pathways in C. tyrobutyricum has a potential to improve butanol yield by directing more carbon flux towards butanol synthesis pathway. Biosynthesis of butyric acid in C. tyrobutyricum requires two consecutive enzymatic steps catalyzed by phosphotransbutyrylase (PTB) and butyrate kinase (BK), respectively [Walter et al., 1993]. Phosphotransbutyrylase is encoded by ptb gene while butyrate kinase is encoded buk gene. Both of ptb and buk are located in the same operon with ptb proceeding buk 44 bp in C. acetobutylicum [Wisenborn et al., 1989]. Phosphotransacetylase (PTA) and acetate kinase (AK) encoded by pta gene and ack gene, respectively, are responsible for the biosynthesis of acetate [Boynton et al., 1996]. Previous studies have demonstrated that the disruption of pta and ack gene in C. tyrobutyricum can significantly reduce the activities of PTA and AK, resulting in an increase in butyrate titer and yield, although the final concentration of acetate was also slightly increased [Zhu et al., 2004; Liu et al., 2006b]. C. tyrobutyricum mutant (ackkopmad72) with overexpression of adhe2 and inactivation of ack presented a significantly higher butanol titer and yield than the control cloned with adhe2 gene alone [Yu et al., 2011]. Similar results were observed on C. tyrobutyricum mutant (ptbkopmad72) with overexpression of adhe2 and inactivation of ptb [Yu et al., 2011]. Figure 2.3 shows the putative metabolic pathways of glucose in engineered C. tyrobutyricum mutant with integrated butanol synthesis pathway and inactivated acids formation pathways [Yu et al., 2011]. The recently developed ClosTron gene knockout system has made directed mutagenesis of specific genes in clostridium species easier, faster, more stable and reliable [Heap et al., 2010]. The ClosTron system has taken advantage of the mobile group II intron (Targetron) from the ltrb gene of Lactococcus lactis (Ll.ltrB) to achieve directed insertional 36

66 inactivation by plugging into the specific target site via an RNA-mediated retrohoming mechanism, which can recombine with the target site DNA through base-pairing [Karberg et al., 2001; Mohr et al., 2000]. It has been demonstrated that Ll.ltrB group II intron can be used in a wide range of host strains, including both gram-positive and gramnegative bacteria [Frazier et al., 2003; Yao et al., 2006]. In addition, they have developed a standardized modular system for Clostridium-Escherichia coli shuttle plasmids, which provides various replicons, different selection markers, a multiple cloning site, and blue/white screening for simplified cloning and isolating, as shown in Figure 2.4 [Heap et al., 2009]. Moreover, by using flippase-mediated marker rescue system, developing clostridial mutants with multiple knockouts of targeted genes can be easily realized [Heap et al., 2010]. With the help of the ClosTron gene knockout system, a number of mutants with disrupted genes were rapidly obtained in Clostridium difficile and C. acetobutylicum, and specific genes in Clostridium botulinum and Clostridium sporogenes have also been inactivated for the first time [Heap et al., 2007]. In fact, the modular shuttle plasmids and modular ClosTron plasmids have become a powerful tool for gene manipulations in clostridium species to study the functions of specific genes [Emerson et al., 2009; Kirby et al., 2009; Twine et al., 2009; Jia et al., 2011; Kuit et al., 2012; Cooksley et al., 2013], to understand the regulations involved in metabolic pathways [Underwood et al., 2009; Cai et al., 2011; Lehmann et al., 2012], as well as to achieve heterologous expressions [Yu et al., 2011; Yu et al., 2012]. 2.5 Enhanced butanol production by NADH driving forces Despite the inactivation of acetic and butyric acids synthesis pathways in C. tyrobutyricum, the production of these by-products cannot be completely eliminated due 37

67 to the presence of some unknown pathways that can synthesize acetate and butyrate. Actually, significant amount of acetic and butyric acids are still generated as the main byproducts in butanol-producing C. tyrobutyricum mutants, which could not only limit butanol production, but also increase the cost for butanol recovery. By investigating the metabolic pathways in adhe2-overexpressed C. tyrobutyricum mutants, it was noted that NADH availability should be a limiting step for butanol production because in order to make one molecule of butanol from glucose, a total of four molecules NADH are needed [Shen et al., 2011]. The metabolic reaction from glucose to pyruvate, however, can only generate two molecules of NADH. In addition, it has been demonstrated that the expression of adhe2 gene is highly dependent on NADH level [Fontaine et al., 2002]. Therefore, providing more reducing power and thus increasing the availability of NADH should be a promising strategy to improve butanol production at the expense of acetate and butyrate by directing more carbon flux towards the biosynthesis pathway of butanol, the most reducing end-product in the metabolic network. Actually, it has been reported that different metabolite profiles in E. coli were observed in response to different levels of NADH availability by using carbon sources with different oxidation states and increasing NADH pool via overexpressing FDH pathway [Berríos-Rivera et al., 2004]. The redox balance of solventogenic clostridia is primarily controlled and regulated by H + /H2 ratio through the activity of ferredoxin hydrogenase and NADH/NAD + ratio through the activity of ferredoxin-nad + reductase. Briefly, pyruvate is generated from glucose glycolysis and is then oxidized to generate acetyl-coa, from which various endproducts with different degrees of oxidoreduction (acetic acid, butyric acid, ethanol, acetone, and butanol) are produced [Peguin et al., 1994a]. Distinct electron flow patterns 38

68 have been observed during the two different phases (acidogenic and solventogenic phases) in solventogenic clostridia. During the exponential phase when acids synthesis pathways are activated and acetate and butyrate are produced predominantly, the electron flow originated from pyruvate synthesis and excessive NADH accumulation is directed to oxidized ferredoxin, which is then mainly regenerated via hydrogen production through the activity of ferredoxin hydrogenase to maintain redox balance [Peguin et al., 1994a]. During the stationary phase when acetic and butyric acids are reassimilated and reutilized to produce acetone, ethanol, and butanol, two oxidation-reduction pathways are involved to realize redox balance: direct reoxidation of reduced pyridine nucleotides resulting from glycolytic conversion of glucose to pyruvate, and reoxidation of the reduced ferredoxin via the ferredoxin-nad + reductase [Peguin et al., 1994a]. As a result, a lower hydrogen production from reduced ferredoxin can be predicted during the solventogenic phase. The maintenance of redox balance in solventogenic clostridia can be simply described by the following reactions: Various approaches have been applied to manipulate the redox balance of solventogenic clostridia by decreasing the in vivo activity of the hydrogenase and increasing the availability of reducing power, which can divert electron flow from hydrogen generation to NADH accumulation and redirect carbon flux towards the synthesis pathways of more 39

69 reduced metabolites such as butanol and ethanol [Lutke-Eversloh and Bahl, 2011]. Studies on the effects of agitation and hydrogen partial pressure on the fermentation kinetics of C. acetobutylicum revealed that an improved butanol production whereas a reduced hydrogen generation was observed during the pressurized fermentation [Doremus et al., 1985; Yerushaimi et al., 1985]. In other studies, carbon monoxide, a known inhibitor of hydrogenase, was used for modulation of ABE fermentation in C. acetobutylicum with a 50% reduction in hydrogen production, 10-15% increase in butanol yield, and an improvement in electron efficiency to solventogenic phase from 75% to 85% [Datta et al., 1985; Meyer et al., 1986]. A limitation in iron concentration and utilization of more reduced substrates such as xylose, glycerol, and mannitol, have also been reported to significantly improve butanol production at the expense of acetic and butyric acids due to the increased availability of reducing equivalents [Junelles et al., 1988; Peguin and Soucaille, 1995; Girbal and Soucaille, 1994; Vasconcelos et al., 1994; Andrade and Vasconcelos, 2003; Yu et al., 2011]. Internal NADH driving forces based on enzyme mechanism or gene manipulation such as utilization of irreversible reactions, enzymatic kinetic control strategy, and overexpression of NAD + -dependent formate dehydrogenase have also been applied for enhanced butanol production [Nakayama et al. 2008; Berrios-Rivera et al., 2002; Nielsen et al., 2009; Shen et al., 2011; Bond-Watts et al., 2011; Atsumi et al., 2008; Shen and Liao, 2008]. For example, by constructing a chimeric pathway as a kinetic control element, high-titer (4,650 ± 720 mg/l) and highyield (28%) n-butanol production from glucose was achieved in E. coli [Bond-Watts et al., 2011]. By implementing NADH and acetyl-coa driving forces and creating an irreversible reaction, a high butanol titer (15 g/l without butanol removal technique and 40

70 30 g/l with in situ butanol recovery by gas stripping), which was comparable to butanol production by native solventogenic clostridia, was obtained in E. coli [Shen et al., 2011]. In addition to these approaches, the regulation of NADH availability through the use of artificial electron carriers, such as viologen dyes, is relatively simple [Kim and Kim, 1988; Peguin et al., 1994; Peguin and Soucaille, 1995, 1996; Rao and Mutharasan, 1986, 1987; Girbal et al., 1995]. In particular, methyl viologen, which has the standard redox potential close to that of ferredoxin, the native electron carrier for most anaerobic bacteria [Adams and Mortenson, 1984; Peguin et al., 1994], has been studied extensively as an artificial electron carrier for its effect on alcohol production in C. acetobutylicum [Peguin and Soucaille, 1996; Rao and Mutharasan, 1986; 1987]. For example, Kim and Kim studied the fermentation kinetics of C. acetobutylicum with methyl viologen and electrochemical energy, and concluded that butanol production was increased by 26% whereas acetone generation was reduced by 25% in the presence of 2 mm MV [Kim and Kim, 1988]. Peguin and Soucaille investigated chemostat culture of C. acetobutylicum in a three-electrode potentiometric system with 1 mm methyl viologen as an electron carrier, and found that the specific rates of butanol (mmol/g cell/h) was improved from 1.65 to 2.11 while that of acetone was decreased from 0.96 to 0.76 at ph 5.0 [Peguin and Soucaille, 1996]. Peguin et al. also examined batch cultures of C. acetobutylicum at four different controlled ph values (4.5, 5.0, 5.5, and 6.5) with 1 mm methyl viologen addition. At ph 4.5, a typical solventogenic metabolism, butanol titer was increased from 10.0 g/l to 13.5 g/l with a yield (mol/mol glucose) improved from 0.42 to 0.65, whereas acetone production was significantly reduced from 5.2 g/l to 2.0 g/l with a yield (mol/mol glucose) decreased from 0.29 to 0.10 [Peguin et al., 1994]. 41

71 Two mechanisms have been proposed to explain the alternated electron flow and redistributed carbon flux among the metabolic pathways in the presence of methyl viologen. The first mechanism states that MV is considered as a competitive inhibitor of hydrogenase [Grupe and Gottschalk, 1992; Rao and Mutharasan, 1986, 1987]. Without the supplementation of methyl viologen, hydrogen production is the primary pathway to achieve redox balance because of the high activity of ferredoxin hydrogenase. In addition, hydrogen generation from protons catalyzed by ferredoxin hydrogenase is more favorable than NADH generation from NAD + because the release of hydrogen into atmosphere can be considered as an irreversible reaction. In the presence of methyl viologen, however, hydrogen generation will be significantly reduced because of the inhibition in hydrogenase activity. As a result, in order to maintain redox balance, more available electron will be directed to generate NADH from NAD +, which in turn will be consumed during the solvent synthesis pathways for regeneration of NAD + pool. Due to the increased NADH availability, more carbon flux will be directed towards more reduced end-products, such as butanol and ethanol. Since butanol is the most reduced end-product in the metabolic network, the supply of methyl viologen is expected to significantly facilitate butanol production. The second mechanism claims that in the presence of methyl viologen, an artificial chain of electron carriers: pyruvate:ferredoxin oxidoreductase/mv/ferredoxin-nad + reductase/nad + was formed, which can divert electron flow from hydrogen generation to NADH accumulation, based on the assumption that MV is as good a substrate as ferredoxin for the pyruvate: ferredoxin oxidoreductase [Adams and Mortenson, 1984; Meinecke et al., 1989; Peguin et al., 1994; Peguin and Soucaille, 1995, 1996]. Nevertheless, both of these two mechanisms have 42

72 proposed that the use of artificial electron carriers such as methyl viologen can increase NADH availability and thus improve butanol production by alternating the native electron flow and redistributing the carbon flux among the metabolic pathways. In the presence of methyl viologen (MV), the maintenance of redox balance in solventogenic clostridia can be described by the following reactions: 2.6 Strategies to overcome butanol-induced inhibition Low butanol titer due to product inhibition is one of the most crucial challenges in fermentative butanol production [Nicolaou et al., 2010]. Butanol is able to go into the cytoplasmic membrane and change its structure by decreasing the ratio of unsaturated and saturated fatty acids, resulting in an adverse alternation in phospholipid and fatty acid composition in the cell membrane [Lepage et al., 1986]. As a result, a number of physicochemical characteristics of the cells including uptake and transport of nutrients, permeability of cell membrane, maintenance of intracellular ph and ATP levels, activities of intrinsic membrane proteins, and the specific interaction between solvents and lipids will be disturbed by this butanol-induced toxicity [Liu and Qureshi, 2009; Kumar and Gayen, 2011]. Actually, very few solventogenic clostridia can tolerate more than 15 g/l butanol [Liu and Qureshi, 2009; Kumar and Gayen, 2011]. Low butanol titer 43

73 does not only result in low butanol yield and reactor productivity, but also significantly increase the cost for butanol recovery. It is estimated that the cost for butanol separation will be cut by 50% if the final butanol concentration can be pushed from 12 g/l to 19 g/l [Papoutsakis et al., 2005]. Substantial efforts have been made to overcome poor solvent resistance and improve butanol titer in solventogenic clostridia, including strain improvement and process development [Ezeji et al., 2010]. For strain improvement, directed and non-directed mutagenesis as well as genetic modifications such as overexpression or inactivation of specific genes associated with solvent tolerance have been widely used to develop hyper-butanol-tolerant mutants [Lee et al., 2008; Lutke-Eversloh and Bahl, 2011]. For example, SA-1 and SA-2, two butanoltolerant mutants derived from C. acetobutylicum ATCC 824 through serial enrichment procedure (also called adaptation), were able to tolerate higher concentration of butanol (>15 g/l) than the parental strain [Lin and Blaschek, 1983; Baer et al. 1987; Blaschek, 2002]. These mutants also demonstrated better fermentation performance, such as higher growth rate, butanol production, and solvent ratio [Lin and Blaschek, 1983]. C. beijerinckii mutant BA101, which can produce 20 g/l butanol and has been widely used in ABE fermentation, was also obtained through mutagenesis and evolution [Blaschek, 2002]. Similarly, by adaptation and evolution in a fibrous bed bioreactor, a hyperbutanol-tolerant and production mutant, C. beijerinckii JB 200, which can produce 21 g/l butanol in free-cell fermentation and up to 28.2 g/l butanol in immobilized-cell fermentation, was screened and identified [Lu et al., 2012; Xue et al., 2012]. In order to evaluate the effects of gene modifications on butanol tolerance and production, various genes that are supposed to be coupled with solvent resistance in solventogenic clostridia 44

74 have been overexpressed or inactivated, including butyrate kinase (pjc4bk) [Green et al. 1996], alcohol dehydrogenase gene (pjc4bk-ptaad) [Harris et al. 2000], genes in the class I stress response operon groesl (pgroe1) [Tomas et al. 2003], and sporulation gene spo0a (pmspoa) [Alsaker et al. 2004]. However, no significant improvements in butanol resistance and synthesis in these mutants were observed due to the vicissitudes in inherent properties of cell membrane and insufficient knowledge about the genetic and metabolic regulation associated with solvent tolerance [Kumar and Gayen, 2011]. So far, the highest butanol titer achieved by metabolic engineering is only 17 g/l, which was obtained by overexpression of a major heat shock protein, groesl [Tomas et al., 2003]. Currently, identifying and understanding the functions and interactions of specific genes linked with solvent tolerance based on genomic, proteomic, and transcriptional views and synthetic biology seems to be the most promising strategy to address butanol inhibition issues [Borden and Papoutsakis, 2007; Shi and Blaschek, 2008; Nolling et al., 2001; Alsaker et al., 2010; Mao et al., 2010; Durre et al., 2002; Janssen et al., 2010; Paredes et al., 2005; Janssen et al., 2012; Nicolaou et al., 2010]. In addition to metabolic engineering and mutagenesis, integration of fermentation and separation has also been commonly used for alleviating butanol-induced inhibition via in situ butanol recovery, which can minimize the toxicity of butanol on cell proliferation [Ezeji et al., 2010; Kumar and Gayen, 2011]. In industry, distillation and molecular sieve is the most widely used process for ethanol and butanol recovery because of its high recovery efficiency, easy scalability, and well-established operation procedures. However, due to the low butanol titer (< 2%) during ABE fermentation, distillation is not a desirable technique for butanol recovery because it is very energy-intensive and costly. 45

75 Consequently, various relatively economic separation techniques including adsorption, liquid-liquid extraction, perstraction, pervaporation, reverse osmosis, and gas stripping have been proposed and applied to facilitate butanol production and recovery by online butanol removal from fermentation broth [Zheng et al., 2009]. Pervaporation is a membrane-based separation technique, which can allow volatile species to diffuse through the membrane, evaporate into permeate, and finally be condensed in a cooling trap [Vane, 2005; 2008; Thongsukmak and Sirkar, 2007]. The performance of pervaporation is highly dependent on the choice of membranes, such as poly-dimethyl siloxane (PDMS), polypropylene (PP), PTFE, poly[1-(trimethylsilyl)-1-propyne] (PTMSP), and Ge-ZSM-5 that are commonly used in pervaporation process [Vane, 2005; 2008; Qureshi et al., 1992; Vrana et al., 1993; Volkov et al., 1997; 2004; Fadeev et al., 2001, 2003; Li et al., 2003; Sano et al., 1994]. Liquid-liquid extraction or perstraction has also been proposed for butanol recovery from dilute aqueous solution as an alternative separation method based on the difference of solubility in extractant phase [Ezeji et al., 2004; Vane, 2008]. As a suitable extractant for butanol separation via liquid-liquid extraction, it has to meet various requirements including high selectivity, high distribution coefficient, non-toxic to microorganisms, immiscible, non-emulsifying, inexpensive to use and easily available [Maddox, 1989; Vane, 2008]. Long-chain alcohols, alkanes, esters, fatty acids, and oils are commonly used traditional extractants [Vane, 2008] whereas ionic liquid or biodiesel are newly developed materials for butanol recovery in liquid-liquid extraction process [Earle and Seddon, 2000; Fadeev and Meagher, 2001; Hagiwara and Ito, 2000; Toh et al., 2006; Zhao et al., 2005; Li et al., 2010]. Butanol recovery via adsorption is usually realized through two consecutive steps: 46

76 adsorption by adsorbent materials in a packed column and desorption by treating the adsorbent materials at high temperature to release concentrated butanol solution [Vane, 2008]. Similar to pervaporation, the performance of adsorption is highly dependent on the choice of adsorbents, such as hydrophobic zeolites, resin, activated carbon, silicalite, bonopore, and polyvinylpyridine [Groot et al., 1992; Holtzapple and Brown, 1994; Oudshoorn et al., 2009; Nielsen and Prather, 2009]. Although integrated liquid-liquid extraction/perstraction, pervaporation, or adsorption process could offer some benefit to relieve butanol toxicity and facilitate butanol production, a number of inherent limitations including loss of nutrients and fermentation intermediate products, membrane fouling, complexity in operation, requirement of additional separation steps and chemicals, and high equipment investments make these processes non-economic and non-efficient [Ezeji et al., 2010; Kumar and Gayen, 2011]. Among these integrated processes, gas stripping is the most simple but an efficient technique to minimize butanol inhibition, improve fermentation performance, and facilitate butanol recovery without disrupting cell culture, nutrient supply, and intermediate product accumulation [Ezeji et al., 2010; Lee et al., 2008; Kumar and Gayen, 2011]. In addition, gas tripping also has a couple of advantages over other separation techniques, including easier operation, lower capital investment and energy input, no requirement of extra steps and chemicals, ability to operate under fermentation temperature, and flexibility in solids removal [Vane, 2008; Oudshoorn et al., 2009]. Actually, the gas mixture of CO 2 and H 2 used in the gas stripping process is usually generated during the fermentation process, which can greatly save materials cost. Once butanol titer in the culture broth reaches a certain amount, usually above 10 g/l, gas 47

77 stripping is started to bubble the gas mixture of CO 2 and H 2 through the fermenter to selectively strip butanol from the fermentation broth, followed by the recovery of concentrated butanol from the butanol-saturated gas phase via passing through a condenser from bottom to top, which could allow sufficient retention time for butanol condensation. The condenser is usually operated at normal pressure and a temperature range of 1-2. It has been reported that the lower the condensing temperature was used, the more the butanol can be recovered from the gas phase [Xue et al., 2012, Lu et al., 2012]. However, too low a temperature is not beneficial for butanol selectivity since more water will also be condensed at lower temperature, such as -10. After condensation, most butanol in the gas phase will be recovered along with a partial condensation of water; and the gas mixture will be pumped back to the fermenter to continuously strip butanol from the culture broth. As a result, a relatively low butanol titer (usually g/l) can be maintained in the fermentation broth, which could significantly alleviate butanol-induced inhibition and allow continuous butanol production. Gas stripping has been widely used in batch, fed-batch, and continuous processes for ABE production by solventogenic clostridia [Ezeji et al., 2003; Ezeji et al., 2004a; Ezeji et al., 2004b; Ezeji et al., 2007; Ezeji et al., 2013; Lu et al., 2012; Xue et al., 2012; Xue et al., 2013; Vrije et al., 2013]. Ezeji et al. examined the effect of gas-stripping for in situ removal of ABE from culture broth during the batch fermentation by C. beijerinckii BA101, which utilized g/l glucose and produced total ABE of 75.9 g/l in the integrated process with 200% and 118% improvement in ABE productivity and yield, as compared to the control batch fermentation without gas stripping [Ezeji et al., 2003]. With H 2 and CO 2 as the carrier 48

78 gases, an integrated fed-batch fermentation and gas stripping system was applied for ABE production by C. beijerinckii BA101 [Ezeji et al., 2004]. Finally, g solvents (77.7 g acetone, g butanol, 3.4 g ethanol) were produced from 500 g glucose with an average solvent yield and productivity of 0.47 g/g and 1.16 g/l/h, respectively [Ezeji et al., 2004]. In another study, Ezeji et al. successfully produced 81.3 g/l ABE from g/l saccharified liquefied cornstarch (SLCS), a potential industrial substrate, in an integrated fed-batch fermentation and gas stripping process by C. beijerinckii BA101 [Ezeji et al., 2007]. Recently, a continuous one-stage fermentation integrated with gas stripping was applied for ABE fermentation by C. beijerinckii BA101 [Ezeji et al., 2013]. With the help of online butanol recovery, g ABE was produced from 1,125.0 g total sugar in 1 L culture volume within 504 h with a stable long-term performance [Ezeji et al., 2013]. Lu et al. utilized concentrated cassava bagasse hydrolysate (CBH) containing g/l glucose for ABE production by C. acetobutylicum JB200 in a fibrous bed bioreactor integrated with gas stripping [Lu et al., 2012]. A total of g/l ABE (butanol: 76.4 g/l, acetone: 27.0 g/l, ethanol: 5.1 g/l) with an overall yield of 0.32 g/g for ABE and 0.23 g/g for butanol was obtained within 263 h fed-batch fermentation [Lu et al., 2012]. In another study of ABE fermentation by C. acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping, 172 g/l ABE (113.3 g/l butanol, 49.2 g/l acetone, 9.7 g/l ethanol) was produced from g/l glucose over 326 h with an overall productivity and yield of 0.53 g/l/h and 0.36 g/g for ABE and 0.35 g/l/h and 0.24 g/g for butanol, respectively [Xue et al., 2012]. By applying a two-stage gas stripping strategy for butanol recovery, higher titers of ABE (10.0 g/l acetone, 19.2 g/l butanol, 1.7 g/l ethanol vs. 7.9 g/l acetone, 16.2 g/l butanol, 1.4 g/l ethanol) with a 49

79 higher butanol yield (0.25 g/g vs g/g) and productivity (0.40 g/l/h vs g/l/h) was successfully achieved in the ABE fermentation by C. acetobutylicum JB200 in a fibrous bed bioreactor [Xue et al., 2013]. Recently, isopropanol, butanol and ethanol (IBE) production by C. beijerinckii NRRL B593 in batch, repeated-batch, and continuous fermentation integrated with gas stripping was evaluated [Vrije et al., 2013]. 3.0 g/l IBE with a productivity of 0.29 g/l/h, 10.3 g/l IBE with a yield of 0.31 g/g and a productivity of 0.11 g/l/h, and 8.2 g/l IBE with a productivity of 1.3 g/l/h was obtained in the gas stripping integrated batch, repeated-batch, and continuous processes, respectively [Vrije et al., 2013]. The attempts of using gas stripping for enhanced ABE or IBE production in batch, fed-batch, repeated-batch, or continuous fermentation processes by different clostridial strains are summarized in Table Adaptation and evolution in fibrous-bed bioreactor (FBB) Adaptation and evolution in fibrous-bed bioreactor (FBB) is another advanced fermentation strategy to improve solvent tolerance and butanol titer by following the principle of survival of the fittest in nature [Yang, 1996]. Figure 2.5 shows the design of a FBB system [Yang, 1996]. It is a glass column vessel packed with a spiral wound fibrous matrix to realize free flow of fluid and particles through the channels between layers of fibrous matrices in the axial direction. The highly porous fibrous matrix has large surface area and void volume to allow high densities of immobilized cells, which can facilitate the achievement of high cell tolerance to toxic metabolites, such as butanol [Yang, 1996]. In addition, FBB also presents a couple of advantages including free flow of suspended solids, low pressure drop, and stable long-term performance for an entire operation period (few months to over a year) over conventional immobilized cell 50

80 bioreactors, such as packed bed and membrane bioreactors, in which clogging and fouling problems were frequently observed. Moreover, the adapted cells are forced to contact with gradually increased butanol concentrations, which in turn could provide a selection pressure to drive the evolution towards higher butanol titers. As a result, cells with high butanol-tolerating ability will survive and weakened and dead cells killed by the high butanol stress will be washed out from the FBB system. Finally, as a nondirected mutagenesis and evolution, it does not require extensive information at metabolic and physiological levels and is not dependent on available genetic modifications and functional knowledge. FBB technology has been successfully applied for enhanced production of stem cells, antibodies, enzymes, and various value-added chemicals and biofuels including embryonic stem cells [Ouyang and Yang, 2008], monoclonal antibody [Zhu and Yang, 2005], soluble human fas ligand [Chen et al., 2009], cellulase [Lan et al., 2013], glucoamylase [Kilonzo et al., 2010], lactic acid [Wang et al., 2010; Shi et al., 2012; Tay and Yang, 2002], propionic acid [Wang and Yang, 2013; Suwannakham and Yang, 2005; Suwannakham et al., 2006; Zhu et al., 2012; Liang et al., 2012; Chen et al., 2012], mycophenolic acid [Xu and Yang, 2007], butyric acid [Zhu et al., 2002; Zhu and Yang, 2003; Liu et al., 2006; Liu and Yang, 2006; Jiang et al., 2009, 2010, 2011, 2012; Huang et al., 2011; Wei et al., 2013], ethanol [Chen et al., 2013], and butanol [Huang et al., 2004; Lu et al., 2012; Xue et al., 2012] with a remarkable improvement in titer, yield and productivity of target products. In addition to the significantly improved production of target products, enhanced tolerance to toxic metabolites such as butanol and butyric acid has also been observed in previous studies [Zhu and Yang, 2003; Liu and Yang, 2006; 51

81 Jiang et al., 2011, 2012; Lu et al., 2012; Xue et al., 2012]. For example, by adaptation and evolution in FBB, the maximum specific growth rate of adapted C. tyrobutyricum cells was increased by 2.3-fold and its tolerance to butyrate inhibition increased by 29-fold, compared to the wild type [Zhu and Yang, 2003]. In another study of butyric acid production by C. tyrobutyricum immobilized in a fibrous bed bioreactor, the adapted culture demonstrated significantly higher tolerance to butyric acid and reduced inhibition on specific growth rate and phosphotransbutyrylase (PTB) enzyme and ATPase with elevated intracellular ph and elongated rod morphology, compared with the original culture [Jiang et al., 2011]. Similarly, by adaptation and evolution in a fibrous bed bioreactor, a hyper-butanol-tolerant and production mutant, C. acetobutylicum JB200, which can produce 21 g/l butanol in free-cell fermentation and up to 28.2 g/l butanol in immobilized-cell fermentation, was screened, isolated, and identified [Lu et al., 2012; Xue et al., 2012]. However, the maintenance of the superior abilities such as high butanol tolerance and butanol production rate of the mutants developed via adaptation and evolution is very difficult because they are very likely to lose their acquired abilities during subculture. In addition, since butanol production is not a favorable cellular event during metabolic activities for ATP generation and cell survival, it is not guaranteed that higher butanoltolerant mutants can be obtained via adaptive mutagenesis. Moreover, it has been reported that butanol production in solventogenic clostridia is coupled with sporulation, cell autolysis, and acid-solvent metabolic shift, which would make the adaptation and evolution strategy less efficient and reliable [Ezeji et al., 2010]. The combination of adaptive mutagenesis and metabolic engineering might provide a promising strategy to 52

82 develop hyper butanol-tolerant clostridial mutants with more stable and reliable performance. 2.8 Butanol production from alternative feedstocks Fermentative butanol production is also limited by high substrate cost and the availability of raw materials [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. It has been estimated that the cost of raw materials accounts for more than 50% of the total production cost in ABE fermentation, which has made the biochemical route not economically competitive to petrochemical process [Dürre, 2007; Garćia et al., 2011; Lu, 2012]. The utilization of traditional feedstocks including sugarcane and cereal grains which are derived from food crops for biofuels production has a potential to induce fluctuations in food supply, cause food shortage, and increase food prices [Kumar and Gayen, 2011]. The development of biofuels from food crops has also been hampered by limited crop lands and the availability of raw materials [Searchinger et al., 2008]. Recently, lignocellulosic materials such as agricultural residues, woody biomass, and industrial and municipal wastes have been considered as alternative feedstocks for biofuels production because they are abundant, renewable, inexpensive, and widely available [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. It has been demonstrated that Clostridium spp. are able to efficiently consume a variety of carbohydrates including simple and complex sugars such as pentose and hexose, an essential characteristic for economical production of biofuels from lignocellulosic materials [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. The major compositions including cellulose, hemicelluloses, lignin, and starch of some typical cellulosic and lignocellulosic biomass are listed in Table 2.4 [Howard et al., 2003; Saha, 53

83 2003]. It is clear that the concentrations of major components and fermentable sugars are highly substrate specific. In addition, different biomass hydrolysates usually contain different glucose/xylose ratio, which may have a profound impact on fermentation performance. Recently, cost-effective butanol production from various agricultural residues and industrial wastes has been extensively studied [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. Corn-derived agricultural residues and industrial wastes including corn stover, corn fiber, corncob, degermed corn, and liquefied corn starch have been considered as alternative feedstocks for economical biobutanol production. Qureshi et al. utilized corn stover hydrolysate as a substrate for ABE production by C. beijerinckii P260, which exhibited no growth and no ABE production with untreated corn stover hydrolysate whereas produced as high as g/l ABE after inhibitor removal by treating the hydrolysate with Ca(OH) 2, an ABE titer comparable to the control (21.06 g/l) with glucose as a substrate [Qureshi et al., 2010a]. In another study using corn stover hydrolysate for ABE production by Clostridium saccharobutylicum DSM in a continuous fermentation process, g/l solvent with a productivity of 0.43 g/l/h was obtained at a dilution rate of 0.15 h -1 [Ni et al., 2012]. By using alkali-treated steamexploded corn stover (SECSAT) as solid substrate and absorbed lignocellulose fermentation (ALF) strategy, 47% higher ABE production was successfully achieved in C. acetobutylicum ATCC 824, compared to the control with submerged culture [He and Chen, 2012]. Utilization of acid and enzyme hydrolyzed corn fiber for ABE production by C. beijerinckii BA101 has also been considered. It has been reported that sulfuric acid treated corn fiber hydrolysate (SACFH) could inhibit cell growth and butanol production 54

84 (1.7 g/l ABE) whereas 9.3 and 8.6 g/l ABE was produced after treatment of SACFH with XAD-4 resin and in enzyme treated corn fiber hydrolysate (ETCFH), respectively [Qureshi et al., 2008a]. In another study, non-detoxified hemicellulosic hydrolysate of corn fiber treated with dilute sulfuric acid (SAHHC) was considered as a substrate for ABE production by a C. beijerinckii mutant RT66, which produced 12.9 g/l ABE with a yield of 0.35 g/g and a productivity of 0.18 g/l/h [Guo et al., 2013]. Du et al. reported that C. beijerinckii IB4 was able to produce 9.50 g/l butanol in sulfuric acid treated corn fiber hydrolysate (SACFH) without inhibitors removal after optimization of medium components using fractional factorial design by Box-Behnken [Du et al., 2013]. Ezeji et al. investigated the feasibility of using degermed corn and liquefied corn starch as alternative feedstocks for ABE production by C. beijerinckii BA101, in which g/l ABE from saccharified degermed corn and 81.3 g/l ABE from saccharified liquefied corn starch was achieved in a continuous fermentation at a dilution rate of 0.03 h -1 and in an integrated fed-batch fermentation and gas stripping process, respectively [Ezeji et al., 2007a, 2007b]. Recently, corncob was considered as a raw material for ABE production by C. acetobutylicum SE-1 in an integrated wet disk milling (WDM) pretreatment and enzymatic hydrolysis and fermentation process, during which a comparable ABE production rate (0.15 g/l/h in SSF process and 0.12 g/l/h in SHF process) to the control (0.17 g/l/h in glucose fermentation) was observed [Zhang et al., 2013]. In addition to corn derived feedstocks, various straw-based raw materials including barley straw, wheat straw, rice straw, rice bran, and switchgrass have also been considered as alternative substrates for ABE production. Qureshi et al. evaluated the utilization of dilute sulfuric acid treated barley straw hydrolysate (BSH) without or with 55

85 lime Ca(OH) 2 treatment for ABE production by C. beijerinckii P260, which produced 7.09 g/l ABE with a yield of 0.33 g/g and a productivity of 0.10 g/l/h in the original barley straw hydrolysate whereas reached g/l ABE with a yield of 0.43 g/g and a productivity of 0.39 g/l/h after inhibitor removal by lime Ca(OH) 2 treatment [Qureshi et al., 2010b]. Qureshi et al. also investigated the utilization of wheat straw hydrolysate (WSH) as alternative feedstocks for ABE production by C. beijerinckii P260. In a batch fermentation, 60.2 g/l total sugars derived from hydrolysis of 86 g/l wheat straw was used to produce 25.0 g/l ABE with a yield of 0.42 g/g and a productivity of 0.60 g/l/h [Qureshi et al., 2007]. In another batch fermentation by simultaneous saccharification and fermentation (SSF) of wheat straw hydrolysate, C. beijerinckii P260 was able to produce g/l ABE with a productivity of 0.19 g/l/h without online solvent removal whereas g/l ABE with a productivity of 0.31 g/l/h with in situ solvent recovery by gas stripping [Qureshi et al., 2008a]. Then, in an integrated fed-batch fermentation and gas stripping process by simultaneous saccharification and fermentation (SSF) of wheat straw hydrolysate, the ABE production was improved by 16% with a productivity of 0.36 g/l/h [Qureshi et al., 2008b]. Alkaline peroxide wheat straw hydrolysate (APWSH) was also considered as a suitable substrate for ABE production by C. beijerinckii P260, which produced less than 2.59 g/l ABE in the original wheat straw hydrolysate whereas successfully reached 22.17g/L ABE in the salt removed APWSH by electrodialysis [Qureshi et al., 2008c]. Switchgrass hydrolysate (SGH) is another possible raw material for ABE production by C. beijerinckii P260 in batch fermentations, during which the cell growth and ABE production (1.48 g/l) was severely inhibited in untreated switchgrass hydrolysate whereas ABE production was improved to g/l in SGH after inhibitors 56

86 removal [Qureshi et al., 2010b]. Recently, ABE production by Clostridium saccharoperbutylacetonicum N1-4 from rice straw, rice bran, and de-oiled rice bran has also been investigated. In batch fermentation, C. saccharoperbutylacetonicum N1-4 was able to produce g/l ABE with a productivity of 0.10 g/l/h and a yield of 0.44 g/g in the dilute sulfuric acid pretreated de-oiled rice bran with inhibitors removal by XAD-4 resin, which was higher than pretreated rice bran [Al-Shorgani et al., 2012]. In another study, non-pretreated rice straw hydrolysate was evaluated for biobutanol production by C. saccharoperbutylacetonicum N1-4 under non-sterile environmental conditions, which predicted comparable butanol yield to sterile biobutanol production [Chen et al., 2013]. Industrial and municipal wastes including domestic organic waste (DOW), dried distiller s grains and soluble (DDGS), cheese whey, cane molasses, wood pulp, packing peanuts, and oil palm decanter cake are another group of promising alternative feedstocks for economical production of biofuels. Claassen et al. reported ABE production from domestic organic waste (DOW) by solventogenic clostridia C. acetobutylicum DSM 1731 and C. beijerinckii B-592, which produced 1.5 g/l and 0.9 g/l ABE, respectively, with an improved ABE titer and yield after removal of unspecific inhibiting components [Claassen et al., 2000]. Later on, Lopez-contreras reported ABE production from fresh and dried DOW by C. acetobutylicum ATCC 824, which was able to produce 4.0 g ABE/100g extruded DOW in a suspension of 10% (w/v) DOW in distilled water whereas 7.5 g ABE/100g extruded DOW in a suspension of 10% (w/v) DOW supplemented with commercial cellulase and β-glucosidases [Lopez-contreras et al., 2000]. Ezeji and Blaschek evaluated the utilization of dried distillers' grains and solubles (DDGS) hydrolysates with various pretreatment techniques (dilute acid, liquid hot water (LHW), 57

87 or ammonium fiber expansion (AFEX)) as an alternative substrate for ABE production by solventogenic clostridia, and concluded that C. saccharobutylicum 262 could produce 12.1 g/l ABE from dilute acid pretreated DDGS, and C. butylicum 592 could produce 12.9 g/l ABE from liquid hot water pretreated DDGS whereas 11.6 g/l ABE from AFEX pretreated DDGS [Ezeji and Blaschek, 2008]. Recently, fiber-enhanced DDGS pretreated with electrolyzed water was considered for ABE production by C. beijerinckii BA 101, which could generate 5.35 g ABE from 100 g dry fiber-enhanced DDGS [Wang et al., 2013]. In another study, starch-based packing peanuts was considered as a source of fermentable carbohydrates for ABE production by C. beijerinckii BA 101, which produced 21.7 g/l total ABE with a productivity of 0.20 g/l/h and a solvent yield of 0.37 g/g [Jesse et al., 2002]. By using cheese whey as a renewable feedstock for butanol production by C. acetobutylicum DSM 792 in a continuous packed bed reactor, a butanol titer of 4.93 g/l with a productivity of 2.66 g/l/h and a yield of 0.26 g/g was successfully achieved [Raganati et al., 2013]. After optimization via response surface methodology and central composite design, C. acetobutylicum ATCC 824 was able to produce 6.03 g/l butanol with a yield of 0.11 g/g from oil palm decanter cake, a potential lignocellulosic biomass for biorefinery [Razak et al., 2013]. With wood pulp as an immobilization matrix, a mixture alcohol production of isopropanol and butanol by C. beijerinckii DSM 6423 with a maximum titer of g/l, a productivity of 5.58 g/l/h, and a yield of 0.45 g/g was successfully realized in an immobilized column reactor [Survase et al., 2013]. Recently, cane molasses have been considered as alternative feedstocks for ABE production by C. beijerinckii L175 and C. saccharobutylicum DSM 13864, which 58

88 produced g/l ABE and g/l ABE with a productivity of 0.44 g/l/h, respectively [Li et al., 2013; Ni et al., 2013]. Recently, other starch-based cellulosic materials or lignocellulosic biomass including cassava bagasse, sago pith residues, and green seaweed Ulva lactuca have also been considered as alternative feedstocks for ABE production. Lu et al. investigated n-butanol production from cassava bagasse hydrolysate in an integrated fed-batch fermentation and gas stripping process and confirmed that C. acetobutylicum JB200, a hyper-butanoltolerant mutant, was able to produce g/l ABE with an overall ABE yield of 0.32 g/g and a butanol productivity of 0.32 g/l/h [Lu et al., 2012]. In another study using sago pith residue hydrolysate as an alternative carbon source supplemented with 0.5 g/l yeast extract, C. acetobutylicum ATCC 824 produced 8.84 g/l ABE with a productivity and yield of 0.12 g/l/h and 0.30 g/g, respectively [Linggang et al., 2013]. Hot-water treated green seaweed Ulva lactuca was also considered as a promising raw material for ABE production by C. beijerinckii and C. acetobutylicum, which produced ABE at high yields (0.35 g/g) [van der Wal et al., 2013]. ABE production from various alternative feedstocks by solventogenic clostridia was summarized in Table 2.5. However, in order to get access to the cellulosic structures and release fermentable sugars, physical, chemical, or biological pretreatment and enzymatic hydrolysis are usually required for the utilization of lignocellulosic materials as fermentation substrates. Pretreatment process does not only significantly contribute to the high cost in biofuels development, but also generate numerous inhibitory compounds such as furfural, furan, acetic, ferulic, glucuronic, p-coumaric acids, phenolic compounds, and aldehydes, which can severely affect cell growth and metabolism, substrate utilization efficiency, as well as 59

89 fermentation performance [Ezeji et al., 2007; Jang et al., 2012]. Furfural and hydroxymethylfurfural (HMF), which have demonstrated some inhibitory effects on cell growth and fermentation performance, are usually generated from pentose and hexose during the pretreatment and hydrolysis processes of lignocellulosic materials [Mussatto and Roberto, 2004] whereas phenolic, aromatic compounds and aldehydes, which have shown severe inhibitory effects on cell growth and fermentation performance even at very low concentrations, are usually derived from lignin [Ezeji et al., 2007b]. Ezeji et al. investigated the effects of some inhibitory compounds present in lignocellulosic hydrolysate on cell growth and ABE production by C. beijerinckii BA101 and confirmed that as low as 0.30 g/l p-coumaric and ferulic acids can significantly inhibit cell growth and reduce ABE production in C. beijerinckii BA101 whereas interestingly, furfural and HMF demonstrated some stimulatory effect on the growth of C. beijerinckii BA101 and ABE production [Ezeji et al., 2007b]. In order to use lignocellulosic hydrolysates as alternative economical feedstocks and improve substrate utilization efficiency, detoxification by removing inhibitory compounds through physical or chemical treatment is usually required [Ezeji et al., 2010]. Inhibitors removal via adsorption with lime Ca(OH) 2, activated charcoal, or ion-exchange resins has been extensively studied to limit the inhibitory effects of toxic compounds on cell growth and fermentation performance. For example, during a batch fermentation using corn stover hydrolysate as a substrate for ABE production by C. beijerinckii P260, no growth and no ABE production was observed with untreated corn stover hydrolysate whereas as high as g/l ABE was obtained after inhibitor removal by treating the hydrolysate with Ca(OH) 2 [Qureshi et al., 2010a]. In another study on ABE production 60

90 from acid and enzyme hydrolyzed corn fiber by C. beijerinckii BA101, significant inhibitory effect on cell growth and ABE production (1.7 g/l ABE) was observed without inhibitors removal whereas 9.3 g/l ABE was produced after treatment of SACFH with XAD-4 resin [Qureshi et al., 2008b]. A significant improvement in ABE production (26.64 g/l ABE with a yield of 0.43 g/g and a productivity of 0.39 g/l/h) from dilute sulfuric acid treated barley straw hydrolysate (BSH) by C. beijerinckii P260 was also achieved after inhibitor removal by lime Ca(OH) 2 treatment, compared to the results without inhibitor removal (7.09 g/l ABE with a yield of 0.33 g/g and a productivity of 0.10 g/l/h) [Qureshi et al., 2010b]. Similar results were obtained on ABE production from switchgrass hydrolysate (SGH) by C. beijerinckii P260, during which the cell growth and ABE production (1.48 g/l) was severely inhibited in untreated switchgrass hydrolysate whereas ABE production was improved to g/l in SGH after inhibitors removal [Qureshi et al., 2010b]. Recently, XAD-4 resin was successfully used to remove inhibitory compounds presented in dilute sulfuric acid pretreated de-oiled rice bran during an ABE production by C. saccharoperbutylacetonicum N1-4, which produced g/l ABE with a productivity of 0.10 g/l/h and a yield of 0.44 g/g [Al- Shorgani et al., 2012]. The generation of inhibitors from lignocellulosic materials is usually pretreatment method and substrate specific [Jang et al., 2012]. The commonly used pretreatment techniques include steam explosion (high temperature o C and high pressure MPa), liquid hot water pretreatment (very high temperature o C), ammonia fiber explosion (liquid ammonia, o C, high pressure), acid pretreatment (dilute or concentrated acids, such as H 2 SO 4, HCl, HNO 3, and H 3 PO 4 ), as well as alkaline 61

91 pretreatment (strong bases including sodium hydroxide, potassium hydroxide, calcium hydroxide, and ammonia hydroxide) [Lu, 2011]. Usually, thermal pretreatments including steam explosion, liquid hot water pretreatment, and ammonia fiber explosion can release less inhibitory compounds with lower concentrations than acid and alkaline pretreatments [Lu, 2011]. Recently, the development of advanced pretreatment and hydrolysis processes that can limit the generation of inhibitory compounds as well as development of superior strains that can tolerate lignocellulosic materials derived inhibitors have become the primary concerns for economically competitive production of butanol from lignocellulosic biomass hydrolysates [Jang et al., 2012]. Nevertheless, butanol production from lignocellulosic materials by Clostridium spp. has been considered as the most promising strategy in the development of inexpensive, renewable, and sustainable liquid fuels to replace petroleum-based gasoline. 2.9 References Adams MWW, Mortenson LE The physical and catalytic properties of hydrogenase II of Clostridium pasteurianum. A comparison with hydrogenase I. J Biol Chem 259: Alemdar A, Sain M Isolation and characterization of nanofibers from agricultural residues - wheat straw and soy hulls. Bioresour Technol 99: Alsaker KV, Paredes C, Papoutsakis ET Metabolite stress and tolerance in the production of biofuels and chemicals: gene-expression based systems analysis of butanol, butyrate and acetate stresses in the anaerobe Clostridium acetobutylicum. Biotechnol Bioeng 105: Alsaker KV, Spitzer TR, Papoutsakis ET Transcriptional analysis of spo0a over expression in Clostridium acetobutylicum and its effect on the cell's response to butanol stress. J Bacteriol 186: Al-Shorgani NK, Kalil MS, Yusoff WM Biobutanol production from rice bran and de-oiled rice bran by Clostridium saccharoperbutylacetonicum N1-4. Bioproc Biosyst Eng 35:

92 Andrade JC, Vasconcelos I Continuous cultures of Clostridium acetobutylicum: culture stability and low-grade glycerol utilisation. Biotechnol Lett 25: Atsumi S, Cann AF, Connor MR, Shen CR, Smith KM, Brynildsen MP, Chou KJY, Hanai T, Liao JC Metabolic engineering of Escherichia coli for 1-butanol production. Metab Eng 10: Atsumi S, Hanai T, Liao JC Non-fermentative pathways for synthesis of branchedchain higher alcohols as biofuels. Nature 451: Atsumi S, Liao JC Metabolic engineering for advanced biofuel production from Escherichia coli. Curr Opin Biotechnol 19: Baer SH, Blaschek HP, Smith TL Effect of butanol challenge and temperature on lipid composition and membrane fluidity of butanol-tolerant Clostridium acetobutylicum. Appl Environ Microbiol 53: Bahl H, Andersch W, Gottschalk G Continuous production of acetone and butanol by Clostridium acetobutylicum in a two stage phosphate limited chemostat. Eur J Appl Microbiol Biotechnol 15: Berezina OV, Zakharova NV, Brandt A, Yarotsky SV, Schwarz WH, Zverlov VV Reconstructing the clostridial n-butanol metabolic pathway in Lactobacillus brevis. Appl Microbiol Biotechnol 87: Berrios-Rivera SJ, Bennett GN, San KY. 2002a. The effect of increasing NADH availability on the redistribution of metabolic fluxes in Escherichia coli chemostat cultures. Metab Eng 4: Berrios-Rivera SJ, Bennett GN, San KY. 2002b. Metabolic engineering of Escherichia coli: increase of NADH availability by overexpressing an NAD + dependent formate dehydrogenase. Metab Eng 4: Berrios-Rivera SJ, Sanchez AM, Bennett GN, San KY Effect of different levels of NADH availability on metabolite distribution in Escherichia coli fermentation in minimal and complex media. Appl Microbiol Biotechnol 65: Blaschek H, Annous B, Formanek J, Chen CK Method of producing butanol using a mutant strain of Clostridium beijerinckii. US patent 6,358,717. Bond-Watts BB, Bellerose RJ, Chang MCY Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways. Nat Chem Biol 7: Borden JR, Papoutsakis ET Dynamics of genomic-library enrichment and identification of solvent tolerance genes for Clostridium acetobutylicum. Appl Environ Microbiol 73:

93 Bose BK Global warming: energy, environmental pollution, and the impact of power electronics. Industrial Electronics Magazine, IEEE 4:6-17. Boynton Z, Bennett G, Rudolph R Cloning, sequencing, and expressing of genes encoding phosphotransacetylase and acetate kinase from C. acetobutylicum ATCC824. Appl Environ Microbiol 62: Branduardi P, Longo V, Berterame NM, Rossi G, Porro D A novel pathway to produce butanol and isobutanol in Saccharomyces cerevisiae. Biotechnol Biofuels 6: Cai G, Jin B, Saintd C, Monisc P Genetic manipulation of butyrate formation pathways in Clostridium butyricum. J Biotechnol 155: Cascone R Biobutanol-A replacement for bioethanol? Chem Eng Prog 104:S4-S8. Chen F, Feng X, Xu H, Zhang D, Ouyang P Propionic acid production in a plant fibrous-bed bioreactor with immobilized Propionibacterium freudenreichii CCTCC M Biotechnol J 164: Chen J, Chen H, Zhu X, Lu Y, Yang S-T, Xu Z, Cen P Long-term production of soluble human Fas ligand through immobilization of Dictyostelium discoideum in a fibrous bed bioreactor. Appl Microbiol Biotechnol 82: Chen WH, Chen YC, Lin JG Evaluation of biobutanol production from nonpretreated rice straw hydrolysate under non-sterile environmental conditions. Bioresour Technol 135: Chen Y, Liu Q, Zhou T, Li B, Yao S, Wu J, Ying H Ethanol production by repeated batch and continuous fermentations by Saccharomyces cerevisiae immobilized in a fibrous bed bioreactor. J Microbiol Biotechnol 23: Claassen PAM, Budde MAW, Contreras AML Acetone, butanol and ethanol production from domestic organic waste by solventogenic Clostridia. J Microbiol Biotechnol 2: Cooksley CM, Zhang Y, Wang HZ, Redl S, Winzer K, Minton NP Targeted mutagenesis of the Clostridium acetobutylicum acetone-butanol-ethanol fermentation pathway. Metab Eng 14: Datta R, Zeikus JG Modulation of acetone butanol ethanol fermentation: utilization of carbon monoxide to inhibit hydrogen production and to enhance butanol yields. Appl Environ Microbiol 48: de Vrije T, Budde M, van der Wal H, Claassen PAM, Lopez-Contreras AM "In situ" removal of isopropanol, butanol and ethanol from fermentation broth by gas stripping. Bioresour Technol 137:

94 Dellomonaco C, Fava F, Gonzalez R The path for next generation biofuels: successes and challenges in the era of synthetic biology. Microb Cell Fact 9:3-17. Doremus MG, Linden JC, Moreira AR Agitation and pressure effect on acetone butanol fermentation. Biotechnol Bioeng 27: Du T, He A, Wu H, Chen J, Kong X, Liu J, Jiang M, Ouyang P Butanol production from acid hydrolyzed corn fiber with Clostridium beijerinckii mutant. Bioresour Technol 135: Durre P, Bohringer M, Nakotte S, Schaffer S, Thormann K, Zickner B Transcriptional regulation of solventogenesis in Clostridium acetobutylicum. J Mol Microbiol Biotechnol 4: Durre P, Kuhn A, Gottwald M, Gottschalk G Enzymatic investigationson butanol dehydrogenase and butyraldehyde dehydrogenase in extracts of Clostridium acetobutylicum. Appl Microbiol Biotechnol 26: Durre P Biobutanol: An attractive biofuel. Biotechnol J 2: Dwidar M, Kim S, Jeon BS, Um Y, Mitchell RJ, Sang BI Co-culturing a novel Bacillus strain with Clostridium tyrobutyricum ATCC to produce butyric acid from sucrose. Biotechnol Biofuels 6: Earle MJ, Seddon KR Ionic liquids. Green solvents for the future. Pure Appl Chem 72: Emerson JE, Reynolds CB, Fagan RP, Shaw HA, Goulding D, Fairweather NF A novel genetic switch controls phase variable expression of CwpV, a Clostridium difficile cell wall protein. Mol Microbiol 74: Evans PJ, Wang HY Enhancement of butanol formation by Clostridium acetobutylicum in the presence of decanol-oleyl alcohol mixed extractants. Appl Environ Microbiol 54: Ezeji T, Blaschek HP Fermentation of dried distillers' grains and solubles (DDGS) hydrolysates to solvents and value-added products by solventogenic clostridia. Bioresour Technol 99: Ezeji T, Milne C, Price ND, Blaschek HP Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl Microbiol Biotechnol 85: Ezeji T, Qureshi N, Blaschek HP. 2007a. Production of acetone-butanol-ethanol (ABE) in a continuous flow bioreactor using degermed corn and Clostridium beijerinckii. Process Biochem 42:

95 Ezeji TC, Qureshi N, Blaschek HP Production of butanol by Clostridium beijerinckii BA101 and in-situ recovery by gas stripping. World J Microbiol Biotechnol 19: Ezeji TC, Qureshi N, Blaschek HP. 2004a. Acetone butanolethanol (ABE) production from concentrated substrate: Reduction in substrate inhibition by fed-batch technique and product inhibition by gas stripping. Appl Microbiol Biotechnol 63: Ezeji TC, Qureshi N, Blaschek HP. 2004b. Butanol fermentation research: upstream and downstream manipulations. Chem Rec 4: Ezeji TC, Qureshi N, Blaschek HP. 2007b. Butanol production from agricultural residues: Impact of degradation products on Clostridium beijerinckii growth and butanol fermentation. Biotechnol Bioeng 97: Ezeji TC, Qureshi N, Blaschek HP Microbial production of a biofuel (acetonebutanol-ethanol) in a continuous bioreactor: impact of bleed and simultaneous product removal. Bioproc Biosys Eng 36: Fadeev AG, Kelley SS, McMillan JD, Selinskaya Y, Khotimsky VS, Volkov VV Effect of yeast fermentation by-products on poly(1-trimethylsilyl-1-propyne) pervaporative performance. J Membr Sci 214: Fadeev AG, Meagher MM Opportunities for ionic liquids in recovery of biofuels. Chem Commun 34: Fadeev AG, Selinskaya Y, Kelley SS, Meagher MM, Litvinova EG, Khotimsky VS, Volkov VV Extraction of butanol from aqueous solutions by pervaporation through poly(1-trimethylsilyl-1-propyne). J Membr Sci 186: Fischer CR, Klein-Marcuschamer D, Stephanopoulos G Selection and optimization of microbial hosts for biofuels production. Metab Eng 10: Fontaine L, Meynial-Salles I, Girbal L, Yang XH, Croux C, Soucaille P Molecular characterization and transcriptional analysis of adhe2, the gene encoding the NADHdependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol 184: Formanek J, Mackie R, Blaschek HP Enhanced butanol production by Clostridium beijerinckii BA101 grown in semidefined P2 medium containing 6 percent maltodextrin or glucose. Appl Environ Microbiol 63: Frazier CL, SanFilippo J, Lambowitz AM, Mills DA Genetic manipulation of Lactococcus lactis by using targeted group II introns: generation of stable insertions without selection. Appl Environ Microbiol 69:

96 Garćia V, PäkkiläJ, Ojamo H, Muurinen E, Keiski RL Challenges in biobutanol production: How to improve the efficiency. Renew Sustain Ener Reviews 15: Ghim CM, Kim T, Mitchell RJ, Lee SK Synthetic biology for biofuels: Building designer microbes from the scratch. Biotechnol Bioproc Eng 15: Girbal L, Soucaille P Regulation of Clostridium acetobutylicum metabolism as revealed by mixed-substrate steady-state continuous cultures: role of NADH/NAD + ratio and ATP pool. J Bacteriol 176: Girbal L, Vasconcelos I, Saint-Amans S, Soucaille P How neutral red modified carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph. FEMS Microbiol Rev 16: Green EM, Bennett GN Inactivation of an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC824. Appl Biochem Biotechnol 57: Green EM, Boynton ZL, Harris LM, Ruldolph FB, Papoutsakis ET, Bennett GN Genetic manipulation of acid formation pathways by gene inactivation in Clostridium acetobutylicum ATCC 824. Microbiology 142: Groot WJ, van der Lans RGJM, Luyben KCAM Technologies for butanol recovery integrated with fermentations. Proc Biochem 27: Grupe H, Gottschalk G Physiological events in Clostridium acetobutylicum during the shift from acidogenesis to solventogenesis in continuous culture and presentative of a model for shift induction. Appl Environ Microbiol 58: Guo T, He A, Du T, Zhu D, Liang D, Jiang M, Wei P, Ouyang P Butanol production from hemicellulosic hydrolysate of corn fiber by a Clostridium beijerinckii mutant with high inhibitor-tolerance. Bioresour Technol 135: Hagiwara R, Ito Y Room temperature ionic liquids of alkylimidazolium cations and fluoroanions. J Fluor Chem 105: Harris LM, Blank L, Desai RP, Welker NE, Papoutsakis ET Fermentation characterization and flux analysis of recombinant strains of Clostridium acerobutylicum with an inactivated solr gene. J Ind Microbiol Biotechnol 27: Harris LM, Desai RP, Welker NE, Papoutsakis ET Characterization of recombinant strains of the Clostridium acetobutylicum butyrate kinase inactivation mutant: Need for new phenomenological models for solventogenesis and butanol inhibition? Biotechnol Bioeng 67:1-11. Harris LM, Welker NE, Papoutsakis ET Northern, morphological, and fermentation analysis of spo0a inactivation and overexpression in Clostridium acetobutylicum ATCC824. J Bacteriol 184:

97 He Q, Chen H Improved efficiency of butanol production by absorbed lignocellulose fermentation. J Biosci Bioeng 115: Heap JT, Kuehne SA, Ehsaan M, Cartman ST, Cooksley CM, Scott JC, Minton NP The ClosTron: mutagenesis in Clostridium refined and streamlined. J Microbiol Methods 80: Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP The clostron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods 70: Heap JT, Pennington OJ, Cartman ST, Minton NP A modular system for Clostridium shuttle plasmids. J Microbiol Methods 78: Holtzapple MT, Brown RF Conceptual design for a process to recover volatile solutes from aqueous solutions using silicalite. Sep Technol 4: Howard RL, Abotsi E, Jansen van Rensburg EL, Howard S Lignocellulosic biotechnology: issues of bioconversion and enzyme production. African J Biotechnol 2: Huang J, Cai J, Wang J, Zhu X, Huang L, Yang ST, Xu Z Efficient production of butyric acid from Jerusalem artichoke by immobilized Clostridium tyrobutyricum in a fibrous-bed bioreactor. Bioresour Technol 102: Huang WC, Ramey DE, Yang ST Continuous production of butanol by Clostridium acetobutylicum immobilized in a fibrous bed bioreactor. Appl Biochem Biotechnol 113: Inui M, Suda M, Kimura S, Yasuda K, Suzuki H, Toda H, Yamamoto S, Okino S, Suzuki N, Yukawa H Expression of Clostridium acetobutylicum butanol synthetic genes in Escherichia coli. Appl Microbiol Biotechnol 77: Jang YS, Malaviya A, Cho C, Lee J, Lee SY Butanol production from renewable biomass by clostridia. BioresourcTechnol 123: Janssen H, Döring C, Ehrenreich A, Voigt B, Hecker M, Bahl H, Fischer RJ A proteomic and transcriptional view of acidogenic and solventogenic steady-state cells of Clostridium acetobutylicum in a chemostat culture. Appl Microbiol Biotechnol 87: Janssen H, Grimmler C, Ehrenreich A, Bahl H, Fischer RJ A transcriptional study of acidogenic chemostat cells of Clostridium acetobutylicum-solvent stress caused by a transient n-butanol pulse. Biotechnol J 161: Jesse TW, Ezeji TC, Qureshi N, Blaschek HP Production of butanol from starchbased waste packing peanuts and agricultural waste. J Ind Microbiol Biotechnol 29:

98 Jia K, Zhu Y, Zhang Y, Li Y Group II Intron-Anchored Gene Deletion in Clostridium. Plos one 6:1-10. Jiang L, Li S, Hu Y, Xu Q, Huang H Adaptive evolution for fast growth on glucose and the effects on the regulation of glucose transport system in Clostridium tyrobutyricum. Biotechnol Bioeng 109: Jiang L, Wang J, Liang S, Cai J, Xu Z, Cen P, Yang S, Li S Enhanced butyric acid tolerance and bioproduction by Clostridium tyrobutyricum immobilized in a fibrous bed bioreactor. Biotechnol Bioeng 108: Jiang L, Wang J, Liang S, Wang X, Cen P, Xu Z Butyric acid fermentation in a fibrous bed bioreactor with immobilized Clostridium tyrobutyricum from cane molasses. Bioresour Technol 100: Jiang L, Wang J, Liang S, Wang X, Cen P, Xu Z Production of Butyric Acid from Glucose and Xylose with Immobilized Cells of Clostridium tyrobutyricum in a Fibrous-bed Bioreactor. Appl Biochem Biotechnol 1602: Jones DT, Woods DR Acetone butanol fermentation revisited. Microbiol Rev 50: Junelles AM, Janiti-Idrissi R, Petitdemange H, Gay R Iron effect on acetonebutanol fermentation. Curr Microbiol 17: Karberg, M., Guo, H., Zhong, J., Coon, R., Perutka, J., Lambowitz, A.M., Group II introns as controllable gene targeting vectors for genetic manipulation of bacteria. Nat. Biotechnol. 19: Kilonzo PM, Margaritis A, Bergougnou MA Repeated-batch production of glucoamylase using recombinant Saccharomyces cerevisiae immobilized in a fibrous bed bioreactor. J Ind Microbiol Biotechnol 37: Kim TS, Kim BH Electron flow shift in Clostridium acetobutylicum fermentation by electrochemically introduced reducing equivalent. Biotechnol Lett 10: Kirby JM, Ahern H, Roberts AK, Kumar V, Freeman Z, Acharya KR, Shone CC Cwp84, a surface-associated, cysteine protease, plays a role in the maturation of the surface layer of Clostridium difficile. J Biol Chem 284: Knoshaug EP, Zhang M Butanol tolerance in a selection of microorganisms. Appl Biochem Biotechnol 153: Kuit W, Minton NP, López-Contreras AM, Eggink G Disruption of the acetate kinase (ack) gene of Clostridium acetobutylicum results in delayed acetate production. Appl Microbiol Biotechnol 94:

99 Kumar M, Gayen K Developments in biobutanol production: New insights. Appl Energy 88: Lan IE, Liao JC Metabolic engineering of cyanobacteria for 1-butanol production from carbon dioxide. Metab Eng13: Lan TQ, Wei D, Yang ST, Liu X Enhanced cellulase production by Trichoderma viride in a rotating fibrous bed bioreactor. Bioresour Technol 133: Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung SK Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: Lehmann D, Hönicke D, Ehrenreich A, Schmidt M, Weuster-Botz D, Bahl H, Lütke- Eversloh T Modifying the product pattern of Clostridium acetobutylicum: Physiological effects of disrupting the acetate and acetone formation pathways. Appl Microbiol Biotechnol 94: Lepage C, Fayolle F, Hermann M, Vandecasteele JP Changes in membrane lipid composition of Clostridium acetobutylicum during acetone-butanol fermentation: effects of solvents, growth temperature and ph. J Gen Microbiol 133: Li H, Luo W, Gu Q, Wang Q, Hu W, Yu X Acetone, butanol, and ethanol production from cane molasses using Clostridium beijerinckii mutant obtained by combined low-energy ion beam implantation and N-methyl-N-nitro-Nnitrosoguanidine induction. Bioresour Technol 137: Li S, Tuan VA, Falconer JL, Noble RD Properties and separation performance of Ge-ZSM-5 membranes. Micropor Mesopor Mater 58: Li SY, Srivastava R, Parnas RS Separation of 1-butanol by pervaporation using novel tri-layer PDMS composite membrane. J Membr Sci 363: Liang ZX, Li L, Li S, Cai Y-H, Yang ST, Wang JF Enhanced propionic acid production from Jerusalem artichoke hydrolysate by immobilized Propionibacterium acidipropionici in a fibrous-bed bioreactor. Bioproc Biosys Eng 35: Lin YL, Blaschek HP Butanol production by a butanol-tolerant strain of Clostridium acetobutylicum in extruded corn broth. Appl Environ Microbiol 45: Linggang S, Phang LY, Wasoh H, Abd-Aziz S Acetone-Butanol-Ethanol Production by Clostridium acetobutylicum ATCC 824 Using Sago Pith Residues Hydrolysate. Bioenergy Research 6: Liu S, Qureshi N How microbes tolerate ethanol and butanol. New Biotechnol 26:

100 Liu X, Zhu Y, Yang ST. 2006a. Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Progr 22: Liu X, Zhu Y, Yang ST. 2006b. Butyric acid and hydrogen production by Clostridium tyrobutyricum ATCC and mutants. Enz Microb Technol 38: Liu XG, Yang ST. 2006c. Kinetics of butyric acid fermentation of glucose and xylose by Clostridium tyrobutyricum wild type and mutant. Process Biochem 41: Lopez-Contreras AM, Claassen PA, Mooibroek H, De Vos WM, Utilization of saccharides in extruded domestic organic waste by Clostridium acetobutylicum ATCC 824 for production of acetone, butanol and ethanol. Appl Microbiol Biotechnol 54: Lu C, Zhao J, Yang ST, Wei D Fed-batch fermentation for n-butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour Technol 104: Lu C Butanol production from lignocellulosic feedstocks by acetone-butanolethanol fermentation with integrated product recovery. Ph.D. Thesis, The Ohio State University. Lutke-Eversloh T, Bahl H Metabolic engineering of Clostridium acetobutylicum: recent advances to improve butanol production. Curr Opin Biotechnol 22: Maddox IS The actone-butanol-ethanol fermentation: recent progress in technology. Genet Eng Rev 7: Mao S, Luo Y, Zhang T, Li J, Bao G, Zhu Y, Chen Z, Zhang Y, Li Y, Ma Y Proteome reference map and comparative proteomic analysis between a wild type Clostridium acetobutylicum DSM 1173 and its mutant with enhanced butanol tolerance and butanol yield. J Proteome Res 9: Meinecke B, Bertram J, Gottschalk G Purification and characterization of the pyruvate ferredoxin oxidoreductase from Clostridium acetobutylicum. Arch Microbiol 152: Meyer CL, Roos JW, Papoutsakis ET Carbon monoxide gasing leads to alcohol production and butyrate uptake without acetone formation in continuous cultures of Clostridium acetobutylicum. Appl Microbiol Biotechnol 24: Mohr G, Smith D, Belfort M, Lambowitz AM Rules for DNA target-site recognition by a lactococcal group II intron enable retargeting of the intron to specific DNA sequences. Genes Dev. 14:

101 Mussatto SI, Roberto IC Alternatives for detoxification of diluted-acid lignocellulosic hydrolysates for use in fermentative processes: a review. Bioresour Technol 93:1-10. Naik SN, Goud VV, Rout PK, Dalai AK Production of first and second generation biofuels: a comprehensive review. Renew Sustain Energy Rev 14: Nair RV, Bennett GN, Papoutsakis ET Molecular characterization of an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC 824. J Bacteriol 176: Nair RV, Green EM, Watson DE, Bennett GN, Papoutsakis ET Regulation of the sol locus genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 by a putative transcriptional repressor. J Bacteriol 181: Nair RV, Papoutsakis ET Expression of plasmid-encoded aad in Clostridium acetobutylicum M5 restores vigorous butanol production. J Bacteriol 176: Nakayama S, Kosaka T, Hirakawa H, Matsuura K, Yoshino S, Furukawa K Metabolic engineering for solvent productivity by downregulation of the hydrogenase gene cluster hupcba in Clostridium saccharoperbutylacetonicum strain N1-4. Appl Microbiol Biotechnol 78: Ni Y, Xia Z, Wang Y, Sun Z Continuous butanol fermentation from inexpensive sugar-based feedstocks by Clostridium saccharobutylicum DSM Bioresour Technol 129: Nicolaou SA, Gaida SM, Papoutsakis ET A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: From biofuels and chemicals, to biocatalysis and bioremediation. Metab Eng 12: Nielsen DR, Leonard E, Yoon SH, Tseng HC, Yuan C, Prather KLJ Engineering alternative butanol production platforms in heterologous bacteria. Metab Eng 11: Nielsen DR, Prather KJ In situ product recovery of n-butanol using polymeric resins. Biotechnol Bioeng 102: Nolling J, Breton G, Omelchenko MV, Makarova KS, Zeng Q, Gibson R, Lee HM, Dubois J, Qiu D, Hitti J, Wolf YI, Tatusov RL, Sabathe F, Doucette-Stamm L, Soucaille P, Daly MJ, Bennett GN, Koonin EV, Smith DR Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J Bacteriol 183: Oudshoorn A, van der Wielen LAM, Straathof AJJ. 2009a. Adsorption equilibria of biobased butanol solutions using zeolite. Biochem. Eng J 48:

102 Oudshoorn A, van der Wielen LAM, Straathof AJJ. 2009b. Assessment of options for selective 1-butanol recovery from aqueous solution. Ind Eng Chem Res 48: Ouyang A, Yang ST A two-stage perfusion fibrous bed bioreactor system for mass production of embryonic stem cells. Expert Opin Biologic Therapy 8: Papoutsakis ET, Tomas CA, Tesic M, Santiago JY, Increased cell resistance to toxic organic substances. US Patent Papoutsakis ET Engineering solventogenic clostridia. Curr Opin Biotechnol 19: Paredes C, Alsaker KV, Papoutsakis ET A comparative genomic view of clostridial sporulation and physiology. Nat Rev 3: Peguin S, Goma S, Delorme P, Soucaille P. 1994a. Metabolic flexibility of Clostridium acetobutylicum in response to methyl viologen. Appl Microbiol Biotechnol 42: Peguin S, Goma S, Delorme P, Soucaille P. 1994b. Enhanced alcohol yields in batch cultures of Clostridium acetobutylicum using a three-electrode potentiometric system with methyl viologen as electron carrier. Biotechnol Lett 16: Peguin S, Soucaille P Modulation of carbon and electron flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl Environ Microbiol 61: Peguin S, Soucaille P Modulation of metabolism of Clostridium acetobutylicum grown in chemostat culture in a three-electrode potentiostatic system with methyl viologen as electron carrier. Biotech Bioeng 51: Pierrot P, Fick M, Engasser JM Continuous acetone butanol fermentationwith high productivity by cell ultrafiltration and recycling. Biotech Lett 8: Qureshi N, Blaschek HP Butanol production using Clostridium beijerinckii BA101 hyper-butanol producing mutant strain and recovery by pervaporation. Appl Biochem Biotechnol 86: Qureshi N, Ezeji TC, Ebener J, Dien BS, Cotta MA, Blaschek HP. 2008a. Butanol production by Clostridium beijerinckii. Part I. Use of acid and enzyme hydrolyzed corn fiber. Bioresour Technol 99: Qureshi N, Maddox IS, Friedl A Application of continuous substrate feeding to the ABE fermentation: relief of product inhibition using extraction, perstraction, stripping and pervaporation. Biotechnol Prog 8: Qureshi N, Saha BC, Cotta MA Butanol production from wheat straw hydrolysate using Clostridium beijerinckii. Bioproc Biosys Eng 30:

103 Qureshi N, Saha BC, Cotta MA. 2008c. Butanol production from wheat straw by simultaneous saccharification and fermentation using Clostridium beijerinckii: part II fed-batch fermentation. Biomass Bioenergy 32: Qureshi N, Saha BC, Dien B, Hector RE, Cotta MA. 2010b. Production of butanol (a biofuel) from agricultural residues: part I use of barley straw hydrolysate. Biomass Bioenergy 34: Qureshi N, Saha BC, Hector RE, Dien B, Hughes S, Liu S, Iten L, Bowman MJ, Sarath G, Cott MA. 2010a. Production of butanol (a biofuel) from agricultural residues: part II use of corn stover and switchgrass hydrolysates. Biomass Bioenergy 34: Qureshi N, Saha BC, Hector RE, Hughes SR, Cotta MA. 2008b. Butanol production from wheat straw by simultaneous saccharification and fermentation using Clostridium beijerinckii: part I batch fermentation. Biomass Bioenergy 32: Raganati F, Olivieri G, Procentese A, Russo ME, Salatino P, Marzocchella A Butanol production by bioconversion of cheese whey in a continuous packed bed reactor. Bioresour Technol 138: Ranganathan S, Maranas CD Microbial 1-butanol production: identification of non-native production routes and in silico engineering interventions. Biotechnol J 5: Rao G, Mutharasan R Alcohol production by Clostridium acetobutylicum induced by methyl viologen. Biotechnol Lett 8: Rao G, Mutharasan R Altered electron flow in continuous cultures of Clostridium acetobutylicum induced by viologen dyes. Appl Environ Microbiol 53: Razak MNA, Ibrahim MF, Yee PL, Hassan MA, Abd-Aziz S Statistical Optimization of Biobutanol Production from Oil Palm Decanter Cake Hydrolysate by Clostridium acetobutylicum ATCC 824. Bioresour 8: Saha BC Hemicellulose bioconversion. J Ind Microbiol Biotechnol 30: Sano T, Yanagishita H, Kiyouzumi Y, Mizukami F, Haraya H Sepation of ethanol/water mixture by silicalite membrane on pervaporation. J Membr Sci 95: Searchinger T, Heimlich R, Houghton RA, Dong F, Elobeid A, Fabiosa J, Tokgoz S, Hayes D, Yu TH Use of U.S. croplands for biofuels increases greenhouse gases through emissions from land-use change. Science 319: Shen CR, Lan EI, Dekishima Y, Baez A, Cho KM, Liao JC Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl Environ Microbiol 77:

104 Shen CR, Liao JC Metabolic engineering of Escherichia coli for 1-butanol and 1- propanol production via the keto-acid pathways. Metab Eng 10: Shi Z, Blaschek HP Transcriptional analysis of Clostridium beijerinckii NCIMB 8052 and the hyper-butanol-producing mutant BA101 during the shift from acidogenesis to solventogenesis. Appl Environ Microbiol 74: Shi Z, Wei P, Zhu X, Cai J, Huang L, Xu Z Efficient production of L-lactic acid from hydrolysate of Jerusalem artichoke with immobilized cells of Lactococcus lactis in fibrous bed bioreactors. Enzyme Microb Technol 51: Sillers R, Chowb A, Tracy B, Papoutsakis ET Metabolic engineering of the nonsporulating, non-solventogenic Clostridium acetobutylicum strain M5 to produce butanol without acetone demonstrate the robustness of the acid-formation pathways and the importance of the electron balance. Metab Eng 10: Silverstein RA, Chen Y, Sharma-Shivappa RR, Boyette MD, Osborne J A comparison of chemical pretreatment methods for improving saccharification of cotton stalks. Bioresour Technol 98: Steen EJ, Chan R, Prasad N, Myers S, Petzold CJ, Redding A, Ouellet M, Keasling JD Metabolic engineering of Saccharomyces cerevisiae for the production of n- butanol. Microb Cell Fact 7:36. Survase SA, van Heiningen A, Granstrom T Wood pulp as an immobilization matrix for the continuous production of isopropanol and butanol. J Ind Microbiol Biotechnol 40: Suwannakham S, Huang Y, Yang ST Construction and characterization of ack knock-out mutants of Propionibacterium acidipropionici for enhanced propionic acid fermentation. Biotechnol Bioeng 94: Suwannakham S, Yang ST Enhanced propionic acid fermentation by Propionibacterium acidipropionici mutant obtained by adaptation in a fibrous-bed bioreactor. Biotechnol Bioeng 91: Tay A, Yang ST Production of L(+)-lactic acid from glucose and starch by immobilized cells of Rhizopus oryzae in a rotating fibrous bed bioreactor. Biotechnol Bioeng 80:1-12. Thongsukmak A, Sirkar KK Pervaporation membranes highly selective for solvents present in fermentation broth. J Memb Sci 302: Toh SLI, McFarlane J, Tsouris C, DePaoli DW, Luo H, Dai S Room-temperature ionic liquids in liquid-liquid extraction: effects of solubility in aqueous solutions on surface properties. Solvent Extraction and Ion Exchange 24:

105 Tomas CA, Bonarius H, Alsaker K, Yang H, Hendriksen W, Beamish J, Paredes C, Papoutsakis ET. 2003a. DNA-array based transcriptional analysis of Clostridium acetobutylicum sporulation (SK01) and degenerate (M5) mutants. J Bacteriol 185: Tomas CA, Welker NE, Papoutsakis ET. 2003b. Overexpression of groesl in Clostridium acetobutylicum results in increased solvent production and tolerance, prolonged metabolism, and changes in the cell's transcriptional program. Appl Environ Microbiol 69: Tracy BP, Jones SW, Fast AG, Indurthi DC, Papoutsakis ET Clostridia: the importance of their exceptional substrate and metabolite diversity for biofuel and biorefinery applications. Curr Opin Biotechnol 23: Tummala SB, Junne SG, Papoutsakis ET Antisense RNA downregulation of coenzyme A transferase combined with alcohol-aldehyde dehydrogenase overexpression leads to predominantly alcohologenic Clostridium acetobutylicum fermentations. J Bacteriol 185: Twine SM, Reid CW, Aubry A, McMullin DR, Fulton KM, Austin J, Logan SM Motility and flagellar glycosylation in Clostridium difficile. J Bacteriol 191: Underwood S, Guan S, Vijayasubhash V, Baines SD, Graham L, Lewis RJ, Wilcox MH, Stephenson K Characterisation of the sporulation initiation pathway of Clostridium difficile and the role in toxin production. J Bacteriol 191: van der Wal H, Sperber B, Houweling-Tan B, Bakker RRC, Brandenburg W, Lopez- Contreras AM Production of acetone, butanol, and ethanol from biomass of the green seaweed Ulva lactuca. Bioresour Technol 128: Vane LM Review: A review of Pervaporation for product recovery from biomass fermentation processes. J Chem Technol Biotechnol 80: Vane LM Separation technologies for the recovery and dehydration of alcohols from fermentation broths. Biofuels Bioprod Bioref 2: Vasconcelos I, Girbal L, Soucaille P Regulation of carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph on mixtures of glucose and glycerol. J Bacteriol 176: Volkov VV, Fadeev AG, Khotimsky VS, Litvinova EG, Selinskaya Y, McMillan JD, Kelley SS Effects of synthesis conditions on the pervaporation properties of poly[-1-(trimethylsilyl)-1-propyne] useful for membrane bioreactors. J Appl Polym Sci 91: Volkov VV, Khotimsky VS, Litvinova EG, Fadeev AG, Selinskaya Y, Plate NA, McMillan JD, Kelley SS Development of novel poly[-1-(trimethylsilyl)-1-76

106 propyne] based materials for pervaporation separation in biofuel production. Polym Mater Sci Eng 77: Vrana DL, Meagher MM, Hutkins RW, Duffield B Pervaporation of model acetone-butanol-ethanol fermentation product solutions using Polytetrafluoroethylene membranes. Sep Sci Technol 28: Walter K, Nair R, Cary J, Bennett G Sequence and arrangement of two genes of the butyrate-synthesis pathway of Clostridium acetobutylicum ATCC824. Gene 134: Wang X, Wang Y, Wang B, Blaschek H, Feng H, Li Z Biobutanol production from fiber-enhanced DDGS pretreated with electrolyzed water. Renewable Energy 52: Wang Z, Wang Y, Yang ST, Wang R, Ren H A novel honeycomb matrix for cell immobilization to enhance lactic acid production by Rhizopus oryzae. Bioresour technol101: Wang Z, Yang ST Propionic acid production in glycerol/glucose co-fermentation by Propionibacterium freudenreichii subsp. shermanii. Bioresour Technol 137: Wei D, Liu X, Yang ST Butyric acid production from sugarcane bagasse hydrolysate by Clostridium tyrobutyricum immobilized in a fibrous-bed bioreactor. Bioresour Technol 129: Wisenborn DP, Rudolph FB, Papoutsakis ET Phosphotransbutyrylase from Clostridium acetobutylicum ATCC824 and its role in acidogenesis. Appl Environ Microbiol 66: Wu ZT, Yang ST Extractive fermentation for butyric acid production from glucose by Clostridium tyrobutyricum. Biotech. Bioeng. 82: Xu Z, Yang ST Production of mycophenolic acid by Penicillium brevicompactum immobilized in a rotating fibrous-bed bioreactor. Enzyme Microb Technol 40: Xue C, Zhao J, Liu F, Lu C, Yang S-T, Bai F-W Two-stage in situ gas stripping for enhanced butanol fermentation and energy-saving product recovery. Bioresour Technol 135: Xue C, Zhao J, Lu C, Yang ST, Bai F, Tang IC High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping. Biotechnol Bioeng 109: Yang ST Extractive fermentation using convoluted fibrous bed bioreactor. United States Patent Application Publication. US Patent

107 Yao J, Lambowitz AM Gene targeting in Gram-negative bacteria by use of amobile group II intron (Targetron) expressed from a broad-host-range vector. Appl Environ Microbiol 73: Yerushaimi L, Volesky B Importance of agitation in acetone butanol fermentation. Biotechnol Bioeng 27: Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol 93: Yu M, Zhang Y, Tang IC, Yang ST Metabolic engineeringof Clostridium tyrobutyricum for n-butanol production. Metab Eng 13: Zhang J, Wang M, Gao M, Fang X, Yano S, Qin S, Xia R Efficient acetonebutanol-ethanol production from corncob with a new pretreatment technology-wet disk milling. Bioenergy Research 6: Zhang Y Metabolic engineering of Clostridium tyrobutyricum for production of biofuels and bio-based chemicals. Ph.D. thesis. The Ohio State University. Zhao H, Xia S, Ma P Review: use of ionic liquids as green solvents for extractions. J Chem Technol Biotechnol 80: Zheng YN, Li LZ, Xian M, Ma YJ, Yang JM, Xu X, He DZ Problems with the microbial production of butanol. J Ind Microbiol Biotechnol 36: Zhu L, Wei P, Cai J, Zhu X, Wang Z, Huang L, Xu Z Improving the productivity of propionic acid with FBB-immobilized cells of an adapted acid-tolerant Propionibacterium acidipropionici. Bioresour Technol 112: Zhu Y, Liu X, Yang ST Construction and characterization of pta gene-deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotech Bioeng 90: Zhu Y, Wu ZT, Yang ST Butyric acid production from acid hydrolysate of corn fibre by Clostridium tyrobutyricum in a fibrous-bed bioreactor. Process Biochem 38: Zhu Y, Yang ST Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Progr 19: Zhu Y, Yang ST Effect of ph on metabolic pathway shift in fermentation of xylose by Clostridium tyrobutyricum. J Biotechnol 110:

108 Zverlov VV, Berezina O, Velikodvorskaya GA, Schwarz WH Bacterial acetone and butanol production by industrial fermentation in the Soviet Union: Use of hydrolyzed agricultural waste for biorefinery. Appl Microbiol Biotechnol 71:

109 Properties Butanol Ethanol Gasoline Specific gravity at 60 F Energy density (MJ/L) Heat of vaporization (MJ/kg) Air-fuel ratio Research octane number (RON) Motor octane number (MON) Oxygen, wt.% <2.7 Water solubility at 25 (%, v/v) <0.01 Table 2.1 Properties and comparison of butanol, ethanol, and gasoline. 80

110 81 Hosts Gene expression Butanol titer (g/l) References E. coli thil, hbd, crt, bcd-ctfb-ctfa, adhe1/adhe Inui et al., 2008 E. coli thrabc, kivd,adh2, ilva,leuabcd 0.8 Shen and Liao, 2008 E. coli crt,bcd,ctfab,hbd,atob,adhe Atsumi et al., 2008 E. coli crt,bcd,ctfab,hbd,atob,adhe2, gapa 0.58 Nielsen et al., 2009 E. coli pha,hbd,crt,ter,adhe2, aceef.lpd 4.65 Bond-Watts et al., 2011 E. coli atob,adhe2,crt,hbd,ter,fdh 15.0 Shen et al., 2011 B. subtilis crt,bcd,ctfab,hbd,thl,adhe Nielsen et al., 2009 L. brevis crt,bcd,ctfab,hbd 0.3 Berezina et al., 2010 P. putida crt,bcd,ctfab,hbd,thl,adhe Nielsen et al., 2009 S. cerevisiae ERG10, hbd,crt,ccr,adhe Steen et al., 2008 S. cerevisiae goxb, MLS1, DAL7, Leu2, PDC, ADH Branduardi et al., 2013 cyanobacteria ter, atob, adhe2, crrt, hbd Lan and Liao, 2011 C. tyrobutyricum thl, adhe Yu et al., 2011 C. tyrobutyricum thl, adhe2, ackko Yu et al., 2011 Table 2.2 Heterologous expression of clostridial butanol pathway in various alternative platforms. 81

111 82 Strain Reactor type Substrate ABE or IBE production References Titer (g/l) Yield (g/g) Productivity (g/l/h) C. beijerinckii BA101 Batch Glucose Ezeji et al., 2003 C. beijerinckii BA101 Fed-batch Glucose Ezeji et al., 2004 C. beijerinckii BA101 Fed-batch SLCS Ezeji et al., 2007 C. beijerinckii BA101 Continuous Glucose Ezeji et al., 2013 C. acetobutylicum JB200 Fed-batch CBH Lu et al., 2012 C. acetobutylicum JB200 Fed-batch Glucose Xue et al., 2012 C. acetobutylicum JB200 Batch Glucose Xue et al., 2013 C. beijerinckii B593 Batch Glucose Vrije et al., 2013 Repeated-batch xylose Continuous mixture Table 2.3 Enhanced ABE or IBE production in an integrated fermentation and gas stripping process by various clostridial strains. 82

112 Biomass Major compositions (%, dry basis) Cellulose Hemicellulose Lignin Starch (Inulin) Cassava bagasse Corn fiber Corn stover Cotton stalk Jerusalem artichoke Total fiber: (50) Rice straw Sugarcane bagasse Soybean hull Switch grass Wheat straw Table 2.4 Major compositions of some typical cellulosic and lignocellulosic biomass [Howard et al., 2003; Saha, 2003; Silverstein et al., 2007; Alemdar and Sain, 2008; Lu et al., 2012]. 83

113 Substrates ABE production References Titer (g/l) Yield (g/g) Productivity (g/l/h) Corn stover Qureshi et al., 2010a Corn stover Ni et al., 2012 Corn fiber Qureshi et al., 2008a Corn fiber Guo et al., 2013 Corn fiber Du et al., 2013 Degermed corn Ezeji et al., 2007a SLCS Ezeji et al., 2007b Corncob Zhang et al., 2013 Barley straw Qureshi et al., 2010b Barley straw Qureshi et al., 2010b Wheat straw Qureshi et al., 2007 Wheat straw Qureshi et al., 2008a Wheat straw Qureshi et al., 2008b Wheat straw Qureshi et al., 2008c Switchgrass Qureshi et al., 2010b Rice bran Al-Shorgani et al., 2012 DOW Claassen et al., 2000 DOW Claassen et al., 2000 DOW Lopez-contreras et al., 2000 DDGS Ezeji and Blaschek, 2008 DDGS Ezeji and Blaschek, 2008 DDGS Wang et al., 2013 Packing peanuts Jesse et al., 2002 Cheese whey Raganati et al., 2013 OPDC Razak et al., 2013 Wood pulp Survase et al., 2013 Cane molasses Li et al., 2013 Cane molasses Ni et al., 2012 Cassava bagasse Lu et al., 2012 Sagopith residue Linggang et al., 2013 Seaweed Ulva lactuca van der Wal et al., 2013 SLCS: saccharified liquefied corn starch; DOW: domestic organic waste; DDGS: dried distillers' grains and soluble; OPDC, Oil palm decanter cake Table 2.5 ABE production from various renewable feedstocks by solventogenic clostridia. 84

114 Acidogenic phase Solventogenic phase Figure 2.1 Typical metabolic pathways of glucose in solventogenic clostridia [Lutke- Eversloh and Bahl, 2011]. 85

115 Figure 2.2 Metabolic pathways of glucose in wide type C. tyrobutyricum (PTA, phosphotransacetylase; AK, acetate kinase; PTB, phosphotransbutyrylase; BK, butyrate kinase). 86

116 Glucose Biomass 2NADH + 2ATP Pyruvate NADH CoA Fd H 2 hyd Acetate ack ATP X pta CO 2 Acetyl-CoA FdH 2 aad 2NADH adh CoA Ethanol Butyrate ctf buk ptb X Acetoacetyl-CoA Butyryl-CoA 2NADH 2NADH CoA aad bdh Butanol aad: alcohol/aldehyde dehydrogenase; ack: acetae kinase; adh: alcohol dehydrogenase; bdh: butanol dehydrogenase; buk: butyrate kinase; ctf: CoA transferase; hyd: hydrogenase; pta: phosphotransacetylase; ptb: phosphotransbutyrylase Figure 2.3 Putative metabolic pathways of glucose in C. tyrobutyricum mutant with overexpression of clostridial butanol pathway and disruption of acetate and butyrate synthesis pathways [Yu et al., 2011]. 87

117 Figure 2.4 Modular shuttle plasmids for clostridium-e. Coli and modular ClosTron plasmids for gene manipulation within clostridium [Heap et al., 2010]. 88

118 Figure 2.5 Construction of a FBB system and SEM pictures for cell immobilization on the fibrous matrices [Yang, 1996]. 89

119 Chapter 3: Metabolic engineering of Clostridium tyrobutyricum for enhanced butanol synthesis Abstract Fermentative production of butanol as a potential substitute to gasoline has attracted more and more attention due to energy and environment issues. ABE production via solventogenic clostridia usually suffers from low butanol titer and yield. Heterologous butanol synthesis in C. tyrobutyricum via over-expression of adhe gene from solventogenic clostridia was investigated and fermentation performance between adhe over-expressed C. tyrobutyricum mutants and other alternative butanol production platforms was compared in this study. C. tyrobutyricum-adhe mutants were able to produce 100 mg/l butanol, a titer comparable to some other alternative butanol production platforms. Distinct fermentation performances between adhe and adhe2 overexpressed C. tyrobutyricum mutants were also observed, which should be caused by the fact that adhe and adhe2 gene had a couple of fundamental differences in biological functions. In terms of butanol synthesis in C. tyrobutyricum, adhe was not as effective as adhe Introduction Due to growing concerns over global warming issues, rapid depletion of crude oils, a hike in gasoline prices, as well as increasing demand on domestic energy security, the development of biofuels from abundant, renewable, and low-cost raw materials has 90

120 become more and more important and attractive [Durre, 2007]. Butanol, an important industrial chemical and solvent, is now considered as a superior transportation fuel and a promising substitute to gasoline because the properties of butanol are very similar to gasoline, including heating value, energy density, and octane numbers. In addition, biobutanol also presents some other advantages, such as convenient pipeline transportation in current petroleum infrastructures, blending with either gasoline or diesel fuel at any ratio, and low solubility in water [Cascone, 2008]. Actually, butanol can be directly used in the traditional engines without any modification. Biobutanol is usually produced via acetone-butanol-ethanol (ABE) fermentation by solventogenic clostridia, including Clostridium acetobutylicum and Clostridium beijerinckii [Jones and Woods, 1986]. However, these solventogenic clostridia have a couple of inherent drawbacks that make them unfavorable hosts for butanol production, including low butanol yield due to acetone accumulation, low butanol titer and reactor productivity due to low butanol tolerance, and limited genetic modifications due to complicated ABE metabolic pathways [Yu et al., 2011, Ezeji et al., 2010].The biggest problem is that the genetic regulation and metabolic shift from acidogenic phase (acetate and butyrate formation pathway) to solventogenic phase (ABE formation pathway) in solventogenic clostridia is still not well understood, which has greatly increased the uncertainty in process control [Papoutsakis, 2008; Lee et al., 2008]. Heterologous expression of butanol synthesis pathway in other hosts might be a promising strategy to overcome these issues [Lutke-Eversloh and Bahl, 2011]. In fact, various heterologous platforms including E. coli, Bacillus subtilis, Lactobacillus brevis, Pseudomonas putida, Saccharomyces cerevisiae as well as cyanobacteria have been considered for clostridial 91

121 butanol synthesis [Inui et al., 2008; Atsumi et al., 2008; Nielsen et al., 2009; Bond-Watts et al., 2011; Shen et al., 2011; Berezina et al., 2010; Steen et al., 2008; Branduardi et al., 2013; Lan and Liao, 2011]. However, the efficiency is usually low and the mutants are very unstable due to the unpredicted disruption at genetic, molecular, and metabolic levels. Low butanol tolerance might be another problem for butanol synthesis in heterologous platforms [Fischer et al., 2008; Knoshaug and Zhang, 2009]. Recently, C. tyrobutyricum has been considered as a suitable host for heterologous butanol production because its metabolic pathways are very similar to those in solventogenic clostridia [Yu et al., 2011]. It has also demonstrated favorable metabolic pathway from glucose to butyryl-coa, higher butanol yield due to no acetone generation, and higher butanol tolerance than solventogenic clostridia [Yu et al., 2011]. Most importantly, heterologous butanol production in C. tyrobutyricum is less likely to involve in sporulation, cell autolysis, and metabolic shift, the major factors that could limit butanol production in native solventogenic clostridia [Yu et al., 2011]. Previously, aldehyde/alcohol dehydrogenase 2 (adhe2) from C. acetobutylicum ATCC824 was successfully introduced into C. tyrobutyricum; and the adhe2-overexpressed mutants were able to produce significant amount of butanol (~ 10.0 g/l) with a relatively high butanol yield (> 0.20 g/g) [Yu et al., 2011]. So far, two types of aldehyde/alcohol dehydrogenase genes have been identified in solventogenic clostridia including adhe and adhe2 [Nair et al., 1994; Fontaine et al., 2002]. Although both of them carry the functions of converting butyryl-coa to butanol and also acetyl-coa to ethanol, they present a couple of inherent differences. First, adhe is part of the sol operon (a set of adhe, ctfa, ctfb, and adc genes), which plays an 92

122 important role in the balance of CoA intermediate products and end products [Fischer et al., 1993] whereas adhe2 is located in the upstream of adhe gene and is not a part of the sol operon [Fontaine et al., 2002]. Second, adhe is expressed in solventogenic phase which requires low ph (ph 4.5) whereas the expression of adhe2 requires high NADH availability and neutral ph (ph 6.5) during the alcohologenic phase [Fontaine et al., 2002]. Moreover, adhe2 prefers to catalyze the conversion of butyryl-coa to butanol while adhe does not have such a preference. Previous results have demonstrated that butanol yield in adhe2-overexpressed C. tyrobutyricum mutants was similar to or even lower than that in native solventogenic clostridia due to the fact that acetic and butyric acids were still generated as the major byproducts in these mutants [Yu et al., 2011]. Knock-out of acetate and butyrate synthesis pathways in C. tyrobutyricum has a potential to improve butanol yield by directing more carbon flux towards butanol synthesis pathway. It has been reported that inactivation of acetic acid formation route in C. tyrobutyricum could significantly improve butyric acid titer and yield whereas a lower butyrate concentration and B/A ratio (butyrate/acetate ratio) was obtained in the ptb/buk knockout mutants [Zhu et al., 2004; Liu et al., 2006]. In addition, C. tyrobutyricum mutants with adhe2-overexpression and ack/pta or ptb/buk knockout presented a significantly higher butanol production than the control with only adhe2 gene [Yu et al., 2011]. The recently developed ClosTron gene knockout system, which provides various replicons, different selection markers, a multiple cloning site, and blue/white screening strategy, has made directed mutagenesis of specific genes in clostridium species easier, faster, more stable and reliable [Heap et al., 2009, 2010]. In addition, by using flippase- 93

123 mediated marker rescue system, developing clostridial mutants with multiple knockouts of targeted genes can be easily realized [Sadowski, 1995; Cherepanov and Wackernagel, 1995; Hoang et al., 1998; Heap et al., 2010]. In fact, the ClosTron gene knockout system has become a powerful tool for gene manipulations in clostridium species to study the functions of specific genes [Emerson et al., 2009; Kirby et al., 2009; Twine et al., 2009; Jia et al., 2011; Kuit et al., 2012; Cooksley et al., 2013], to understand the regulations involved in metabolic pathways [Underwood et al., 2009; Cai et al., 2011; Lehmann et al., 2012], as well as to achieve heterologous expressions [Yu et al., 2011; Yu et al., 2012]. In this study, heterologous butanol production via overexpressing adhe gene in C. tyrobutyricum was achieved. Fermentation performances between adhe and adhe2 overexpressed C. tyrobutyricum mutants as well as other alternative butanol production platforms were compared and discussed. In addition, single knockout of either acetate (pta/ack) or butyrate (ptb/buk) pathway in C. tyrobutyricum was realized by using ClosTron gene knockout system to evaluate the effects of gene inactivations on fermentation kinetics. 3.2 Materials and methods Bacterial strain and media C. tyrobutyricum wild type (C. tyrobutyricum ATCC 25755) and mutant strain CtΔack developed by partially knockout of acetate biosynthesis pathway (knockout of ack gene) was used in this study [Liu et al., 2006]. The stock culture of C. tyrobutyricum ATCC and CtΔack was maintained anaerobically at -85 o C in Reinforced Clostridial Medium (RCM; Difco, Detroit, MI). Unless otherwise noted, all fermentation studies 94

124 were carried out at 37 o C in the Clostridium Growth Medium (CGM) containing 60 g/l glucose, 2 g/l yeast extract, 4 g/l trypticase peptone, 2 g/l (NH 4 ) 2 SO 4, 1 g/l K 2 HPO 4, 1 g/l KH 2 PO 4, 0.1 g/l MgSO 4.7H 2 O, g/l FeSO 4.7H 2 O, g/l CaCl 2.2H 2 O, 0.01 g/l MnSO 4.H 2 O, 0.02 g/l CoCl 2.6H 2 O, g/l ZnSO 4.7H 2 O Plasmids construction The adhe2 gene under the control of native thiolase (thl) promoter have been successfully cloned and transferred into C. tyrobutyricum previously [Yu et al., 2011]. Similar procedures were adopted to clone and transfer adhe gene into C. tyrobutyricum as described by Yu et al [Yu et al., 2011], as shown in Figure 3.1. Specifically, gene adhe was amplified from C. acetobutylicum ATCC 824 genomic DNA by PCR using forward primer:gaaacagctatgaccttaaggttgttttttaaaacaatttatatacatt -TC and reverse primer: ATTTAAATTTGGATCATAAATATTTAGGAGGAATAGTC -ATGAAAGTCACAACAGTAA. The PCR product was purified and digested with XbaI and XmaI, and then ligated into plasmid pmtl82151 [Heap et al., 2009] digested with the same restriction enzymes to generate recombinant pmtl82151-adhe. Promoter thl was amplified from C. tyrobutyricum ATCC genomic DNA by PCR using forward primer: AGCTAAGCTTCTGAATATTCAGCGAAAATAG and reverse primer: TCTACCGCGGACGTCGGATCCAAATTTAAATTGATTACAAACCTTTTTACC. The PCR product was purified and digested with XmaI and EcoRI, and then ligated into recombinant plasmid pmtl82151-adhe digested with the same restriction enzymes to generate the final butanol-expressing plasmid pmtl82151-thl-adhe (p82ta1). All recombinant plasmids were transformed into E. coli DH5α for plasmid amplification and 95

125 purification. The purified plasmids were verified by enzyme digestion, gel analysis, colony PCR, and DNA sequencing before transformation into E. coli CA434, as shown in Figure 3.2. Another strategy was also used to construct the adhe-expressing plasmid. Instead of cloning thl gene and adhe gene and ligating them on plasmid pmtl82151 separately, the adhe2 gene from the plasmid pmtl82151-thl-adhe2 was cut down and the adhe gene was directly inserted by using in-fusion cloning system, as shown in Figure 3.3. Specifically, adhe gene was amplified from C. acetobutylicum ATCC 824 genomic DNA by PCR using special primers designed by following the instructions of in-fusion cloning system protocol. Plasmid pmtl82151-thl-adhe2 (pmad22), constructed and confirmed by Yu et al [Yu et al., 2011], was treated with BamHI and SacII to remove adhe2 gene. The fragment of the enzyme-digested pmad22 was recovered and purified via gel extraction and mixed with the PCR-amplified adhe gene in the in-fusion cloning reaction buffer to allow the ligation of adhe gene onto the fragment. The ligasing product was transformed into E. coli DH5α for plasmid amplification and extraction. The newly constructed plasmid pmtl82151-thl-adhe-2 (p82ta2) was verified by colony PCR and DNA sequencing, as seen in Figure 3.4. By following the instructions, the intron region for re-targeting pta/ack or ptb was designed online ( and single knockout clostron plasmids (pmtl007c-e2::ct-ack-334s, pmtl007c-e2::ct-pta-142s, and pmtl007c-e2::ctptb-342s, respectively) containing the re-targeted intron sequences were constructed and ordered commercially. Briefly, design of the re-targeted intron for single knockout of pta/ack or ptb gene was finished via the free-of-charge easy-to-use design tool online 96

126 ( Then, construction of the clostron plasmid, which contains the retargeted intron for directed mutagenesis of the selected site, was completed by a DNA synthesis company, who synthesized the intron targeting region and cloned it into a modular ClosTron plasmid Plasmids transformation Transformation of plasmids p82ta1 and p82ta2 into C. tyrobutyricum wild type and Δack mutant via conjugation was also described previously [Purdy et al., 2002, Heap et al., 2009, Yu et al., 2011]. Briefly, p82ta1 or p82ta2 was first transformed into a donor strain E. coli CA434 by electroporation. Then a single colony of the p82at1 or p82ta2- transformed E. coli CA434 was picked up and cultured in the LB medium supplemented with 30 ug/ml chloramphenicol at 37 o C and 250 rpm overnight to early log phase (OD600~1.5). Donor cells were collected from 1.0 ml of the overnight cultured medium by centrifuging and then washed in 1.0 ml of sterile phosphate-buffered saline (PBS) solution to remove trace antibiotics. After centrifugation again, the donor cell pellet was re-suspended in 200 μl of the recipient cells, C. tyrobutyricum wild type or Δack mutant, respectively. The recipient cells was cultured anaerobically in reinforced clostridial medium (RCM) at 37 o C overnight to mid-log phase (OD600~2.5). The mixture of donor and recipient cells was then pipetted onto a RCM plate drop-by-drop and incubated at 37 o C for 24 hours under anaerobic conditions. Cells on the conjugation plate was recovered using an inoculation loop and re-suspended in 1.0 ml RCM, followed by re-plating the cells on selective RCM plates supplemented with 30 ug/ml thiamphenicol for selection of C. tyrobutyricum mutants containing target plasmid and 250 ug/ml D-cycloserine for counter selection of donor strain, E. coli CA434. Selective RCM plates were incubated at 97

127 37 o C under anaerobic conditions for 3-5 days until the presence of single colonies. Transformation of single knockout clostron plasmids (pmtl007c-e2::ct-ack-334s, pmtl007c-e2::ct-pta-142s, and pmtl007c-e2::ct-ptb-342s, respectively) into C. tyrobutyricum wild type was also completed by conjugation Isolation of single knockout mutants The clostron mutagenesis procedure can be divided into four steps: re-targeted intron design, plasmid construction, plasmid transfer and mutant isolation [Heap et al., 2010]. The plasmid-containing mutants was screened and selected in the growth medium supplemented with thiamphenicol or spectinomycin. In order to isolate the desired mutants with inactivated target site, the plasmid-containing colonies was re-streaked onto growth medium supplemented with erythromycin, which can kill the undesired mutants. Therefore, by subculturing the transformants on RCM plates supplemented with 30 ug/ml thiamphenicol, plasmid-containing C. tyrobutyricum mutants were screened and selected. Then, the selected mutants were re-streaked onto RCM plates supplemented with 40 ug/ml erythromycin to identify and isolate C. tyrobutyricum mutants with desired mutagenesis Fermentation kinetics in serum bottles Tests of fermentation kinetics of selected mutants (adhe-overexpressed C. tyrobutyricum mutants and pta/ack or ptb single knockout C. tyrobutyricum mutants) were carried out in serum bottles. Each bottle containing 50 ml CGM medium was inoculated with 1.0 ml active cells of selected mutants from an overnight culture in RCM at 37 o C anaerobically. After inoculation, these serum bottles were incubated at 37 o C with ph adjusted to

128 once a day by adding 10% (w/v) NaOH solution. Samples were taken periodically to monitor cell growth, glucose consumption, and metabolites (ethanol, butanol, acetic acid, butyric acid, and lactate) production during the fermentation Analytical methods Cell growth was determined by measuring the optical density of suspended cells at 600 nm with a proper dilution rate using a spectrophotometer (UV-16-1, Shimadzu, Columbia, MD). The concentrations of volatile metabolites, including ethanol, acetic acid, butanol, and butyric acid were analyzed by a gas chromatography (GC-2014, Shimadzu, Columbia, MD) equipped with a flame ionization detector (FID), a Zebron ZB-FFAP capillary GC column (column length 30 m, internal diameter 0.25 mm and film thickness 0.25 μm, Phenomenex, Torrance, CA), and an auto sampler (AOC-20i, Shimadzu, Columbia, MD). For sample analysis, the temperature for both injector and detector was set at 250 o C. The temperature for the column was initially held at 60 o C for 3 minutes, then increased to 150 o C at a constant rate of 30 o C per minute, and finally held at 150 o C for 4 minutes. Glucose concentration was determined by using a high performance liquid chromatography (LC-20AD, Shimadzu, Columbia, MD) equipped with a refractive index detector (RID) and a Rezex ROA-Organic Acid H + column (300 mm 7.80 mm, Phenomenex, Torrance, CA). For sample analysis, N H 2 SO 4 was used as the mobile phase with a flow rate of 0.6 ml/min and an injection volume of 15 μl. 99

129 3.3 Results and discussion Heterologous expression of adhe gene in C. tyrobutyricum The adhe2 gene under the control of native thiolase (thl) promoter have been successfully cloned and transferred into C. tyrobutyricum previously [Yu et al., 2011]. In order to compare the difference of two aldehyde/alcohol dehydrogenase genes, adhe and adhe2, adhe gene was heterologously expressed in C. tyrobutyricum wild type and Δack mutant, as shown in Figure 3.1. The construction and transformation of plasmids were verified by enzyme digestion and colony PCR, as shown in Figure 3.2, which confirmed that gene adhe and promoter thl was successfully inserted into plasmid pmtl Single colonies from the selective RCM plates were picked up for the test of fermentation kinetics in serum bottles with CGM medium. The fermentation performance of selected mutants, five for adhe over-expressed C. tyrobutyricum wild type mutants (CTWT1 (p82ta1) - CTWT5 (p82ta1)) and five for adhe over-expressed C. tyrobutyricum Δack mutants (CTΔack1 (p82ta1) CTΔack5 (p82ta1)), was given in Table 3.1. It is clear that all of the adhe over-expressed C. tyrobutyricum mutants including CTWT (p82ta1) and CTΔack (p82ta1) demonstrated the ability to produce butanol, although the butanol titers were very low (only ~ 50 mg/l for CTWT (p82ta1) mutants and ~ 100 mg/l for CTΔack (p82ta1) mutants). It is also interesting to note that compared to CTWT (p82ta1) mutants, higher butanol titers (100 mg/l vs. 50 mg/l) and lower acetate titers (< 2.0 g/l vs. > 2.0 g/l), butyrate titers (< 8.0 g/l and > 8.0 g/l), and specific growth rates (~ /h vs. ~ /h) were observed in the CTΔack (p82ta1) mutants, except for CT Δack3 (p82ta1) mutant, which had a similar fermentation performance to CTWT 100

130 (p82ta1) mutants. The higher carbon flux towards butanol synthesis pathway in CTΔack (p82ta1) mutants might be caused by the fact that ack gene, which is responsible for acetic acid synthesis, in these mutants was partially inactivated to reduce the generation of acetate and redirect more carbon flux from acetyl-coa to butyryl-coa [Zhu et al., 2004; Liu et al., 2006]. Interestingly, butyric acid production in these mutants was also decreased due to the disruption of ack gene, probably because the activity of CoA transferases, which play an important role in the balance of CoA intermediate products and end products, was also partially disrupted by gene deletion [Fischer et al., 1993]. It has been reported that the disruption of pta and ack gene in C. tyrobutyricum can significantly reduce the activities of PTA and AK [Zhu et al., 2004; Liu et al., 2006]. In addition, C. tyrobutyricum mutant (ackkopmad72) with overexpression of adhe2 and inactivation of ack presented a significantly higher butanol titer and yield than the control cloned with adhe2 gene alone [Yu et al., 2011]. Similar results were observed on C. tyrobutyricum mutant (ptbkopmad72) with overexpression of adhe2 and inactivation of ptb [Yu et al., 2011]. Our results are consistent with these observations. At first, I thought that the extremely low butanol titers in CTWT (p82ta1) and CTΔack (p82ta1) mutants might be due to the absence of the native promoter, thl gene, since the DNA sequence of this gene was not detected during the sequencing analysis of the recombinant plasmid p82ta1. Therefore, another strategy was used to construct the adhe-expressing plasmid by cutting down the adhe2 gene from the plasmid pmtl82151-thl-adhe2 and directly inserting the adhe gene via in-fusion cloning system, instead of cloning thl and adhe and ligating them on plasmid pmtl82151 separately (see 101

131 Figure 3.3). The replace of adhe2 gene and insertion of adhe gene into plasmid pmtl82151-thl-adhe was verified by colony PCR, as shown in Figure 3.4. Again, single colonies, five for adhe over-expressed C. tyrobutyricum wild type mutants (CTWT (p82ta2)) and five for adhe over-expressed C. tyrobutyricum Δack mutants (CTΔack (p82ta2)) from the selective RCM plates were picked up for the test of fermentation kinetics in serum bottles with CGM medium. Unfortunately, no butanol production was detected in the selected mutants this time. It is clear that butanol production in adhe over-expressed C. tyrobutyricum mutants is not comparable to that in adhe2 over-expressed C. tyrobutyricum mutants, which were able to produce nearly 10.0 g/l butanol [Yu et al., 2011; Yu et al., 2012]. There are a couple of reasons for the distinct fermentation performances between adhe and adhe2 over-expressed mutants. First, as a part of the sol operon, which contains a set of adhe, ctfa, ctfb, and adc genes, adhe plays an critical role in the balance of CoA intermediate products such as acetyl- CoA, acetoacetyl-coa, and butyryl-coa, and end products including acetate, ethanol, acetone, butyrate, and butanol [Fischer et al., 1993]. Gene adhe2, however, is located in the upstream of adhe gene and is not a part of the sol operon [Fontaine et al., 2002]. Therefore, based on the assumption that the expressions of genes involved in sol operon (adhe, ctfa, ctfb, and adc) are closely coupled with each other, the biological function of adhe gene might be greatly limited by heterologous expression of adhe gene alone in C. tyrobutyricum since adc, a key gene involved in acetone synthesis pathway, is absent in wild type C. tyrobutyricum. Heterologous expression of adhe2 gene alone in C. tyrobutyricum, however, is not affected by this issue because it is not a part of the sol operon. Second, it has been reported that solventogenic clostridia can be maintained at 102

132 different metabolic states in response to different culture conditions [Girbal et al., 1995; Girbal and Soucaille, 1998]. Acidogenic phase during which acetic and butyric acids synthesis pathways are activated usually requires neutral ph (6-7) whereas solventogenic phase during which acetate and butyrate are reassimilated and consumed to produce acetone, butanol, and ethanol usually requires low ph (4-5). Alcohologenic phase during which butanol and ethanol are generated without acetone formation is a special metabolic state, which only occurs at neutral ph with high NADH availability [Girbal et al., 1995; Girbal and Soucaille, 1998]. Gene adhe is usually expressed during solventogenic phase whereas adhe2 is only expressed during alcohologenic phase [Fontaine et al., 2002]. The extremely low butanol titer in adhe over-expressed C. tyrobutyricum mutants might be resulted from the poor culture conditions which are unfavorable for the expression of adhe gene. Third, it should be noted that adhe2 prefers to catalyze the conversion of butyryl-coa to butanol while adhe does not have such a preference, another factor that might lead to higher butanol production in adhe2 over-expressed C. tyrobutyricum mutants [Fontaine et al., 2002]. Finally, a recent research has demonstrated that the transcription of sol operon including adhe gene was regulated by a common repressor protein, SolR, whose gene (solr) is located upstream of the adhe gene, another important feature that might limit butanol production in adhe over-expressed C. tyrobutyricum mutants [Harris et al., 2001]. In addition to C. tyrobutyricum, heterologous expression of clostridial butanol pathway has been realized in various bacterial hosts including E. coli, Bacillus subtilis, Lactobacillus brevis, Pseudomonas putida, Saccharomyces cerevisiae as well as cyanobacteria [Inui et al., 2008; Atsumi et al., 2008; Nielsen et al., 2009; Bond-Watts et 103

133 al., 2011; Shen et al., 2011; Berezina et al., 2010; Steen et al., 2008; Branduardi et al., 2013; Lan and Liao, 2011]. Table 3.2 compares the attempts of heterologous butanol production in various alternative platforms. It is clear that E. coli was the mostly wellstudied microorganism for heterologous butanol synthesis because of its well-understood metabolic pathways and abundant and readily available genetic tools. Early attempts on heterologous butanol production in E. coli have been focused on demonstrating the butanol producing ability of this bacterium by simply introducing clostridial butanol synthesis pathway into E. coli, which had a butanol titer ranging from 0.55 g/l to 1.18 g/l [Inui et al., 2008; Atsumi et al., 2008; Shen and Liao, 2008; Nielsen et al., 2009]. Recently, based on an enzymatic chemical reaction mechanism or by creating an irreversible reaction catalyzed by Ter (trans-enoyl-coenzyme A reductase) and implementing NADH and acetyl-coa driving forces, high-titer and high-yield butanol production was successfully achieved in E. coli, which was comparable to butanol production by native solventogenic clostridia [Bond-Watts et al., 2011; Shen et al., 2011]. However, heterologous expression of clostridial butanol pathway in other bacterial hosts including B. subtilis, L. brevis, P. putida, S.cerevisiae, and cyanobacteria presented extremely low butanol titers, ranging from 2.5 mg/l to 300 mg/l, which were apparently not competitive to butanol production via ABE fermentation by solventogenic clostridia [Nielsen et al., 2009; Berezina et al., 2010; Steen et al., 2008; Branduardi et al., 2013; Lan and Liao, 2011]. In this study, 100 mg/l butanol was produced in adhe overexpressed C. tyrobutyricum mutants, although the adhe2 over-expressed C. tyrobutyricum mutants can produce butanol at a titer as high as 10.0 g/l [Yu et al., 2011]. It should be noted that adhe2 rather than adhe was used in most of the alternative 104

134 butanol production platforms, indicating that in terms of heterologous butanol synthesis, adhe2 was more favorable than adhe. Since promoter plays an important role in controlling the expression levels of specific genes, utilization of stronger promoters with more specific roles and higher enzyme activities to replace the native promoter thl might be a promising strategy to improve butanol production in adhe over-expressed C. tyrobutyricum mutants. The most attractive candidate is the sol promoter coming from C. acetobutylicum sol operon (adhe is a part of this operon), which is responsible for producing solvents in solventogenic clostridia [Fischer et al., 1993; Nolling et al., 2001]. Another interesting candidate is the phosphotransbutyrylase (ptb) promoter, coming from C. acetobutylicum ptb-buk operon, because previous studies have demonstrated that the expression levels from ptb promoter were significantly higher than those from other promoters, such as sol promoter and thl promoter [Tummala et al., 1999; Feustel et al., 2004; Heap et al., 2007]. Process development and optimization such as using a more suitable medium and applying a more stable ph control is another effective approach to improve butanol production. Nevertheless, adhe gene was successfully cloned and transferred into C. tyrobutyricum and the selected mutants demonstrated the ability to produce butanol at a comparable level to other alternative heterologous butanol synthesis platforms Knockout of acetate and butyrate synthesis pathways in C. tyrobutyricum As mentioned before, knockout of acetate or butyrate synthesis pathway or both pathways is a highly possible approach to reduce the generation of acetic and butyric acids and redirect more carbon flux towards butanol synthesis pathway. In order to confirm this strategy, single knockout of pta/ack gene involved in acetate synthesis 105

135 pathway or ptb gene involved in butyrate synthesis pathway was first carried out by using the newly developed clostron gene knockout system [Zhu et al., 2004; Liu et al., 2006; Zhang et al., 2012]. The fermentation performance of selected mutants (four for each mutagenesis including single knockout of ack, pta, or ptb gene) was given in Table 3.3. Surprisingly, compared to the control (wild type C. tyrobutyricum), all of the selected mutants with single knockout (ackko, ptako, or ptbko) except for CTptaKO-4, had higher acetate titers (> 1.70 g/l vs. < 1.50 g/l), lower butyrate titers (~ 6.0 g/l vs. ~ 9.0 g/l), and significantly higher acetate/butyrate ratios (> 0.25 vs. ~ 0.16) than the control, which is out of my expectation because ackko or ptako mutants were supposed to produce less acetate and more butyrate than the control whereas ptbko mutants were expected to produce more acetate and less butyrate than the control. It seems that CTptaKO-4 mutant is the only one that possessed the desired mutagenesis, which presented a slightly lower acetate titer (1.35 g/l vs g/l), a little bit higher butyrate titer (9.15 g/l vs g/l), and lower acetate/butyrate ratio (0.148 vs ) than the control. In addition, butyrate yield in CTptaKO-4 mutant (0.351 g/g) was significantly higher than that in the control (0.317 g/g), although the acetate yield was similar in both strains (0.050 g/g). Knock-out of acetate (ack/pta gene) and butyrate (ptb gene) synthesis pathways in C. tyrobutyricum has been achieved in previous studies which reported that the disruption of pta and ack gene in C. tyrobutyricum can significantly reduce the activities of PTA and AK, resulting in an increase in butyrate titer and yield, although the final concentration of acetate was also slightly increased [Zhu et al., 2004; Liu et al., 2006]. Similar results were obtained in ptb-knockout C. tyrobutyricum mutants, which demonstrated a 106

136 reduction in PTB enzyme activity, a remarkable improvement in acetate titer and yield, as well as a slight increase in butyrate titer [Zhang et al., 2012]. Genetic manipulations of acetate and butyrate synthesis pathways by gene inactivation in solventogenic clostridia such as C. acetobutylicum have been extensively studied [Lee et al., 2008]. Green et al. disrupted acetate and butyrate formation pathways in C. acetobutylicum ATCC 824 by inactivating pta or buk gene using homologous recombination, and confirmed that inactivation of pta gene significantly reduced PTA and ACK enzyme activity and acetate production whereas inactivation of buk gene resulted in a significant decrease in BUK enzyme activity and butyrate production [Green et al., 1996]. Similar results were obtained by Harris et al, who reported a remarkable improvement in acetate production by disrupting buk gene in C. acetobutylicum [Harris et al., 2000]. By using a group II intron (targetron) vector, Shao et al. successfully disrupted the buk gene in C. acetobutylicum and improved butanol production [Shao et al., 2007]. Recently, by using ClosTron gene knockout system, Kuit et al. evaluated the effects of ack gene inactivation on fermentation performance of C. acetobutylicum and found that ack knockout mutant demonstrated a 97% reduction in AK enzyme activity and a decreased and delayed acetate production whereas increased acetoin, ethanol, and butanol production [Kuit et al., 2012]. With the help of the same strategy (ClosTron technology), Lehmann et al. successfully obtained five knockout mutants with inactivation of key genes involved in central metabolic pathways, including pta, adc, ctfa, and ctfb [Lehmann et al., 2012]. They reported that no significant effect on fermentation profiles was observed in ack knockout mutant, which was inconsistent with previous results, although a significantly reduced solvent production was found in other mutants [Lehmann et al., 2012]. In this 107

137 study, disruption of either acetate or butyrate synthesis pathway in C. tyrobutyricum led to an increase in acetate production, a decrease in butyrate production, as well as a significantly higher acetate/butyrate ratio, indicating the presence of some unknown pathways that can synthesize acetate and butyrate using genes other than ack/pta and buk/ptb. Nevertheless, double knockout of both acetate and butyrate formation pathways in C. tyrobutyricum should be a promising strategy to significantly reduce acids generation. 3.4 Conclusion Heterologous expression of clostridial butanol pathway with over-expression of adhe gene as well as single knockout of either acetate or butyrate synthesis pathway by inactivating ack/pta or ptb gene in C. tyrobutyricum was investigated in this study. Gene adhe under the control of native promoter thl was successfully cloned and transferred into C. tyrobutyricum and various mutants were obtained, which demonstrated the ability to produce butanol at a titer of ~ 100 mg/l. Although this titer cannot be comparable with that in adhe2 over-expressed C. tyrobutyricum mutants and the recently developed butanol-producing E. coli mutants, it presented a similar butanol production to other alternative platforms. Utilization of stronger promoters as well as process development and optimization might significantly improve butanol production in adhe over-expressed C. tyrobutyricum mutants. Disruption of either ack/pta gene involved in acetate synthesis pathway or ptb gene involved in butyrate synthesis pathway in C. tyrobutyricum increased acetate production, decreased butyrate generation, and remarkably improved acetate/butyrate ratio, which was partially inconsistent with previous studies on genetic manipulations of acid formation pathways in solventogenic clostridia. However, double 108

138 knockout of both acetate and butyrate biosynthesis pathways in C. tyrobutyricum should be a promising strategy to significantly reduce acids generation. This study has demonstrated the distinct fermentation performances between adhe and adhe2 overexpressed C. tyrobutyricum mutants, confirming that these two genes had a couple of fundamental differences such as locations in genome, roles in metabolic regulation, transcriptional levels, and expression conditions, although both of them carry the functions of converting butyryl-coa to butanol and acetyl-coa to ethanol. In addition, it was confirmed that in terms of heterologous butanol synthesis in alternative platforms, adhe is not as effective as adhe References Atsumi S, Cann AF, Connor MR, Shen CR, Smith KM, Brynildsen MP, Chou KJY, Hanai T, Liao JC Metabolic engineering of Escherichia coli for 1-butanol production. Metab Eng 10: Berezina OV, Zakharova NV, Brandt A, Yarotsky SV, Schwarz WH, Zverlov VV Reconstructing the clostridial n-butanol metabolic pathway in Lactobacillus brevis. Appl Microbiol Biotechnol 87: Bond-Watts BB, Bellerose RJ, Chang MCY Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways. Nat Chem Biol 7: Branduardi P, Longo V, Berterame NM, Rossi G, Porro D A novel pathway to produce butanol and isobutanol in Saccharomyces cerevisiae. Biotechnol Biofuels 6: Cai G, Jin B, Saintd C, Monisc P Genetic manipulation of butyrate formation pathways in Clostridium butyricum. J Biotechnol 155: Cascone R Biobutanol-A replacement for bioethanol? Chem Eng Prog 104:S4-S8. Cherepanov PP, Wackernagel W Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene, 158:

139 Cooksley CM, Zhang Y, Wang HZ, Redl S, Winzer K, Minton NP Targeted mutagenesis of the Clostridium acetobutylicum acetone-butanol-ethanol fermentation pathway. Metab Eng 14: Durre P Biobutanol: An attractive biofuel. Biotechnol J 2: Emerson JE, Reynolds CB, Fagan RP, Shaw HA, Goulding D, Fairweather NF A novel genetic switch controls phase variable expression of CwpV, a Clostridium difficile cell wall protein. Mol Microbiol 74: Ezeji T, Milne C, Price ND, Blaschek HP Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl Microbiol Biotechnol 85: Feustel L, Nakotte S, Durre P Characterization and development of two reporter gene systems for Clostridium acetobutylicum. Appl Environ Microbiol 70: Fischer CR, Klein-Marcuschamer D, Stephanopoulos G Selection and optimization of microbial hosts for biofuels production. Metab Eng 10: Fischer RJ, Helms J, Durre P Cloning, sequencing, and molecular analysis of the sol operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J Bacteriol 175: Fontaine L, Meynial-Salles I, Girbal L, Yang XH, Croux C, Soucaille P Molecular characterization and transcriptional analysis of adhe2, the gene encoding the NADHdependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol 184: Girbal L, Croux C, Vasconcelos I, Soucaille P Regulation of metabolic shifts in Clostridium acetobutylicum ATCC824. FEMS Microbiol Rev 17: Girbal L, Soucaille P Regulation of solvent production in Clostridium acetobutylicum. Trends Biotechnol 16:1-16. Green EM, Boynton ZL, Harris LM, Ruldolph FB, Papoutsakis ET, Bennett GN Genetic manipulation of acid formation pathways by gene inactivation in Clostridium acetobutylicum ATCC 824. Microbiology 142: Harris LM, Blank L, Desai RP, Welker NE, Papoutsakis ET Fermentation characterization and flux analysis of recombinant strains of Clostridium acerobutylicum with an inactivated solr gene. J Ind Microbiol Biotechnol 27: Harris LM, Desai RP, Welker NE, Papoutsakis ET Characterization of recombinant strains of the Clostridium acetobutylicum butyrate kinase inactivation 110

140 mutant: Need for new phenomenological models for solventogenesis and butanol inhibition? Biotechnol Bioeng 67:1-11. Heap JT, Kuehne SA, Ehsaan M, Cartman ST, Cooksley CM, Scott JC, Minton NP The ClosTron: mutagenesis in Clostridium refined and streamlined. J Microbiol Methods 80: Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP The clostron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods 70: Heap JT, Pennington OJ, Cartman ST, Minton NP A modular system for Clostridium shuttle plasmids. J Microbiol Methods 78: Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP A broad-hostrange Flp-FRT recombination system for site-specific excision of chromosomallylocated DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212: Inui M, Suda M, Kimura S, Yasuda K, Suzuki H, Toda H, Yamamoto S, Okino S, Suzuki N, Yukawa H Expression of Clostridium acetobutylicum butanol synthetic genes in Escherichia coli. Appl Microbiol Biotechnol 77: Jia K, Zhu Y, Zhang Y, Li Y Group II Intron-Anchored Gene Deletion in Clostridium. Plos one 6:1-10. Jones DT, Woods DR Acetone butanol fermentation revisited. Microbiol Rev 50: Kirby JM, Ahern H, Roberts AK, Kumar V, Freeman Z, Acharya KR, Shone CC Cwp84, a surface-associated, cysteine protease, plays a role in the maturation of the surface layer of Clostridium difficile. J Biol Chem 284: Knoshaug EP, Zhang M Butanol tolerance in a selection of microorganisms. Appl Biochem Biotechnol 153: Kuit W, Minton NP, López-Contreras AM, Eggink G Disruption of the acetate kinase (ack) gene of Clostridium acetobutylicum results in delayed acetate production. Appl Microbiol Biotechnol 94: Lan IE, Liao JC Metabolic engineering of cyanobacteria for 1-butanol production from carbon dioxide. Metab Eng13: Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung SK Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: Lehmann D, Hönicke D, Ehrenreich A, Schmidt M, Weuster-Botz D, Bahl H, Lütke- Eversloh T Modifying the product pattern of Clostridium acetobutylicum: 111

141 Physiological effects of disrupting the acetate and acetone formation pathways. Appl Microbiol Biotechnol 94: Liu X, Zhu Y, Yang ST Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Progr 22: Lutke-Eversloh T, Bahl H Metabolic engineering of Clostridium acetobutylicum: recent advances to improve butanol production. Curr Opin Biotechnol 22: Nair RV, Bennett GN, Papoutsakis ET Molecular characterization of an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC 824. J Bacteriol 176: Nielsen DR, Leonard E, Yoon SH, Tseng HC, Yuan C, Prather KLJ Engineering alternative butanol production platforms in heterologous bacteria. Metab Eng 11: Nolling J, Breton G, Omelchenko MV, Makarova KS, Zeng Q, Gibson R, Lee HM, Dubois J, Qiu D, Hitti J, Wolf YI, Tatusov RL, Sabathe F, Doucette-Stamm L, Soucaille P, Daly MJ, Bennett GN, Koonin EV, Smith DR Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J Bacteriol 183: Papoutsakis ET Engineering solventogenic clostridia. Curr Opin Biotechnol 19: Purdy D, O Keeffe TAT, Elmore M, Herbert M, McLeod A, Bokori-Brown M, Ostrowski A, Minton NP Conjugative transfer of clostridial shuttle vectors from Escherichia coli to Clostridium difficile through circumvention of the restriction barrier. Mol Microbiol 46: Sadowski PD The Flp recombinase of the 2-Mu-M plasmid of Saccharomyces cerevisiae. Prog Nucleic Acid Res Mol Biol, 51: Shao L, Hu S, Yang Y, Gu Y, Chen J, Yang Y, Jiang W, Yang S Targeted gene disruption by use of a group II intron (targetron) vector in Clostridium acetobutylicum. Cell Research 17: Shen CR, Lan EI, Dekishima Y, Baez A, Cho KM, Liao JC Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl Environ Microbiol 77: Shen CR, Liao JC Metabolic engineering of Escherichia coli for 1-butanol and 1- propanol production via the keto-acid pathways. Metab Eng 10:

142 Steen EJ, Chan R, Prasad N, Myers S, Petzold CJ, Redding A, Ouellet M, Keasling JD Metabolic engineering of Saccharomyces cerevisiae for the production of n- butanol. Microb Cell Fact 7:36. Tummala SB, Welker NE, Papoutsakis ET Development and characterization of a gene expression reporter system for Clostridium acetobutylicum ATCC824. Appl Environ Microbiol 65: Twine SM, Reid CW, Aubry A, McMullin DR, Fulton KM, Austin J, Logan SM Motility and flagellar glycosylation in Clostridium difficile. J Bacteriol 191: Underwood S, Guan S, Vijayasubhash V, Baines SD, Graham L, Lewis RJ, Wilcox MH, Stephenson K Characterisation of the sporulation initiation pathway of Clostridium difficile and the role in toxin production. J Bacteriol 191: Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol 93: Yu M, Zhang Y, Tang IC, Yang ST Metabolic engineeringof Clostridium tyrobutyricum for n-butanol production. Metab Eng 13: Zhang Y, Yu M, Yang ST Effects of ptb knockout on butyric acid fermentation by Clostridium tyrobutyricum. Biotechnol Progr 28: Zhu Y, Liu X, Yang ST Construction and characterization of pta gene-deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotech Bioeng 90:

143 adhe-c. tyrobutyricum μ Butanol Acetate Butyrate Mutants 1/h g/l g/l g/l CTWT1 (p82ta1) CTWT2 (p82ta1) CTWT3 (p82ta1) CTWT4 (p82ta1) CTWT5 (p82ta1) CT Δack1 (p82ta1) CT Δack2 (p82ta1) CT Δack3 (p82ta1) CT Δack4 (p82ta1) CT Δack5 (p82ta1) Table 3.1 Fermentation performance of various adhe over-expressed C. tyrobutyricum wild type and ack knockout mutants. 114

144 115 Hosts Gene expression Butanol titer (g/l) References E. coli thil, hbd, crt, bcd-ctfb-ctfa, adhe1/adhe Inui et al., 2008 E. coli thrabc, kivd,adh2, ilva,leuabcd 0.8 Shen and Liao, 2008 E. coli crt,bcd,ctfab,hbd,atob,adhe Atsumi et al., 2008 E. coli crt,bcd,ctfab,hbd,atob,adhe2, gapa 0.58 Nielsen et al., 2009 E. coli pha,hbd,crt,ter,adhe2, aceef.lpd 4.65 Bond-Watts et al., 2011 E. coli atob,adhe2,crt,hbd,ter,fdh 15.0 Shen et al., 2011 B. subtilis crt,bcd,ctfab,hbd,thl,adhe Nielsen et al., 2009 L. brevis crt,bcd,ctfab,hbd 0.3 Berezina et al., 2010 P. putida crt,bcd,ctfab,hbd,thl,adhe Nielsen et al., 2009 S. cerevisiae ERG10, hbd,crt,ccr,adhe Steen et al., 2008 S. cerevisiae goxb, MLS1, DAL7, Leu2, PDC, ADH Branduardi et al., 2013 cyanobacteria ter, atob, adhe2, crrt, hbd Lan and Liao, 2011 C. tyrobutyricum thl, adhe Yu et al., 2011 C. tyrobutyricum thl, adhe2, ackko Yu et al., 2011 C. tyrobutyricum thl, adhe This study C. tyrobutyricum thl, adhe, ackko This study Table 3.2 Heterologous expression of clostridial butanol pathway in various alternative platforms. 115

145 ack, pta, or Acetate Butyrate Acetate yield Butyrate yield AA/BA ptb mutants (g/l) (g/l) (g/g glucose) (g/g glucose) ratio* CTackKO CTackKO CTackKO CTackKO CTptaKO CTptaKO CTptaKO CTptaKO CTptbKO CTptbKO CTptbKO CTptbKO Control *AA/BA ratio, the ratio of acetate to butyrate Table 3.3 Fermentation performance of various C. tyrobutyricum mutants with single knockout of ack, pta, or ptb genes. 116

146 Figure 3.1 Construction of recombinant plasmid pmtl82151-thl-adhe (p82ta1) for heterologous butanol synthesis in C. tyrobutyricum. 117

147 Figure 3.2 Enzyme digestion confirmation and colony PCR verification of adhe gene, thl gene, plasmid pmtl82151-adhe and insertion of thl gene (A: Lane 1-2, adhe gene, Lane 3, 1kb marker; B: Lane 1, 1kb marker, Lane 2, plasmid pmtl82151-adhe, Lane 3, thl gene; C: Lane 1 and Lane 12, 1kb marker, Lane 2, negative control, Lane 3, positive control, Lane 4-11, thl gene). 118

148 Figure 3.3 Construction of plasmid pmtl82151-thl-adhe-2 (p82ta2) by removing adhe2 gene from plasmid pmad22 and directly inserting PCR-amplified adhe gene in the in-fusion cloning system. 119

149 Figure 3.4 Colony PCR confirmation of p82ta2 construction and transformation (A: Lane 1, 1kb marker, Lane 2-3, negative control, Lane 4, positive control, Lane 5-14, adhe gene; B: Lane 1, 1kb marker, Lane 2-3, negative control, Lane 4, positive control, Lane 5-12, adhe gene). 120

150 Chapter 4: High-yield and high-titer n-butanol production in Clostridium tyrobutyricum with external driving forces Abstract The biosynthesis of n-butanol through aldehyde/alcohol dehydrogenase (adhe2) is usually limited by NADH availability and butanol titer. In order to alleviate these limitations and improve n-butanol production by C. tyrobutyricum overexpressing adhe2, external driving forces were created by introducing an NADH driving force via the addition of methyl viologen (MV), an artificial electron carrier, to direct electron flow and metabolic flux towards the butanol biosynthesis pathway, and a detoxification driving force through the integration of gas stripping, a simple but efficient separation technique, to realize in situ butanol recovery and minimize butanol-induced inhibition. With these external driving forces, high-yield and high-titer butanol production from glucose in C. tyrobutyricum mutant was achieved in batch and fed-batch fermentations. Metabolic flux analysis revealed that the improvement in butanol yield and titer was consistent with the increase in NADH availability. In addition, a continuous butanol production to a total titer of >50 g/l and an overall butanol yield of ~0.33 g/g glucose with an extremely low accumulation of ethanol, acetic and butyric acids was obtained in an integrated fed-batch fermentation with cells immobilized in a fibrous-bed bioreactor and gas stripping for in situ butanol recovery. This study demonstrates the important roles of NADH and detoxification driving forces in the butanol biosynthesis pathway as well 121

151 as a stable and reliable process for high-yield and high-titer n-butanol production by metabolically engineered C. tyrobutyricum. 4.1 Introduction The worldwide consumption of fossil fuels has caused increasingly severe environmental issues such as global warming, and energy crisis, characterized by high gasoline prices. Recently, the conversion of biomass into liquid fuels including biodiesel, ethanol, and butanol, has attracted more and more attention since biofuels have a potential to replace the current petroleum-based energy as alternative transportation fuels [Durre, 2007]. Among the various biofuel candidates converted from biomass, butanol is one of the most promising substitutes for gasoline due to its highly similar physicochemical properties to gasoline, including heating value, energy density, octane numbers, and water solubility [Cascone, 2008]. Butanol production via acetone-butanol-ethanol (ABE) fermentation by solventogenic clostridia, such as Clostridium acetobutylicum and Clostridium beijerinckii, usually suffers from a number of inherent drawbacks, including low butanol yield [Lee et al., 2008], low butanol titer and reactor productivity [Ezeji et al., 2010], complexity in gene manipulation [Heap et al., 2007], and difficulty in process control [Papoutsakis, 2008]. Recently, C. tyrobutyricum was engineered for butanol production by overexpressing an aldehyde/alcohol dehydrogenase gene (adhe2) [Yu et al., 2011], which presents several advantages over native solventogenic clostridia, including favorable metabolic pathway from glucose to butyryl-coa [Liu et al., 2006a, 2006b; Zhu et al., 2004], no acetone generation, higher butanol tolerance [Yu et al., 2011], and less interaction with sporulation and autolysis [Yu et al., 2011]. However, large amounts of acetic and butyric 122

152 acids are still generated as the major by-products in the butanol-producing C. tyrobutyricum mutants, which does not only result in a low butanol yield (~10%), but also greatly increase the cost for butanol recovery [Yu et al., 2011]. Butanol production in solventogenic clostridia is limited by the availability of NADH [Shen et al., 2011; Fontaine et al., 2002; Girbal and Soucaille, 1998; Lutke-Eversloh and Bahl, 2011]. To increase the availability of NADH, various approaches have been applied to manipulate the electron flow and redirect the carbon flux [Lutke-Eversloh and Bahl, 2011]. Generally, these strategies can be divided into two categories: external and internal driving forces. External driving forces usually include an increase in hydrogen partial pressure [Doremus et al., 1985; Yerushaimi and Volesky, 1985], carbon monoxide flushing [Datta and Zeikus, 1985; Meyer et al., 1986], the addition of artificial electron carriers [Kim and Kim, 1988; Peguin et al., 1994; Peguin and Soucaille, 1995, 1996; Rao and Mutharasan, 1986, 1987; Girbal et al., 1995], a limitation in iron concentration [Junelles et al., 1988; Peguin and Soucaille, 1995], as well as utilization of more reduced substrates such as glycerol and mannitol [Vasconcelos et al., 1994; Yu et al., 2011]. Internal driving forces, however, are usually created based on enzyme mechanism and gene manipulation [Shen et al., 2011; Bond-Watts et al., 2011]. Among these approaches, the regulation of NADH availability through the use of artificial electron carriers, such as viologen dyes, is relatively simple. In particular, methyl viologen, which has the standard redox potential close to that of ferredoxin, the native electron carrier for most anaerobic system [Adams and Mortenson, 1984; Peguin et al., 1994], has been studied extensively as an artificial electron carrier for its effect on alcohol production in C. acetobutylicum [Peguin and Soucaille, 1996; Rao and Mutharasan, 1986; 1987]. 123

153 Butanol-induced inhibition is another big challenge for fermentative butanol production [Liu and Qureshi, 2009; Ezeji et al., 2010]. Considerable efforts have been made to understand butanol tolerance and overcome poor solvent resistance in solventogenic clostridia, at both strain and process levels [Lee et al., 2008; Zheng et al., 2009]. Integration of fermentation and separation provides an effective method to alleviate butanol-induced inhibition by in situ butanol recovery [Ezeji et al., 2010; Kumar and Gayen, 2011]. Among various integrated techniques, gas stripping is the most simple but an efficient approach to minimize butanol inhibition [Ezeji et al., 2010; Lee et al., 2008; Lu et al., 2012; Xue et al., 2012]. In addition, it can effectively remove butanol from the fermentation broth without disrupting cell culture, nutrient supply, and intermediate product accumulation [Lee et al., 2008; Kumar and Gayen, 2011]. Moreover, compared to other integrated processes, the equipment investment and energy input in gas stripping are very low [Ezeji et al., 2010; Xue et al., 2012]. In fact, gas stripping has been widely used in batch, fed-batch, and continuous processes for ABE production by solventogenic clostridia [Ezeji et al., 2003; Ezeji et al., 2004a; Ezeji et al., 2004b; Ezeji et al., 2007; Lu et al., 2012; Xue et al., 2012]. In this work, the effects of methyl viologen on cell growth, metabolic flux distribution and butanol production by C. tyrobutyricum mutant was investigated at various ph values. Metabolic flux analysis was applied to better understand the carbon flux, electron flow, and metabolites distribution in response to different concentrations of methyl viologen and medium ph. Finally, high-titer butanol production with further improvement in butanol yield was achieved by integrating fed-batch fermentation with in situ gas stripping to alleviate butanol-induced inhibition. This is the first study applying external 124

154 driving forces for high-yield and high-titer butanol production from glucose by metabolically engineered clostridia. 4.2 Materials and methods Bacterial strain and media C. tyrobutyricum mutant strains CtΔack-adhE2, CTWT-adhE2, and CtΔptb-adhE2 were used in this study. These strains were developed by introducing the butanol biosynthesis pathway via the overexpression of adhe2 gene in C. tyrobutyricum ATCC wild type, or with partially inactivated acetate or butyrate biosynthesis pathway (knockout of ack or ptb gene) [Yu et al., 2011]. The stock culture of CtΔack-adhE2, CTWT-adhE2, and CtΔptb-adhE2 was maintained anaerobically at -85 o C in Reinforced Clostridial Medium (RCM; Difco, Detroit, MI) supplemented with 30 μg/ml thiamphenicol to maintain plasmid stability and adhe2 activity. Unless otherwise noted, all fermentation studies were carried out at 37 o C in the Clostridium Growth Medium (CGM) containing 60 g/l glucose, 2 g/l yeast extract, 4 g/l trypticase peptone, 2 g/l (NH 4 ) 2 SO 4, 1 g/l K 2 HPO 4, 1 g/l KH 2 PO 4, 0.1 g/l MgSO 4.7H 2 O, g/l FeSO 4.7H 2 O, g/l CaCl 2.2H 2 O, 0.01 g/l MnSO 4.H 2 O, 0.02 g/l CoCl 2.6H 2 O, g/l ZnSO 4.7H 2 O, and 30 μg/ml thiamphenicol Effects of methyl viologen or benzyl viologen The effects of methyl viologen (MV) or benzyl viologen (BV) as an artificial electron carrier on fermentation kinetics of CtΔack-adhE2 were studied in serum bottles. The methyl viologen or benzyl viologen (Sigma-aldrich) stock solution (100 ) was sterilized by filtration and added into the medium to a final concentration (μm) of 0 (MV0),

155 (MV50), 100 (MV100), 500 (MV500), and 1000 (MV1000) for MV and 0 (BV0), 10 (BV10), 25 (BV25), 50 (BV50), and 100 (BV100) for BV, respectively. Each bottle, containing 50 ml of the medium, was inoculated with 1.0 ml active cells of CtΔackadhE2 from an overnight culture in RCM at 37 o C anaerobically. After inoculation, these serum bottles were incubated at 37 o C with ph adjusted to 6.5 once a day by adding 10% (w/v) NaOH solution. Samples were taken periodically to monitor cell growth, glucose consumption, and metabolites (ethanol, butanol, acetic acid, butyric acid, and lactate) production during the fermentation. Duplicate bottles were used for each MV or BV concentration studied Effects of nitrogen source Effects of nitrogen source concentration on the fermentation kinetics of CtΔack-adhE2 mutants grown in CGM medium in the presence of 500 μm methyl viologen was also carried out in serum bottles. Four different levels of nitrogen source concentration were considered, including 2.0 g/l trypticase peptone plus 1.0 g/l yeast extract (N1), 4.0 g/l trypticase peptone plus 2.0 g/l yeast extract (N2), 8.0 g/l trypticase peptone plus 4.0 g/l yeast extract (N3), and 16.0 g/l trypticase peptone plus 8.0 g/l yeast extract (N4). 50 ml CGM medium supplemented with 30 ug/ml thiamphenicol and 500 μm methyl viologen was inoculated with 1.0 ml active cells of CTΔack-adhE2 mutant and cultured at 37 o C under anaerobic conditions. Medium ph was adjusted to 6.5 once a day by adding 10% (w/v) NaOH solution and samples were taken periodically to monitor cell density, glucose consumption, and metabolite accumulation during the fermentation process. Duplicate bottles were used for each nitrogen source concentration. 126

156 4.2.4 Effects of gene inactivation In addition to CtΔack-adhE2, the effects of methyl viologen concentration on the fermentation kinetics of CTWT-adhE2 and CtΔptb-adhE2 mutants were also investigated to evaluate the disruption of acetate or butyrate synthesis pathways on fermentation performance in response to artificial electron carriers. Methyl viologen concentrations for CTWT-adhE2 mutant include (μm) 0 (MV0), 100 (MV100), 500 (MV500), and 1000 (MV1000), respectively whereas for CtΔptb-adhE2 mutant include (μm) 0 (MV0), 100 (MV100), 250 (MV250), and 500 (MV500), respectively. Each bottle, containing 50 ml of the medium, was inoculated with 1.0 ml active cells of CTWT-adhE2 or CtΔptbadhE2 mutant from an overnight culture in RCM at 37 o C anaerobically, and then incubated at 37 o C with ph adjusted to 6.5 once a day by adding 10% (w/v) NaOH solution. Samples were taken periodically to monitor cell growth, glucose consumption, and metabolites (ethanol, butanol, acetic acid, butyric acid, and lactate) production during the fermentation. Duplicate bottles were used for each MV level Effects of ph The effects of ph on fermentation kinetics of CtΔack-adhE2 were studied in bench-scale stirred-tank reactors, each containing 1.5 liters of CGM (80 g/l glucose, 30 μg/ml thiamphenicol) with 500 μm or without methyl viologen. After inoculating with 60 ml of an overnight culture in RCM, the fermentation was maintained at 37 o C with the ph controlled at 5.0, 5.5, 6.0, or 6.5 with saturated NH 4 OH solution. Samples were taken periodically to monitor cell growth, glucose consumption, and metabolites (ethanol, butanol, acetic acid, butyric acid, and lactate) production. 127

157 4.2.6 Metabolic flux analysis A stoichiometric model involving 12 metabolites and 10 reactions (see Table 4.8) adapted from previous studies was used to analyze the metabolic flux distribution during the fermentation of CtΔack-adhE2 [Wang et al., 2012; Jo et al., 2008]. Several key assumptions were made in calculating the metabolic fluxes in the fermentation: 1) no net accumulation of intracellular intermediates, including pyruvate, reduced ferredoxin, acetyl-coa, and butyryl-coa; 2) NADH remaining balanced; 3) sufficient energy supplies from ATP generation in the glycolysis and biosynthesis of acetic and butyric acids to support cell growth and maintenance. The molar carbon fluxes from glucose to cell, intermediates and fermentation end products were estimated using the available data on glucose, cell density, and metabolites during the fermentation Fed-batch fermentation with in situ gas stripping Fed-batch fermentation with in situ gas stripping for butanol removal was studied with cells grown in CGM containing 500 μm methyl viologen. The experiments were carried out with free cells and immobilized cells in a fibrous-bed bioreactor (FBB). Detailed description of the system setup and operation has been given previously [Lu et al., 2012; Xue et al., 2012]. Briefly, once butanol titer in the culture broth reaches a certain amount, usually above 10 g/l, gas stripping is started to bubble the gas mixture of CO 2 and H 2 generated during the fermentation process through the fermenter to selectively strip butanol from the fermentation broth, followed by the recovery of concentrated butanol from the butanol-saturated gas phase via passing through a condenser from bottom to top, which could allow sufficient retention time for butanol condensation. The condenser is usually operated at normal pressure and a temperature range of 1-2 o C. After condensation, 128

158 most butanol in the gas phase will be recovered along with a partial condensation of water; and the gas mixture will be pumped back to the fermenter to continuously strip butanol from the culture broth. A schematic diagram of the integrated fed-batch fermentation and gas stripping process is given in Figure 4.1 [Xue et al., 2012] Analytical methods Cell density was measured as the optical density at 600 nm using a spectrophotometer (UV-16-1, Shimadzu, Columbia, MD). Glucose was determined with a YSI 2700 Select Biochemistry Analyzer (Yellow Springs, OH). Volatile metabolites, including ethanol, acetic acid, butanol, and butyric acid, were analyzed with a gas chromatograph (GC-2014, Shimadzu, Columbia, MD). High performance liquid chromatography (HPLC, LC-20AD, Shimadzu, Columbia, MD) was also used to assay glucose and other fermentation metabolites when necessary. Detailed descriptions of GC and HPLC analyses can be found elsewhere [Yu et al., 2011]. 4.3 Results Effects of methyl viologen on fermentation kinetics In order to determine the optimal concentration of methyl viologen for butanol production, the effects of methyl viologen concentration on fermentation kinetics were investigated. Five levels of MV concentration were considered, including 0 μm (MV0), 50 μm (MV50), 100 μm (MV100), 500 μm (MV500), and 1000 μm (MV1000). The results are presented in Figure 4.2, and Table 4.1 compares the final butanol titer, butanol yield, solvents/acids ratio, as well as specific growth rate for each MV concentration. 129

159 It is interesting to note that the effects of methyl viologen on the profiles of four main products (ethanol, butanol, acetic acid, and butyric acid) differed. Butanol production was strongly facilitated by the addition of methyl viologen, although different levels of methyl viologen had different promotional effects. Basically, when the MV concentration was lower than 500 μm, more butanol was produced when more methyl viologen was used, from less than 3.5 g/l butanol at MV0 to as high as 11.0 g/l butanol at MV500, an over 200% increase compared to MV0. The effect of MV500 and MV1000 on butanol synthesis, however, was similar, which would suggest that 500 μm methyl viologen should be the optimal level for improving butanol production (Figure 4.2 C). For ethanol production, lower concentrations of methyl viologen (MV50 and MV100) showed a slight inhibition effect whereas higher MV levels (MV500 and MV1000) could significantly improve ethanol generation (Figure 4.2 D). The effect of methyl viologen on butyric acid production, however, was diametrical to that on ethanol production because MV50 and MV100 presented a slight promotion effect whereas MV500 and MV1000 could strongly inhibit butyrate production (Figure 4.2 E). For acetate production, it is clear that methyl viologen, especially at MV500 and MV1000 level, demonstrated a strong inhibition effect. Without methyl viologen, the final acetic acid titer was 3.5 g/l whereas in the presence of 500 μm or 1000 μm MV, it decreased to 0.5 g/l (Figure 4.2 F). It was also found that high levels of methyl viologen (MV500 and MV1000) could inhibit cell growth, resulting in a longer lag phase and a lower specific growth rate (Figure 4.2 B and Table 4.1). From Table 4.1, it is clear that a higher butanol titer (from 3.27 g/l to g/l), butanol yield (from less than 0.10 to over 0.28 g/g), and solvents/acids ratio (from 0.50 to

160 mol/mol) were achieved in the presence of a higher MV concentration (from MV0 to MV1000), although the specific growth rate for MV500 and MV1000 was much lower than those for MV0, MV50, and MV Effects of benzyl viologen on fermentation kinetics In addition to methyl viologen, the effects of benzyl viologen, another artificial electron carrier, on fermentation kinetics of CtΔack-adhE2 mutant was also studied in serum bottles. Five levels of BV concentrations were considered including 0 μm (BV0), 10 μm (BV10), 25 μm (BV25), 50 μm (BV50), and 100 μm (BV100). Since the cells were unable to survive in 100 μm BV, only the results of BV0, BV10, BV25, and BV50 were given, as shown in Figure 4.3. Table 4.2 compares the final butanol titer, butanol yield, solvents/acids ratio, lag phase, as well as specific growth rate for each BV concentration. Similar to methyl viologen, benzyl viologen could also significantly improve butanol production at the expense of acetate and butyrate. Butanol titer was increased from ~ 9.0 g/l to ~ 11.0 g/l whereas titers of acetic and butyric acids were reduced from ~ 4.0 g/l to less than 1.0 g/l with an increase of BV concentration from 0 μm to 50 μm. In addition, a remarkable improvement in butanol yield (from < 0.20 g/g to ~ 0.30 g/g) and solvents/acids ratio (from < 2.0 mol/mol to ~ 7.0 mol/mol) was also observed, which was consistent to the effects of methyl viologen. Moreover, BV demonstrated an inhibitory effect on cell growth, resulting in a lower specific growth rate (from ~ /h to ~ /h) and longer lag phase (from 0 to 2 days). However, the effect of BV had a couple of differences with that of MV. First, low concentrations of MV (MV50 and MV100) could slightly inhibit ethanol generation and improve butyrate production while high MV concentrations (MV 500 and MV1000) could significantly boost ethanol production and 131

161 limit butyrate generation. The accumulation of both ethanol and butyrate, however, was dramatically decreased in the presence of BV at a concentration higher than 10 μm. Another important difference is that in order to achieve high-titer and high-yield butanol production, 500 μm MV is usually required; but if BV is used, only 25 μm is enough, indicating that as an electron carrier, MV is less efficient than BV Effects of nitrogen source Since organic nitrogen sources such as yeast extract and trypticase peptone play an essential role in cell growth and metabolism, the effects of nitrogen source concentrations on fermentation kinetics of CtΔack-adhE2 mutant was studied in the presence of 500 μm MV in serum bottles. Four levels of nitrogen source concentrations were considered including 2.0 g/l trypticase peptone plus 1.0 g/l yeast extract (N1), 4.0 g/l trypticase peptone plus 2.0 g/l yeast extract (N2), 8.0 g/l trypticase peptone plus 4.0 g/l yeast extract (N3), and 16.0 g/l trypticase peptone plus 8.0 g/l yeast extract (N4). The fermentation kinetics was given in Figure 4.4, and Table 4.3 compares the final butanol titer, butanol yield, solvents/acids ratio, as well as specific growth rate for each nitrogen source level. It is clear that cell growth and butanol production was not significantly affected by nitrogen source concentrations from N1 to N3 level because similar butanol titers ( g/l), butanol yields ( g/g), and specific growth rates ( /h) were observed at these levels. In the presence of 16.0 g/l trypticase peptone plus 8.0 g/l yeast extract (N4), however, lower specific growth rate ( /h) and butanol titer (~ 8.0 g/l) was obtained, indicating that too high a concentration of nitrogen source is not beneficial for cell growth and butanol production. It should be noted that acetate and 132

162 butyrate production at N1 level was significantly lower than that at N2 level (0.34 g/l vs g/l for acetate and 1.72 g/l vs g/l for butyrate), which might be caused by the fact that N1 level nitrogen source was not adequate for ATP generation. By considering both nutrient requirements and production cost, 4.0 g/l trypticase peptone plus 2.0 g/l yeast extract (N2) was used for fermentative butanol production in CtΔack-adhE2 mutant Effects of gene inactivation Since previous studies have demonstrated that gene disruption involved in central metabolic pathways of C. tyrobutyricum has a profound influence on fermentation kinetics and it was confirmed that artificial electron carriers were capable of diverting electron flow and redistributing carbon flux, an investigation on the combinational effects of gene inactivation and redox manipulation should be helpful to better understand the regulations and mechanisms of electron flow and carbon flux involved in central metabolic pathways. In addition to CtΔack-adhE2, the effects of methyl viologen concentration on fermentation kinetics of CTWT-adhE2 and CtΔptb-adhE2 mutants were also studied. The results for CTWT-adhE2 mutant are given in Table 4.4 and Figure 4.5; and the results for CtΔptb-adhE2 mutant are provided in Table 4.5 and Figure 4.6. Table 4.6 compares butanol titer, butanol yield, specific growth rate, lag phase, and solvents/acids ratio for three different mutants CtΔack-adhE2, CTWT-adhE2, and CtΔptb-adhE2 in response to different concentrations of methyl viologen. As shown in Figure 4.5 and Table 4.4, the effects of methyl viologen on fermentation kinetics of CTWT-adhE2 mutant was very similar to that on CtΔack-adhE2 mutant. Basically, significantly higher butanol titers (from < 3.0 g/l to > 9.0 g/l), butanol yields (from < 10% to ~ 28%), solvents/acids ratios (from < 0.50 mol/mol to ~ 5.0 mol/mol) 133

163 whereas dramatically lower acetate titers (from > 3.0 g/l to ~ 0.10 g/l), butyrate titers (from > 7.0 g/l to ~ 2.0 g/l), specific growth rates (from /h to /h), and longer lag phase (from 0 to 2 days) were observed at higher MV concentrations (from 0 to 1000 μm). Interestingly, no ethanol generation was detected in CTWT-adhE2 mutant. Although methyl viologen could also reduce acetate and butyrate production (from 2.81 g/l to 0.10 g/l for acetate and from 7.81 g/l to 3.55 g/l or butyrate), inhibit cell growth (from /h to /h for specific growth rate), improve solvents/acids ratio (from 0.88 mol/mol to 3.14 mol/mol), and increase lag phase (from 0 to 5 days) in CtΔptbadhE2 mutant, the effects of MV on fermentation kinetics of CtΔptb-adhE2 were distinct in two aspects. First, methyl viologen did not have a significant effect on butanol production in CtΔptb-adhE2 mutant because only a slight improvement in butanol titer (from 7.34 g/l to 8.66 g/l) and butanol yield (from 0.15 g/g to 0.20 g/g) was observed. For CtΔack-adhE2 and CTWT-adhE2 mutants, however, both butanol titers and yields were remarkably improved by over 200% in the presence of methyl viologen. Second, methyl viologen demonstrated a severe inhibitory influence on cell growth of CtΔptbadhE2 mutant, resulting in an extremely long lag phase (3 days for MV250 and 5 days for MV500). Actually, the cells were unable to survive in MV1000 medium, indicating that it was very hard for CtΔptb-adhE2 mutant to adapt to the new electron carrier. A short lag phase (1 day) or even no adaptation period, however, was observed for CtΔack-adhE2 and CTWT-adhE2 mutants in response to MV, indicating that ack gene was not essential for cell survival. These results would suggest that disruption of acetate synthesis pathway cannot profoundly affect fermentation kinetics whereas inactivation of butyrate formation 134

164 pathway might cause some fundamental changes in gene regulations and cellular activities Effects of ph on fermentation kinetics without methyl viologen Since medium ph plays an important role in metabolic flux distribution and product profiles, the effect of ph on fermentation kinetics was investigated. Four levels of ph values were considered: ph 5.0, ph 5.5, ph 6.0, and ph 6.5. The results are given in Figure 4.7. Apparently, neutral ph (6.0 and 6.5) values were favorable for solvents production. Ethanol and butanol titer increased from less than 1.0 g/l to above 2.5 g/l and from around 5.0 g/l to nearly 13.0 g/l, respectively, with ph being increased from 5.0 to 6.5 (Figure 4.7 C and D). Acetic and butyric acids production; however, was not significantly affected at a ph higher than 5.5 (5.5, 6.0, 6.5), which would suggest that in response to ph change, the synthesis pathways of acids were more robust than those of solvents (Figure 4.7 E and F). The lowest acetate titer (~ 8.0 g/l) and butyrate titer (~ 9.0 g/l) was obtained at ph 5.0 (Figure 7 E and F). It was noticed that the specific growth rate was similar for each ph level, although the cell density at ph 5.0 was considerably lower than that at other phs (Table 4.7 and Figure 4.7). Neutral ph values (6.0 and 6.5) were also beneficial for the improvement of butanol yield and solvents/acids ratio (Table 4.7) Effects of ph on fermentation kinetics in the presence of 500 μm methyl viologen The effect of ph (5.0, 5.5, 6.0, 6.5) on fermentation kinetics with methyl viologen addition was also considered to determine the optimal ph condition for high-yield 135

165 butanol production. The results were presented in Figure 4.8. In terms of ethanol and butanol production, neutral ph values (6.0 and 6.5) were better than low ph values (5.0 and 5.5) in the presence of methyl viologen. For example, the final butanol titer was above 12.0 g/l at ph 6.0 whereas at ph 5.0, it was less than 8.0 g/l (Figure 4.8 C). In addition, high butanol yield (~29%) and solvents/acids ratios (~10 mol/mol) were achieved at ph 6.5 whereas the lowest butanol yield (~16%) and solvents/acids ratios (~0.75 mol/mol) were obtained at ph 5.5 (Table 4.7). These results were consistent with the effect of ph without methyl viologen, where neutral ph values were favorable for solvents production (Figure 4.7). On the other hand, the generation of acetic and butyric acids was strongly inhibited at neutral ph values (6.0 and 6.5) with the addition of methyl viologen. In fact, above 3.0 g/l acetate and around 10.0 g/l butyrate was produced at ph 5.5 whereas less than 0.5 g/l acetate and around 1.0 g/l butyrate was generated at ph 6.0 (Figure 4.8 E and F). These results indicate that the acids synthesis pathways were extremely sensitive to methyl viologen at neutral ph values (6.0 and 6.5). In addition, a longer lag phase and a lower specific growth rate were observed at neutral ph values (6.0 and 6.5) (Figure 4.8 B and Table 4.7) Metabolic flux analysis for effects of methyl viologen The metabolic flux analysis for each important node in the presence of different methyl viologen concentrations is presented in Figure 4.9. The effect of methyl viologen on the flux distribution at each node can be divided into three distinct categories: no considerable influence, strong inhibition influence, and significant promotion influence. For biomass and important intermediate metabolites (pyruvate, acetyl-coa, and butyryl- CoA), no considerable influence was observed, indicating that these key metabolic nodes 136

166 cannot be easily redirected by external driving forces, although methyl viologen can facilitate the conversion of acetyl-coa to butyryl-coa, resulting in a slightly higher metabolic flux at butyryl-coa node. For hydrogen, acetic and butyric acids, methyl viologen, especially at MV500 and MV1000 level, exhibits strong inhibition influences. For example, the metabolic flux for hydrogen, acetate, and butyrate node is 1.5, 0.3, and 0.35 mol/mol glucose, respectively, without methyl viologen whereas the flux distribution at these nodes is decreased to 0.9, 0.05, and 0.1 mol/mol glucose, respectively, in the presence of 500 μm methyl viologen. On the contrary, methyl viologen presents significant promotion influences at NADH, ethanol and butanol node. Actually, the metabolic flux is increased by 300%, 100%, and 250%, respectively, for NADH, ethanol, and butanol with MV1000. These results are consistent with the experimental observations that methyl viologen can significantly improve solvents production at the expense of acids Metabolic flux analysis for effects of ph with and without methyl viologen addition The metabolic flux analysis for ph effect with and without methyl viologen is presented in Figure 4.10B. Without methyl viologen, lower metabolic flux for biomass is observed at neutral ph values, from 0.18 to 0.06 mol/mol glucose with ph being increased from 5.0 to 6.5. For hydrogen, acetate and butyrate, the metabolic flux is similar at different ph values, indicating that these nodes are not sensitive to ph changes. However, flux analysis reveals that neutral ph values (6.0 and 6.5) are favorable for NADH, ethanol, and butanol production, with metabolic flux improved from 0.12, 0.07, and 0.24 mol/mol glucose, respectively, at ph 5.0 to 0.27, 0.13, and 0.37 mol/mol glucose, respectively, at 137

167 ph 6.5. The effect of ph on metabolic flux distribution is also profoundly affected by methyl viologen as flux analysis reveals that the generation of hydrogen, acetic and butyric acids is strongly inhibited whereas the accumulation of NADH and butanol is remarkably improved at ph 6.0 and 6.5 in the presence of 500 μm methyl viologen. In addition, a significant increase in metabolic flux (from < 0.10 mol/mol glucose without MV to > 0.20 mol/mol glucose with MV500) for biomass is observed at ph 6.0 and Fed-batch fermentation with gas stripping In order to minimize butanol-induced inhibition, gas stripping was applied for in situ butanol recovery. Figure 4.11 shows the kinetics of an integrated fed-batch fermentation and gas stripping for a free-cell culture with 500 μm methyl viologen. As shown in Figure 4.11A, a continuous butanol production for over 200 hours with a final total butanol titer reaching nearly 45 g/l and a total butanol yield of 0.30 g/g glucose was achieved. In addition, the generation of ethanol, acetic and butyric acids was strongly inhibited by methyl viologen. In fact, an extremely low level of acetate and ethanol (~ 1.0 g/l) was observed during the fermentation process. Moreover, it is interesting to note that the cell density during the culture time, especially after the start of gas stripping, was maintained at the same level, primarily due to the removal of excess butanol by gas stripping. Furthermore, the slope of butanol accumulation in terms of glucose consumption is almost a constant (Figure 4.11B), indicating that this process is very stable and reliable. The utilization of cell immobilization in a fibrous-bed bioreactor (FBB) integrated with fed-batch fermentation and gas stripping was also considered. The results are presented in Figure Similar to the free-cell fermentation, a continuous butanol production for 138

168 nearly 400 hours was achieved with butanol as the sole main product (> 50 g/l), a small amount of butyric acid and extremely low titers of acetic acid and ethanol. This process was also stable and reliable as a steady increase in butanol production based on glucose consumption was observed (Figure 4.12B). Compared to free-cell fermentation, however, the immobilized-cell fermentation in FBB presents two distinct differences. First, the cell density in FBB fermentation (OD 600 ~12) was much lower than that in free-cell fermentation (OD 600 ~25), indicating that FBB was an excellent system for cell immobilization, growth, and metabolism. Secondly, the final butanol yield in immobilized-cell fermentation (0.33 g/g glucose) was higher than that in free-cell fermentation (0.30 g/g glucose) due to the improved cell tolerance to butanol and enhanced cell viability. 4.4 Discussion A remarkable improvement in butanol titer and yield was achieved in metabolically engineered C. tyrobutyricum, which should be resulted from the significant increase in NADH availability in the presence of methyl viologen. Actually, it has been demonstrated that NADH plays a vital role in butanol synthesis pathway since the expression of adhe2 gene is highly dependent on NADH level [Fontaine et al., 2002]. In addition, metabolic flux analysis reveals that butanol production is consistent with NADH availability; higher NADH flux induces more butanol whereas less butanol was generated at lower NADH flux (Figure 4.4). Moreover, a sharp decrease in hydrogen generation was observed with MV500 or MV1000, compared to MV0, indicating a remarkable increase in NADH pool since hydrogen and NADH synthesis pathways are competing with each other to consume reducing equivalents and maintain redox balance. 139

169 Usually, hydrogen production is the primary pathway to consume FdH 2 generated during the acetyl-coa synthesis pathway via the reduction of pyruvate. Methyl viologen, however, can divert the electron flow from hydrogen generation to NADH accumulation by affecting the activities of both hydrogenase and NAD + reductase. As a result, NADH production, instead of hydrogen, becomes the primary route to utilize reducing equivalents and in order to achieve redox balance, more carbon flow will be directed towards butanol synthesis pathway for the regeneration of NAD + pool [Peguin et al., 1994; Girbal et al., 1995]. Furthermore, excessive accumulation of NADH in MV500 and MV1000 medium also induces the generation of lactic acid (data not shown), an alternative pathway to restore NAD + pool [Jones and Woods 1986]. In fact, previous studies have reported that high NADH/NAD + ratio is one of the essential factors that can activate the lactate synthesis pathway [Peguin et al., 1994; Peguin and Soucaille, 1995; Girbal et al., 1995]. Finally, cell growth was significantly inhibited due to extremely low flux towards acids synthesis pathways in the presence of MV500 and MV1000 (Table 4.1). It is well-known that most of the ATP required to support cell growth of solventogenic clostridia was generated during the acetic and butyric acids synthesis pathways. Without methyl viologen or at low MV concentrations, high specific growth rates were obtained because of the high metabolic fluxes from acetyl-coa to acetate and butyryl-coa to butyrate. With MV500 or MV1000, however, carbon flow from acetyl- CoA to ethanol, especially from butyryl-coa to butanol, becomes the predominant route, which could significantly reduce ATP generation, and finally inhibit cell growth. Artificial electron carriers, especially methyl viologen, have been reported to improve butanol production at the expense of acetone, acetate, and butyrate in C. acetobutylicum. 140

170 Kim and Kim studied the fermentation kinetics of C. acetobutylicum with methyl viologen and electrochemical energy, and concluded that butanol production was increased by 26% whereas acetone generation was reduced by 25% in the presence of 2 mm MV [Kim and Kim, 1988]. Peguin and Soucaille investigated chemostat culture of C. acetobutylicum in a three-electrode potentiometric system with 1 mm methyl viologen as an electron carrier, and found that the specific rates of butanol (mmol/g cell/h) was improved from 1.65 to 2.11 while that of acetone was decreased from 0.96 to 0.76 at ph 5.0 [Peguin and Soucaille, 1996]. Peguin et al. also examined batch cultures of C. acetobutylicum at four different controlled ph values (4.5, 5.0, 5.5, and 6.5) with 1 mm methyl viologen addition. At ph 4.5, a typical solventogenic metabolism, butanol titer was increased from 10.0 g/l to 13.5 g/l with a yield (mol/mol glucose) improved from 0.42 to 0.65, whereas acetone production was significantly reduced from 5.2 g/l to 2.0 g/l with a yield (mol/mol glucose) decreased from 0.29 to 0.10 in the presence of MV [Peguin et al., 1994]. In this work, the effect of methyl viologen on alcohol production in adhe2-overexpressing C. tyrobutyricum mutant was reported. This is the first study using artificial electron carriers to improve butanol production by manipulating electron flow and carbon flux in metabolically engineered clostridia. It was demonstrated that methyl viologen had a profound effect on the fermentation kinetics of solventogenic C. tyrobutyricum. Basically, high levels of methyl viologen (MV500 and MV1000) can significantly reduce the generation of acids (acetate and butyrate) and strongly promote the production of solvents (ethanol and butanol). For example, compared to the results without methyl viologen, the titers of butanol and ethanol were increased from 3.27 g/l to g/l and from 0.78 g/l to 1.41 g/l, respectively, whereas the titers of butyrate 141

171 and acetate were decreased from 6.00 g/l to 1.47 g/l and from 3.31 g/l to 0.48 g/l, respectively, in the presence of 1000 μm methyl viologen (Table 4.1). A remarkable improvement in butanol yield (g/g glucose, from 0.10 to 0.28) and solvents/acids ratio (mol/mol, from 0.5 to 7.4) was also achieved with MV1000 (Table 4.1). It is interesting to note that in response to methyl viologen, the improvement in butanol titer and yield in C. tyrobutyricum mutant was much higher than those in C. acetobutylicum, which might be caused by the fact that without methyl viologen, NADH availability in C. tyrobutyricum mutant was much lower than that in C. acetobutylicum. The NADH pool, however, was increased to the same level in both strains by the addition of methyl viologen. In addition, with MV the metabolic flux towards acids synthesis pathways in C. tyrobutyricum mutant was decreased to a much more extent than that in C. acetobutylicum, resulting in a significantly higher improvement in butanol yield in the former one. It was confirmed that benzyl viologen was also an excellent artificial electron carrier that can significantly improve butanol titer and yield at very low concentrations. In fact, similar fermentation kinetics were observed in the presence of 500 μm MV or 25 μm BV, indicating that as an electron carrier, BV is more efficient than MV, which might be caused by the fact that they have different chemical structures and their monocation radicals (the functional group) have different electron-carrying abilities [Girbal and Soucaille, 1998]. Actually, the standard redox potential of BV (-360 mv) is very close to that of ferredoxin (-330 mv), the native electron carrier in most anaerobic bacteria, whereas MV has a standard redox potential of -440 mv [Van der Zee and Cervantes, 2009]. 142

172 Although it has been reported that C. tyrobutyricum mutant with overexpression of adhe2 and inactivation of ack or ptb gene presented a significantly higher butanol titer and yield than the control cloned with adhe2 gene alone [Yu et al., 2011], this study demonstrated that similar fermentation kinetics between CtΔack-adhE2 and CTWTadhE2 mutants were observed in response to MV, indicating that the disruption of acetate synthesis pathway did not have a profound influence on fermentation profiles. However, the effects of MV on fermentation kinetics of CtΔptb-adhE2 mutant, in which ptb gene involved in butyrate synthesis pathway was inactivated, were distinct because no significant improvement in butanol production and an extremely long lag phase was observed in CtΔptb-adhE2 mutant in the presence of MV. These results were partially inconsistent with previous studies in which higher solvents production due to disruption of butyrate formation pathway (buk gene) in C. acetobutylicum was reported [Green et al., 1996; Harris et al., 2000; Shao et al., 2007]. In addition, it is clear that butyrate synthesis pathway plays a critical role in cell growth and metabolism in C. tyrobutyricum since the knockout of ptb gene makes it hard for the cells to survive and adapt to the new electron carrier. CtΔack-adhE2 and CTWT-adhE2 mutants, however, were able to survive and adapt to methyl viologen very quickly. Culture ph is another key factor that can determine the product profiles of microbial fermentation [Jones and Woods 1986]. It was showed that for both with and without methyl viologen, neutral ph values (6.0 and 6.5) were favorable for butanol production whereas at low ph values (5.0 and 5.5), acetic and butyric acids were produced dominantly. These results; however, are completely different from previous studies on ABE fermentation by native solventogenic clostridia, which reported that acetic and 143

173 butyric acids are the major products at neutral phs ( ) whereas at low phs ( ), acetone and butanol production usually predominates [Bahl et al., 1982; Huang et al., 2004; Janssen et al., 2010; Li et al., 2011; Haus et al., 2011]. Peguin et al. also studied the effects of methyl viologen on fermentation kinetics of C. acetobutylicum at different ph values, and reported that the improvement in butanol yield was the same (0.2 M butanol/1 M glucose) for each tested ph value (4.5, 5.0, 5.5, and 6.5) [Peguin et al., 1994]. However, this work confirmed that with MV higher improvements in butanol yield were obtained at ph 6.0 and 6.5. Actually, the highest improvement in butanol yield occurred at ph 6.0 whereas at ph 5.5, the improvement was the lowest (Table 4.7). It is well known that ABE fermentation via solventogenic clostridia, such as C. acetobutylicum and C. beijerinckii, consists of two distinct phases: acidogenesis and solventogenesis [Lee et al., 2008]. The transition between these two phases is usually triggered by a ph change [Durre et al., 1987]. Therefore, a poor ph control may lead to an unsuccessful shift from acidogenesis to solventogenesis, which in turn cannot induce the onset of solvent production [Jones and Woods, 1986]. Butanol production via C. tyrobutyricum mutant; however, does not have such an issue because no distinct phases are observed during the fermentation process. In fact, solvent production is usually associated with acids generation in the C. tyrobutyricum mutant. In addition, previous studies have reported that ph 6.3 was the optimal condition for butyrate production in wild-type C. tyrobutyricum [Zhu and Yang, 2004; Jo et al., 2008], which might explain the fact that neutral ph values (6.0 and 6.5) are favorable for butanol production in C. tyrobutyricum mutant since butanol and butyrate synthesis pathways share a common precursor, butyryl-coa. 144

174 It was also found that methyl viologen did not present an inhibition effect on cell growth at ph 5.0 and 5.5, whereas the specific growth rate was much lower at ph 6.0 and 6.5 with MV500, indicating that the role of methyl viologen in controlling electron flow and metabolic flux cannot be fully developed until the ph reached a critical value (6.0 in this case). In fact, a blue culture (the color of MV monocation radical MV + ) was observed at ph 6.0 and 6.5 whereas at ph 5.0 and 5.5, the color of the fermentation broth was almost the same to that without MV, suggesting that methyl viologen did not work properly at low phs because the reduction of the parent dication (MV 2+ ) to monocation radical (MV +, blue) was not completed. These results were also consistent with the flux analysis, which reveals that in the presence of 500 μm MV, NADH and butanol flux at ph 6.0 and 6.5 was much higher than those at ph 5.0 and 5.5 (Figure 4.9). Peguin et al. investigated the effect of ph (4.5, 5.0, 5.5, 6.5) on cell growth of C. acetobutylicum in the presence of 1 mm methyl viologen, and reported that the higher the culture ph, the lower the specific growth rate, with the ratio of maximum specific growth rate without MV to that with 1 mm MV decreased from 0.75 at ph 4.5 to 0.20 at ph 6.5 [Peguin et al., 1994]. These results are partially in agreement with our findings, where the cell growth of both strains was significantly inhibited by methyl viologen at neutral phs (6.0 and 6.5). At low phs (5.0 and 5.5), however, no influence of MV on cell growth of C. tyrobutyricum mutant was observed whereas the cell growth of C. acetobutylicum was still strongly hampered by MV. These agreements and differences can be perfectly explained at gene level involving the expression of adhe and adhe2, which is highly affected by culture ph and NADH availability. C. acetobutylicum is a native solventogenic clostridium, which contains both adhe and adhe2 genes. The expression of adhe requires low ph (usually 145

175 below 5.0) while the expression of adhe2 prefers neutral ph ( ) and high NADH availability [Fontaine et al., 2002]. In the presence of methyl viologen, the cell growth of C. acetobutylicum was inhibited at both low phs and neutral phs due to the influence of NADH availability on both adhe and adhe2. Since the transcription of adhe2 gene is highly dependent on NADH availability, a stronger inhibition on cell growth was observed at neutral phs, where adhe2 is specifically expressed. On the other hand, C. tyrobutyricum mutant is a metabolically engineered clostridium in which only adhe2 gene is overexpressed. Because of the absence of adhe gene in C. tyrobutyricum mutant, no influence of methyl viologen on cell growth was observed at low phs. At neutral phs, however, the cell growth was significantly inhibited by methyl viologen due to the remarkably increased NADH availability and its effect on adhe2 activity. It is interesting to note that in terms of butanol titer, similar results were obtained for both with and without methyl viologen at a ph higher than 5.0 (Table 4.7). The butanol challenge results indicated that 13 g/l butanol could strongly inhibit the growth of C. tyrobutyricum mutant in CGM medium using glucose as the substrate (data not shown). In fact, very few solventogenic clostridia can tolerate more than 15 g/l butanol [Ezeji et al., 2010; Kumar and Gayen, 2011]. In terms of butanol yield and solvents/acids ratio, however, significant improvements were achieved in the presence of 500 μm MV, especially for ph 6.0 and 6.5 (Table 4.7). Therefore, it is expected that high-titer and high-yield butanol production can be realized by developing hyper-butanol-tolerant mutants and using methyl viologen as an artificial electron carrier. Gas stripping was successfully applied for in situ butanol recovery and minimizing butanol-induced inhibition, resulting in a high butanol titer (>50 g/l) and yield (>0.30 g/g 146

176 glucose) in an integrated fermentation-separation process. Butanol production by native solventogenic clostridia usually suffers from low butanol yield due to acetone accumulation [Lee et al., 2008]. In fact, the butanol yield in the conventional ABE fermentation via solventogenic clostridia is typically less than 0.25 g butanol per gram substrate [Ezeji et al., 2010]. However, heterologous expression of the butanol synthesis pathway in C. tyrobutyricum can avoid this problem because the wild-type C. tyrobutyricum does not produce acetone. In addition, the supply of methyl viologen can maximize butanol yield by effectively inhibiting the generation of acetic and butyric acids, for which butanol becomes the main product with extremely low accumulation of acids (Figures 4.11 and 4.12). Moreover, cell immobilization in the FBB was utilized to further improve butanol yield by facilitating the achievement of high cell tolerance to toxic metabolites and prolonged cell viability for continuous butanol production without degeneration and sporulation (Huang et al., 2004). Finally, since methyl viologen only serves as an artificial electron carrier to transport electrons, it was consumed during the fermentation, suggesting that methyl viologen can continuously work in the integrated process. 4.5 Conclusion High-yield and high-titer butanol production in C. tyrobutyricum mutant was achieved by providing external driving forces, including the supply of methyl viologen to alter electron flow and metabolic flux favorable for butanol synthesis and integrated gas stripping to realize online butanol recovery and minimize butanol-induced inhibition. A continuous butanol production to a total titer of >50 g/l with a final yield of ~0.33 g butanol per gram glucose was obtained in the integrated fed-batch fermentation and gas 147

177 stripping process associated with cell immobilization in FBB. This study has demonstrated the importance of NADH and detoxification driving forces in butanol synthesis pathways as well as a stable and reliable process for the enhanced production of butanol, a superior biofuel to ethanol, by metabolically engineered clostridia. 4.6 References Adams MWW, Mortenson LE The physical and catalytic properties of hydrogenase II of Clostridium pasteurianum. A comparison with hydrogenase I. J Biol Chem 259: Bahl H, Andersch W, Gottschalk G Continuous production of acetone and butanol by Clostridium acetobutylicum in a two stage phosphate limited chemostat. Eur J Appl Microbiol Biotechnol 15: Bond-Watts BB, Bellerose RJ, Chang MCY Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways. Nat Chem Biol 7: Cascone R Biobutanol-A replacement for bioethanol? Chem Eng Prog 104:S4-S8. Datta R, Zeikus JG Modulation of acetone butanol ethanol fermentation: utilization of carbon monoxide to inhibit hydrogen production and to enhance butanol yields. Appl Environ Microbiol 48: Doremus MG, Linden JC, Moreira AR Agitation and pressure effect on acetone butanol fermentation. Biotechnol Bioeng 27: Durre P, Kuhn A, Gottwald M, Gottschalk G Enzymatic investigations on butanol dehydrogenase and butyraldehyde dehydrogenase in extracts of Clostridium acetobutylicum. Appl Microbiol Biotechnol 26: Durre P Biobutanol: An attractive biofuel. J Biotechnol 2: Ezeji T, Milne C, Price ND, Blaschek HP Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl Microbiol Biotechnol 85: Ezeji TC, Qureshi N, Blaschek HP Production of butanol by Clostridium beijerinckii BA101 and in-situ recovery by gas stripping. World J Microbiol Biotechnol 19:

178 Ezeji TC, Qureshi N, Blaschek HP. 2004a. Acetone butanolethanol (ABE) production from concentrated substrate: Reduction in substrate inhibition by fed-batch technique and product inhibition by gas stripping. Appl Microbiol Biotechnol 63: Ezeji TC, Qureshi N, Blaschek HP. 2004b. Butanol fermentation research: upstream and downstream manipulations. Chem Rec 4: Ezeji TC, Qureshi N, Blaschek HP Butanol production from agricultural residues: Impact of degradation products on Clostridium beijerinckii growth and butanol fermentation. Biotechnol Bioeng 97: Fontaine L, Meynial-Salles I, Girbal L, Yang XH, Croux C, Soucaille P Molecular characterization and transcriptional analysis of adhe2, the gene encoding the NADHdependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol 184: Girbal L, Soucaille P Regulation of solvent production in Clostridium acetobutylicum. Trends Biotechnol 16:1-16. Girbal L, Vasconcelos I, Saint-Amans S, Soucaille P How neutral red modified carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph. FEMS Microbiol Rev 16: Green EM, Boynton ZL, Harris LM, Rudolph FB, Papoutsakis ET, Bennett GN Genetic manipulation of acid formation pathways by gene inactivation in Clostridium acetobutylicum ATCC 824. Microbiology (UK) 142: Harris LM, Desai RP, Welker NE, Papoutsakis ET Characterization of recombinant strains of the Clostridium acetobutylicum butyrate kinase inactivation mutant: Need for new phenomenological models for solventogenesis and butanol inhibition? Biotechnol Bioeng 67:1-11. Haus S, Jabbari S, Millat T, Janssen H, Fischer RJ, Bahl H, King JR, Wolkenhauer O A systems biology approach to investigate the effect of ph-induced gene regulation on solvent production by Clostridium acetobutylicum in continuous culture. BMC Systems Biology 5: Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP The clostron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods 70: Huang WC, Ramey DE, Yang ST Continuous production of butanol by Clostridium acetobutylicum immobilized in a fibrous bed bioreactor. Appl Biochem Biotechnol 115: Janssen H, Döring C, Ehrenreich A, Voigt B, Hecker M, Bahl H, Fischer RJ A proteomic and transcriptional view of acidogenic and solventogenic steady-state cells 149

179 of Clostridium acetobutylicum in a chemostat culture. Appl Microbiol Biotechnol 87: Jo JH, Lee DS, Park JM The effects of ph on carbon material and energy balances in hydrogen-producing Clostridium tyrobutyricum JM1. Bioresour Technol 99: Jones DT, Woods DR Acetone butanol fermentation revisited. Microbiol Rev 50: Junelles AM, Janiti-Idrissi R, Petitdemange H, Gay R Iron effect on acetonebutanol fermentation. Curr Microbiol 17: Kim TS, Kim BH Electron flow shift in Clostridium acetobutylicum fermentation by electrochemically introduced reducing equivalent. Biotechnol Lett 10: Kumar M, Gayen K Developments in biobutanol production: New insights. Appl Energy 88: Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung SK Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: Li SY, Srivastava R, Suib SL, Li Y, Parnas RS Performance of batch, fed-batch, and continuous A-B-E fermentation with ph-control. Bioresour Technol 102: Liu S, Qureshi N How microbes tolerate ethanol and butanol. New Biotechnol 26: Liu X, Zhu Y, Yang ST. 2006a. Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Prog 22: Liu X, Zhu Y, Yang ST. 2006b. Butyric acid and hydrogen production by Clostridium tyrobutyricum ATCC and mutants. Enz Microb Technol 38: Lu C, Zhao J, Yang ST, Wei D Fed-batch fermentation for n-butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour Technol 104: Lutke-Eversloh T, Bahl H Metabolic engineering of Clostridium acetobutylicum: recent advances to improve butanol production. Curr Opin Biotechnol 22: Meyer CL, Roos JW, Papoutsakis ET Carbon monoxide gasing leads to alcohol production and butyrate uptake without acetone formation in continuous cultures of Clostridium acetobutylicum. Appl Microbiol Biotechnol 24:

180 Papoutsakis ET Engineering solventogenic clostridia. Curr Opin Biotechnol 19: Peguin S, Goma S, Delorme P, Soucaille P Metabolic flexibility of Clostridium acetobutylicum in response to methyl viologen. Appl Microbiol Biotechnol 42: Peguin S, Soucaille P Modulation of carbon and electron flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl Microbiol Biotechnol 61: Peguin S, Soucaille P Modulation of metabolism of Clostridium acetobutylicum grown in chemostat culture in a three-electrode potentiostatic system with methyl viologen as electron carrier. Biotechnol Bioeng 51: Rao G, Mutharasan R Alcohol production by Clostridium acetobutylicum induced by methyl viologen. Biotechnol Lett 8: Rao G, Mutharasan R Altered electron flow in continuous cultures of Clostridium acetobutylicum induced by viologen dyes. Appl Environ Microbiol 53: Shao L, Hu S, Yang Y, Gu Y, Chen J, Yang Y, Jiang W, Yang S Targeted gene disruption by use of a group II intron (targetron) vector in Clostridium acetobutylicum. Cell Research 17: Shen CR, Lan EI, Dekishima Y, Baez A, Cho KM, Liao JC Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl Environ Microbiol 77: Van der Zee FP, Cervantes FJ Impact and application of electron shuttles on the redox (bio)transformation of contaminants: A review. Biotechnol Advances 27: Vasconcelos I, Girbal L, Soucaille P Regulation of carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph on mixtures of glucose and glycerol. J Bacteriol 176: Wang S, Zhu Y, Zhang Y, Li Y Controlling the oxidoreduction potential of the culture of Clostridium acetobutylicum leads to an earlier initiation of solventogenesis, thus increasing solvent productivity. Appl Microbiol Biotechnol 93: Xue C, Zhao J, Lu C, Yang ST, Bai F, Tang IC High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping. Biotechnol Bioeng DOI: /bit Yerushaimi L, Volesky B Importance of agitation in acetone butanol fermentation. Biotechnol Bioeng 27:

181 Yu M, Zhang Y, Tang IC, Yang ST Metabolic engineeringof Clostridium tyrobutyricum for n-butanol production. Metab Eng 13: Zheng YN, Li LZ, Xian M, Ma YJ, Yang JM, Xu X, He DZ Problems with the microbial production of butanol. J Ind Microbiol Biotechnol 36: Zhu Y, Liu X, Yang ST Construction and characterization of pta gene-deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotechnol Bioeng 90: Zhu Y, Yang ST Effect of ph on metabolic pathway shift in fermentation of xylose by Clostridium tyrobutyricum. J Biotechnol 110:

182 MV concentration (μm) μ (h -1 ) 0.131± ± ± ± ±0.000 Butanol Titer (g/l) 3.27± ± ± ± ±0.08 Yield (g/g) 0.097± ± ± ± ±0.003 Butyric acid Titer (g/l) 6.00± ± ± ± ±0.08 Yield (g/g) 0.178± ± ± ± ±0.000 Ethanol Titer (g/l) 0.78± ± ± ± ±0.04 Yield (g/g) 0.023± ± ± ± ±0.001 Acetic acid Titer (g/l) 3.31± ± ± ± ±0.03 Yield (g/g) 0.098± ± ± ± ±0.001 Solvents/Acids ratio (mol/mol) 0.50± ± ± ± ±0.14 Table 4.1 Effects of methyl viologen on fermentation kinetics of C. tyrobutyricum CtΔack -adhe2 grown on glucose in serum bottles at 37 o C and ~ph

183 BV concentration (μm) μ (1/h) 0.147± ± ± ±0.001 Lag phase (day) Butanol Titer (g/l) 9.23± ± ± ±0.27 Yield (g/g) 0.174± ± ± ±0.005 Butyric acid Titer (g/l) 3.93± ± ± ±0.21 Yield (g/g) 0.074± ± ± ±0.006 Ethanol Titer (g/l) 2.34± ± ± ±0.12 Yield (g/g) 0.044± ± ± ±0.002 Acetic acid Titer (g/l) 3.96± ± ± ±0.00 Yield (g/g) 0.074± ± ± ±0.001 Solvents/Acids ratio (mol/mol) 1.59± ± ± ±0.92 Table 4.2 Effects of benzyl viologen on fermentation kinetics of C. tyrobutyricum CtΔack -adhe2 grown on glucose in serum bottles at 37 o C and ~ph

184 Nitrogen source N1 N2 N3 N4 μ (1/h) 0.092± ± ± ±0.000 Lag phase (day) Butanol Titer (g/l) 10.14± ± ± ±0.04 Yield (g/g) 0.258± ± ± ±0.017 Butyric acid Titer (g/l) 1.72± ± ± ±0.44 Yield (g/g) 0.044± ± ± ±0.021 Ethanol Titer (g/l) 0.42± ± ± ±0.18 Yield (g/g) 0.011± ± ± ±0.006 Acetic acid Titer (g/l) 0.34± ± ± ±0.18 Yield (g/g) 0.009± ± ± ±0.007 Solvents/Acids ratio (mol/mol) 5.85± ± ± ±0.58 Table 4.3 Effects of nitrogen source concentration on fermentation kinetics of CTΔackadhE2 mutant grown on CGM medium supplemented with 500 μm methyl viologen in serum bottles. 155

185 MV concentration (μm) μ (1/h) 0.150± ± ± ±0.006 Lag phase (day) Butanol Titer (g/l) 2.83± ± ± ±0.70 Yield (g/g) 0.074± ± ± ±0.005 Butyric acid Titer (g/l) 7.15± ± ± ±0.05 Yield (g/g) 0.186± ± ± ±0.004 Ethanol Titer (g/l) Yield (g/g) Acetic acid Titer (g/l) 3.17± ± ± ±0.00 Yield (g/g) 0.083± ± ± ±0.000 Solvents/Acids ratio (mol/mol) 0.28± ± ± ±0.29 Table 4.4 Effects of methyl viologen on fermentation kinetics of CTWT-adhE2 mutant grown on glucose in serum bottles at 37 o C and ~ph

186 MV concentration (μm) μ (1/h) 0.092± ± ± ±0.002 Lag phase (day) Butanol Titer (g/l) 7.34± ± ± ±0.43 Yield (g/g) 0.143± ± ± ±0.001 Butyric acid Titer (g/l) 7.81± ± ± ±0.16 Yield (g/g) 0.152± ± ± ±0.000 Ethanol Titer (g/l) 0.91± ± ± ±0.05 Yield (g/g) 0.018± ± ± ±0.002 Acetic acid Titer (g/l) 2.81± ± ± ±0.09 Yield (g/g) 0.055± ± ± ±0.002 Solvents/Acids ratio (mol/mol) 0.88± ± ± ±0.14 Table 4.5 Effects of methyl viologen on fermentation kinetics of CtΔptb-adhE2 mutant grown on glucose in serum bottles at 37 o C and ~ph

187 158 Parameters Mutants MV concentration (μm) Butanol titer (g/l) Butanol yield (g/g glucose) μ (1/h) Lag phase (day) Solvents/Acids ratio (mol/mol) CTΔack-adhE2 3.27± ±0.36 / 11.08± ±0.08 CTWT-adhE2 2.83± ±0.29 / 9.28± ±0.70 CTΔptb-adhE2 7.34± ± ± ±0.43 / CTΔack-adhE ± ±0.006 / 0.271± ±0.003 CTWT-adhE ± ±0.027 / 0.267± ±0.005 CTΔptb-adhE ± ± ± ±0.001 / CTΔack-adhE ± ±0.000 / 0.074± ±0.000 CTWT-adhE ± ±0.000 / 0.059± ±0.006 CTΔptb-adhE ± ± ± ±0.002 / CTΔack-adhE2 0 0 / 0 0 CTWT-adhE2 0 0 / 1 2 CTΔptb-adhE / CTΔack-adhE2 0.50± ±0.13 / 5.43± ±0.14 CTWT-adhE2 0.28± ±0.26 / 3.80± ±0.29 CTΔptb-adhE2 0.88± ± ± ±0.14 / Table 4.6 Fermentation performance of CTΔack-adhE2, CTΔptb-adhE2, and CTWT-adhE2 mutants in response to different concentrations of methyl viologen grown on glucose. 158

188 159 ph MV (μm) μ (h -1 ) Butanol Titer (g/l) Yield (g/g) Butyric acid Titer (g/l) Yield (g/g) Ethanol Titer (g/l) Yield (g/g) Acetic acid Titer (g/l) Yield (g/g) Solvents/Acids ratio (mol/mol) ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± Table 4.7 Effects of ph and methyl viologen on fermentation kinetics of C. tyrobutyricum CtΔack -adhe2 grown on glucose in bioreactor at 37 o C. The product yields were calculated based on the available data for each culture condition. 159

189 # Species Equation 1 Cell biomass Glucose NADH ATP 6 CH 1.75 O 0.5 N Pyruvate Glucose + 2 ADP + 2 NAD + 2 Pyruvate + 2 NADH + 2 ATP 3 Acetyl-CoA Pyruvate + CoA + Fd Acetyl-CoA + CO 2 + FdH 2 4 Ethanol Acetyl-CoA + 2 NADH Ethanol + 2 NAD + 5 Acetate Acetyl-CoA + ADP + Pi Acetate + ATP + CoA 6 Butyryl-CoA Acetyl-CoA + 2 NADH Butyryl-CoA + 2 NAD + 7 Butyrate Butyryl-CoA + ADP + Pi Butyrate + ATP + CoA 8 Butanol Butyryl-CoA + 2 NADH Butanol + 2 NAD + 9 Hydrogen FdH 2 Fd + H 2 10 NADH FdH NAD + Fd + 2 NADH Table 4.8 Metabolic pathway stoichiometric equations used in metabolic flux analysis for glucose fermentation by CtΔack-adhE2. Reversible reactions are indicated with, whereas irreversible reactions are indicated with. 160

190 FBB Condenser CO 2 /H 2 Feed Cold water Product Figure 4.1 Experimental setup to integrate fed-batch fermentation in a fibrous-bed bioreactor with gas stripping for continuous butanol production and recovery [Xue et al., 2012]. 161

191 Butyric acid (g/l) Acetic acid (g/l) Butanol (g/l) Ethanol (g/l) Glucose (g/l) A MV0 MV50 MV100 MV500 MV1000 B MV0 MV50 MV100 MV500 MV OD Time (h) Time (h) C MV0 MV50 MV100 MV500 MV1000 D MV0 MV50 MV100 MV500 MV Time (h) Time (h) E 7 MV0 MV50 MV100 6 MV500 MV F MV0 MV50 MV100 MV500 MV Time (h) Time (h) Figure 4.2 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown on CGM medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 162

192 Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) Glucose (g/l) A BV0 BV10 BV25 BV50 B BV0 BV10 BV25 BV OD Time (h) Time (h) C BV0 BV10 BV25 BV50 D BV0 BV10 BV25 BV Time (h) Time (h) E BV0 BV10 BV25 BV50 F BV0 BV10 BV25 BV Time (h) Time (h) Figure 4.3 Effects of benzyl viologen (BV) on fermentation kinetics of CtΔack-adhE2 mutant grown on CGM medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 163

193 Glucose (g/l) 70 Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) A N1 N2 N3 N4 B N1 N2 N3 N Time (h) OD Time (h) C N1 N2 N3 N4 D N1 N2 N3 N Time (h) Time (h) E 3.5 N1 N2 3.0 N3 N4 2.5 F N1 N2 N3 N Time (h) Time (h) Figure 4.4 Effect of nitrogen source concentration on fermentation kinetics of CTΔackadhE2 mutant grown on CGM medium supplemented with 500 μm methyl viologen in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 164

194 Glucose (g/l) 60 MV 0 MV 100 MV MV Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) A B MV 0 MV 100 MV 500 MV OD Time (h) Time (h) C 10 8 MV 0 MV 100 MV 500 MV 1000 D MV 0 MV 100 MV 500 MV Time (h) Time (h) E MV 0 MV 100 MV 500 MV 1000 F MV 0 MV 100 MV 500 MV Time (h) Time (h) Figure 4.5 Effects of methyl viologen (MV) on fermentation kinetics of CTWT-adhE2 mutant grown on CGM medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 165

195 Glucose (g/l) 60 MV0 MV100 MV MV500 Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) A B MV0 MV100 MV250 MV OD Time (h) Time (h) C 10 8 MV0 MV100 MV250 MV500 D MV0 MV100 MV250 MV Time (h) Time (h) E MV0 MV100 MV250 MV500 F MV0 MV100 MV250 MV Time (h) Time (h) Figure 4.6 Effects of methyl viologen (MV) on fermentation kinetics of CtΔptb-adhE2 mutant grown on CGM medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 166

196 Butyric acid (g/l) Acetic acid (g/l) Butanol (g/l) Ethanol (g/l) Glucose (g/l) A ph 5.0 ph 5.5 ph 6.0 ph 6.5 B ph 5.0 ph 5.5 ph 6.0 ph OD Time (h) Time (h) C ph 5.0 ph 5.5 ph 6.0 ph 6.5 D ph 5.0 ph 5.5 ph 6.0 ph Time (h) Time (h) E ph 5.0 ph 5.5 ph 6.0 ph 6.5 F ph 5.0 ph 5.5 ph 6.0 ph Time (h) Time (h) Figure 4.7 Effects of ph on fermentation kinetics of CtΔack-adhE2 mutant grown on CGM medium in a bench-scale stirred-tank bioreactor (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 167

197 Butyric acid (g/l) Acetic acid (g/l) Butanol (g/l) Ethanol (g/l) Glucose (g/l) A ph 5.0 ph 5.5 ph 6.0 ph 6.5 B ph 5.0 ph 5.5 ph 6.0 ph Time (h) OD Time (h) C ph 5.0 ph 5.5 ph 6.0 ph 6.5 D ph 5.0 ph 5.5 ph 6.0 ph E ph 5.0 ph 5.5 ph 6.0 ph 6.5 Time (h) Time (h) F ph 5.0 ph 5.5 ph 6.0 ph 6.5 Time (h) Time (h) Figure 4.8 Effects of ph on fermentation kinetics of CtΔack-adhE2 mutant grown on CGM medium supplemented with 500 μm methyl viologen in a bench-scale stirred-tank bioreactor (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 168

198 169 Metabolic flux (mol/mol glucose) 0.6 Biomass 1.6 Hydrogen 1.0 NADH Pyruvate Acetyl-CoA Acetate Ethanol MV0 MV MV MV Butyryl-CoA Butyrate Butanol MV Time (h) Figure 4.9 Metabolic flux analysis for effects of methyl viologen concentration on each key node involved in the metabolic pathways (see Figure 4.10 for metabolic pathways and supplemental material for pathway stoichiometry). 169

199 A Glucose Biomass 2NADH + 2ATP CoA Pyruvate Fd NADH H 2 Acetate ATP ack pta CO 2 FdH 2 adhe2 adhe2 Acetyl-CoA Acetaldehyde NADH NADH Ethanol ctfab Acetoacetyl-CoA 2NADH Butyrate buk ATP ptb adhe2 adhe2 Butyryl-CoA Butylaldehyde Butanol NADH NADH B Glucose Biomass MV0: ph5.0 ph5.5 ph6.0 ph MV500: ph5.0 ph5.5 ph6.0 ph6.5 2 NADH H 2 Pyruvate Acetate Acetyl-CoA Ethanol Butyrate Butyryl-CoA Butanol Figure 4.10 Metabolic pathways and flux analysis of glucose fermentation by CtΔackadhE2 mutant (A. Metabolic pathways; B. Metabolic flux distributions as affected by ph and methyl viologen). 170

200 Products (g) Glucose (g) OD 600, Products (g) A Glucose Butanol in broth Total butanol OD Ethanol Acetate Butyrate Time (h) B Butanol in broth Total butanol Acetate Butyrate Ethanol Glucose consumption (g) Figure 4.11 Fermentation performance of CtΔack-adhE2 mutant grown on CGM medium supplemented with 500 M methyl viologen and integrated with in situ butanol removal by gas-stripping at ph 6.0 (A, fermentation kinetics; B, product profiles in terms of glucose consumption). 171

201 Products (g) Glucose (g) OD 600, Products (g) A OD Ethanol Acetate Butyrate Butanol in Broth Total Butanol Glucose Time (h) B Acetate Butyrate Ethanol Butanol in Broth Total Butanol Glucose consumption (g) Figure 4.12 Fermentation performance of CtΔack-adhE2 mutant grown on glucose supplemented with 500 M methyl viologen at ph 6.0 in an integrated FBB-gas stripping process (A, fermentation kinetics; B, product profiles in terms of glucose consumption). 172

202 Chapter 5: n-butanol production from glucose and xylose by engineered Clostridium tyrobutyricum in a fibrous-bed bioreactor Abstract Fermentative butanol production usually suffers from low butanol titer, low butanol yield, and high substrate cost. In order to overcome these limitations, adaptation and evolution mutagenesis combined with NADH driving force was used to improve butanol tolerance, minimize by-products generation, as well as facilitate xylose utilization. High-titer (~20.0 g/l) and high-yield (>0.30 g/g) butanol production from glucose, xylose, and glucosexylose co-substrate was successfully achieved with immobilized-cell fermentation in a fibrous-bed bioreactor (FBB). In addition, simultaneous consumption of glucose and xylose was observed during the co-fermentation in FBB, an essential characteristic of a desired bacterial strain for the development of biofuels from lignocellulosic materials. Moreover, scanning electron microscopy revealed that immobilized-cell fermentation in FBB can achieve high cell density, enhance cell viability, and facilitate cell interaction. Finally, a continuous butanol production to a total titer of 60.0 g/l and an overall yield of 0.35 g/g was realized via the integration of fed-batch fermentation and gas stripping, an efficient method to realize in situ butanol recovery, alleviate butanol-induced inhibition, and reduce production cost. To my knowledge, this is the highest butanol titer and yield achieved in a heterologous platform by an engineered clostridia mutant. This study has demonstrated a stable and reliable process for high-titer, high-yield, and cost-effective n- butanol production from glucose and xylose. 173

203 5.1 Introduction With increasing concerns over resources, energy, environment, and security issues, the development of sustainable and renewable transportation fuels has attracted more and more attention [Durre, 2007]. Due to its superior physicochemical properties, butanol is now considered as one of the most promising candidates to replace gasoline [Cascone, 2008]. Tremendous efforts have been made to facilitate fermentative butanol production [Lee et al., 2008; Papoutsakis, 2008]. However, low butanol titer due to low solvent tolerance, low butanol yield due to the formation of by-products, as well as high cost of fermentation substrate have strongly limited the performance of butanol fermentation, making it not economically competitive to petroleum-based fuels [Ezeji et al., 2010; Kumar and Gayen, 2011]. Butanol yield in acetone-butanol-ethanol (ABE) fermentation by solventogenic clostridia, such as Clostridium acetobutylicum and Clostridium beijerinckii, cannot be very high (usually < 0.25 g/g) due to the accumulation of acetone, which also make it more difficult to recover butanol from fermentation broth [Lutke-Eversloh and Bahl, 2011]. Actually, a typical ratio of acetone, butanol, and ethanol is 3:6:1 in ABE fermentation [Jones and Woods, 1986]. Aldehyde/alcohol dehydrogenase (adhe2) overexpressed C. tyrobutyricum mutants could be a promising solution to this problem because this bacterium does not produce acetone, in which butanol has a potential to become the primary solvent [Yu et al., 2011]. However, it has been demonstrated that butanol yield in adhe2-overexpressed C. tyrobutyricum mutants was similar to that in native solventogenic clostridia (0.20 g/g) due to the fact that acetic and butyric acids were still produced as the major by-products in these mutants [Yu et al., 2011]. By introducing an 174

204 artificial electron carrier, specifically methyl viologen or benzyl vilogen, which can increase the availability of NADH, an important factor that can determine butanol production, into the culture medium of butanol-producing C. tyrobutyricum mutants, a significant improvement in butanol yield (> 0.30 g/g) was observed with a greatly reduced formation of acetic and butyric acids. This result was consistent with previous studies, in which the effects of artificial electron carriers on alcohol production in C. acetobutylicum were investigated [Kim and Kim, 1988; Peguin et al., 1994; Peguin and Soucaille, 1995, 1996; Rao and Mutharasan, 1986, 1987; Girbal et al., 1995]. Inhibition effect induced by high butanol titer is one of the most crucial challenges for fermentative butanol production [Nicolaou et al., 2010]. Actually, very few solventogenic clostridia can tolerate more than 15 g/l butanol [Liu and Qureshi, 2009; Ezeji et al., 2010]. Low butanol titer does not only negatively affect butanol yield and productivity, but also significantly increase the costs for butanol recovery. It is estimated that the production cost for butanol separation will be decreased by 50% if the final butanol titer can be improved from 12 g/l to 19 g/l [Papoutsakis et al., 2005]. Considerable efforts have been made to overcome poor solvent resistance and improve butanol titer, at both strain and process levels [Lee et al., 2008; Zheng et al., 2009]. Integrated processes of fermentation and separation, such as adsorption, perstraction, pervaporation, and gas stripping, have been proposed to alleviate butanol-induced inhibition via in situ butanol recovery [Ezeji et al., 2010; Kumar and Gayen, 2011]. Gas stripping is considered as a simple but efficient technique to minimize butanol inhibition without interrupting cell culture, nutrient supply, and intermediate product accumulation [Ezeji et al., 2010; Lee et al., 2008; Kumar and Gayen, 2011]. Gas tripping also has a couple of advantages over 175

205 other integrated processes, including easier operation, lower capital investment and energy input [Oudshoorn et al., 2009]. Actually, gas stripping has been widely applied in previous studies for fermentative butanol production by solventogenic clostridia [Ezeji et al., 2003, 2004; Lu et al., 2012; Xue et al., 2012]. Adaptation and evolution in fibrous-bed bioreactor (FBB) is another advanced fermentation strategy to improve solvent tolerance and butanol titer [Yang, 1996].The highly porous fibrous matrix has large surface area and void volume to allow high densities of immobilized cells, which can facilitate the achievement of high cell tolerance to toxic metabolites including butanol [Yang, 1996]. In addition, the adapted cells are forced to contact with gradually increased butanol concentrations, which in turn could provide a selection pressure to drive the evolution towards higher butanol titers. FBB technology has been successfully applied for enhanced production of various value-added chemicals and biofuels, including propionic acid, butyric acid, and butanol, with a remarkable increase in titer, yield and productivity [Huang et al., 2002; Zhu and Yang, 2003; Shim et al., 2002; Suwannakham and Yang, 2005, Jiang et al., 2009; Jiang et al., 2010; Huang et al., 2011; Lu et al., 2012; Xue et al., 2012; Wei et al., 2012, Wang and Yang, 2013]. In this study, free-cell fermentation was utilized to determine the optimal culture conditions for fermentative butanol production by C. tyrobutyricum in the presence of artificial electron carriers, either methyl viologen or benzyl viologen. Then adaptation and evolution with immobilized-cell fermentation in FBB was applied to obtain high cell density, improve solvent resistance, and achieve high butanol titer with an emphasis on process development, performance, and evaluation. Finally, fed-batch fermentation and 176

206 gas stripping was integrated to minimize butanol-induced inhibition via in situ butanol recovery with a further improvement in butanol titer and yield. This is the first report realizing fermentative butanol production with high-titer and high-yield by immobilized cells of metabolically engineered clostridia. 5.2 Materials and Methods Strain and culture conditions C. tyrobutyricum mutant strain CtΔack-adhE2 with an overexpression of adhe2 gene and a partially knockout of ack gene was used in this study [Liu et al., 2006; Yu et al., 2011]. The stock culture of CtΔack-adhE2 was maintained anaerobically at -85 o C in Reinforced Clostridial Medium (RCM; Difco, Detroit, MI) supplemented with 30 μg/ml thiamphenicol. Unless otherwise noted, all fermentation studies were carried out at 37 o C in corn steep liquor (CSL) medium containing 80 g/l glucose or xylose or glucose and xylose mixture, 30 g/l corn steep liquor (Dow AgroSciences, Indianapolis, IN), 3 g/l (NH 4 ) 2 SO 4, 1.5 g/l K 2 HPO 4, 0.6 g/l MgSO 4.7H 2 O, 0.03 g/l FeSO 4.7H 2 O, 0.5 g/l cysteine, certain amount of methyl viologen (MV) or benzyl viologen (BV), and 30 μg/ml thiamphenicol Effects of methyl viologen or benzyl viologen The effects of methyl viologen (MV) or benzyl viologen (BV) as an artificial electron carrier on fermentation kinetics of CtΔack-adhE2 were studied in serum bottles. The methyl viologen or benzyl viologen (Sigma-aldrich) stock solution (100 ) was sterilized by filtration and added into the medium to a final concentration (μm) of 0 (MV0), 50 (MV50), 100 (MV100), 500 (MV500), and 1000 (MV1000) for MV and 0 (BV0),

207 (BV10), 25 (BV25), and 50 (BV50) for BV, respectively. Each bottle, containing 50 ml of the medium, was inoculated with 1.0 ml active cells of CtΔack-adhE2 from an overnight culture in RCM at 37 o C anaerobically. After inoculation, these serum bottles were incubated at 37 o C with ph adjusted to 6.5 once a day by adding 10% (w/v) NaOH solution. Samples were taken periodically to monitor cell growth, glucose consumption, and metabolites (ethanol, butanol, acetic acid, butyric acid, and lactate) production during the fermentation. Duplicate bottles were used for each MV or BV concentration studied Free-cell fermentation Free-cell fermentation was carried out in a bench-scale stirred-tank reactor containing 1.5 liters of CSL medium to study the fermentation kinetics of CtΔack-adhE2 mutant using either glucose or xylose as a sole carbon source in the presence MV or BV. Seed culture was maintained in a serum bottle containing 60 ml RCM medium at 37 o C for overnight. After inoculating, the free-cell fermentation was performed at 37 o C with ph controlled at 6.0 by saturated NH 4 OH solution. Cell growth, sugar consumption, and metabolites (ethanol, butanol, acetic acid, and butyric acid) accumulation was monitored by taking and analyzing samples periodically Immobilized-cell fermentation in FBB Immobilized-cell fermentation in FBB was performed in a bench-scale stirred-tank reactor containing 1.5 liters of CSL medium connected with a fibrous-bed bioreactor (a glass column vessel packed with a spiral wound fibrous matrix, Yang, 1996) with a working volume of 400 ml to realize adaptation and evolution. The reactor setup and operation of the FBB system has been described in detail previously [Jiang et al., 2010]. 178

208 Basically, the adaptation and evolution in FBB was operated in a repeated-batch model with a circulation loop, which was used to pump the fermentation broth into the FBB from the bottom, out from the top, and then back to the fermentor to allow cell attachment and immobilization on the fibrous matrix. At the end of each batch, the old medium was pumped out from the whole system (regular fermentor and FBB) and replaced by fresh medium. By starting the circulation loop, the immobilized cells in the FBB was used to inoculate the fresh medium, and a new batch began until butanol accumulation ceased due to product repression. CSL medium containing 80 g/l sugar (glucose or xylose or glucose and xylose mixture) supplemented with various concentrations of MV and BV was used in the immobilized-cell fermentation in FBB to evaluate the performance, stability, and reliability of the whole process. The immobilized-cell fermentation in FBB was conducted at 37 o C with ph controlled at 6.0 by saturated NH 4 OH solution. Cell growth, sugar consumption, and metabolites (ethanol, butanol, acetic acid, and butyric acid) accumulation was monitored by taking and analyzing samples periodically. Figure 5.1 provides a schematic diagram for the experimental setup of repeated-batch fermentation in FBB [Zhang et al., 2009] Fed-batch fermentation with in situ gas stripping Fed-batch fermentation integrated with gas stripping for butanol recovery was studied with immobilized cell fermentation in FBB in CSL medium supplemented with 500 μm MV to further improve butanol titer, yield, and productivity by alleviating product repression. Detailed description for the setup and operation of the integrated system has been given previously [Lu et al., 2012; Xue et al., 2012]. 179

209 5.2.6 Scanning electron microscopy Scanning electron microscopy (SEM) was used to gain detailed information for cell immobilization and interaction within the fibrous matrix. SEM samples were prepared according to a previous study [Ouyang et al., 2007]. Briefly, cell culture samples within the fibrous matrix (0.2X0.2 cm 2 ) were incubated in 2.5% glutaraldehyde solution at 4 o C overnight, washed in PBS solution, dehydrated in ethanol solutions (ethanol concentrations (vol/vol) ranging from 10% to 100% at 10% increment, minutes for each solution), and finally dehydrated in hexamethyldisilazane (HMDS) and ethanol mixtures (HMDS concentrations (vol/vol): 25%, 50%, 75%, and 100%, minutes for each mixture). Desiccated samples were coated with gold/palladium and examined with a Quanta 200 scanning electron microscope (FEI Worldwide, Hillsboro, Oregon, USA) Analytical methods Cell density was measured as the optical density at 600 nm using a spectrophotometer (UV-16-1, Shimadzu, Columbia, MD). Volatile metabolites, including ethanol, acetic acid, butanol, and butyric acid, were analyzed with a gas chromatograph (GC-2014, Shimadzu, Columbia, MD). Glucose and xylose concentration was determined by high performance liquid chromatography (HPLC, LC-20AD, Shimadzu, Columbia, MD). Detailed descriptions of GC and HPLC analyses can be found elsewhere [Yu et al., 2011]. 180

210 5.3 Results and Discussion Effects of artificial electron carriers Effects of methyl viologen It has been demonstrated that methyl viologen had a significant impact on butanol production in CGM medium. In order to compare the fermentation performance in CGM and CSL medium, determine an optimal culture condition, as well as reduce production cost, the effects of methyl viologen on fermentation kinetics of CtΔack-adhE2 mutant were investigated in CSL medium. Similar to previous studies, the fermentation was carried out in serum bottles with MV concentration (μm) of 0 (MV0), 100 (MV100), 250 (MV250), 500 (MV500), and 1000 (MV1000); and the results were given in Figure 5.2 and Table 5.1. Similar to the effects of methyl viologen on CtΔack-adhE2 mutant in CGM medium, MV also presented a profound influence on the fermentation kinetics in CSL medium. Butanol production was remarkably improved from ~9.0 g/l to g/l whereas the generation of ethanol and acetate was dramatically reduced, from >2.0 g/l to <1.0 g/l for ethanol and from >5.0 g/l to <1.0 g/l for acetic acid. Interestingly, the production of butyrate was increased from ~2.0 g/l to g/l at low MV concentrations (MV 100 and MV250) whereas it was decreased to <2.0 g/l at high MV concentrations (MV500 and MV 1000). A significant improvement in butanol yield, from ~0.20 g/g to g/g, and solvents/acids ratio, from ~1.50 mol/mol to ~6.0 mol/mol, was also observed in the presence of MV. Moreover, a similar specific growth rate (~0.19 1/h) was obtained from MV0 to MV500; the cell growth was not severely affected until 181

211 MV concentration was increased to 1000 μm, in which the specific growth rate was decreased to 0.78 /h Effects of benzyl viologen Benzyl viologen is another artificial electron carrier that has shown significant impact on fermentation kinetics of CtΔack-adhE2 mutant in CGM medium. The effects of BV on fermentation performance were also studied in CSL medium with BV concentration (μm) of 0 (BV0), 10 (BV10), 25 (BV25), and 50 (BV50). The results were given in Figure 5.3 and Table 5.2. Different from the effects of methyl viologen, only a slight improvement in butanol production was observed (from ~ 12.0 g/l to ~ 14.0 g/l) in the presence of BV, although the generation of ethanol and acetate was greatly reduced (from ~ 5.0 g/l to ~ 2.0 g/l for ethanol and from > 3.0 g/l to < 0.50 g/l for acetate). The production of butyric acid was also decreased from 2.60 g/l at BV0 to 1.88 g/l at BV25. Due to the reduced production of by-products, butanol yield and solvents/acids ratio was remarkably improved, from 0.23 g/g to 0.30 g/g and from 3.0 mol/mol to 6.0 mol/mol, respectively, which was consistent with the effects of MV. However, benzyl viologen demonstrated a severe inhibitory effect on cell growth even at a very low concentration such as 10 μm. In fact, a significantly lower specific growth rate (0.08 1/h vs /h) and longer lag phase (2 days) was observed in the presence of BV. It should be noted that in the presence of 50 μm BV, butanol production was decreased compared to the control, which might be caused by the fact that the cell growth and metabolism was strongly inhibited by such a high BV concentration. 182

212 Comparison of effects of artificial electron carriers in CGM and CSL medium The effects of methyl viologen and benzyl viologen on several key parameters including butanol titer, butanol yield, specific growth rate, and solvents/acids ratio of CtΔackadhE2 mutant grown in CGM and CSL medium are summarized and compared in Figure 5.4 and Figure 5.5, respectively. It is clear that for each MV level, higher butanol titers and yields were achieved in CSL medium than in CGM medium, indicating that CSL is an excellent organic nitrogen source for butanol production by clostridium spp. In particular, without MV, a butanol titer of ~3.0 g/l with a yield of less than 0.10 g/g was observed in CGM medium while in CSL medium, the butanol titer and yield reached as high as 9.0 g/l and over 0.20 g/g, respectively (Figure 5.4). In addition, in the presence of 500 μm MV, a significant inhibitory impact on cell growth was observed in CGM medium whereas in CSL medium, the cell growth was not severely affected until MV concentration reached 1000 μm, which further confirmed that CSL is a better medium than CGM to support cell growth and metabolism as well as improve cell viability during stressful conditions (Figure 5.4). Moreover, except for MV1000, higher solvents/acids ratios were obtained in CSL medium than in CGM medium, which would suggest that CSL is beneficial for solvents production (Figure 5.4). Similar to MV effects in CGM and CSL medium, higher butanol titers and yields were achieved in CSL medium than in CGM medium in the presence of benzyl viologen, although the improvement in butanol titer and yield in BV supplemented CSL medium was not as significant as that in MV supplemented CSL medium (Figure 5.5). For each 183

213 MV level, however, the specific growth rate in CSL medium was very close to that in CGM medium, which was different from the effects of MV in CGM and CSL medium. In fact, BV was able to strongly inhibit cell growth in both CGM and CSL medium at a concentration as low as 10 μm, which further confirmed that as an artificial electron carrier, BV is more efficient than MV (Figure 5.5). In terms of solvents/acids ratio, higher S/A ratios were observed in CSL medium at BV0 and BV10 whereas at BV25 and BV50, S/A ratio became higher in CGM medium, which would suggest that BV concentration higher than 25 μm might not be a favorable condition for solvents production in CSL medium (Figure 5.5). Higher butanol titer, butanol yield, specific growth rate, and solvents/acids ration achieved in CSL medium than those in CGM medium is predictable because previous studies have demonstrated that corn steep liquor is a superior complex nutrient source containing various trace elements, nitrogenous components, proteins and amino acids that can stimulate cell growth and metabolism, support high cell density, improve cell viability, and facilitate cell survival during stressful culture conditions [Choi et al., 2013]. It has been reported that except for tyrosine, glutamine, histidine, and tryptophan, all the other 16 amino acids were detected in corn steep liquor with cysteine, glutamic acid, alanine, leucine, phenylalnine, aspartic acid, threonine, proline, valine, isoleucine, and lysine exceeding 100 mg/l, suggesting that CSL is a rich source of various amino acids [Choi et al., 2013]. In addition, various valuable major and trace elements that are essential for cell growth and metabolism were identified in corn steep liquor including potassium, phosphorous, sulphur, sodium, silicon, magnesium, manganese, zinc, iron, and calcium [Choi et al., 2013]. In fact, CSL contains as high as g/l nitrogen [Choi 184

214 et al., 2013]. However, it should be pointed out that concentration variations in major and trace elements, nitrogen source, proteins, and amino acids are frequently observed in different corn treatment processes [Hull et al., 1996]. Corn steep liquor has been considered as an alternative and cost-effective nutritional source for economically competitive production of butanol by solventogenic clostridia because it is inexpensive, abundant, renewable, and easy to use. Qureshi et al. reported the utilization of corn steep liquor, a byproduct of the corn wet-milling process, for ABE production by C. beijerinckii BA101, which produced 6.29 g/l ABE with a productivity of 2.01 g/l/h at a dilution rate of /h in a continuous fermentation process [Qureshi et al., 2004]. In order to improve the economic competitiveness of fermentative butanol production, Parekh et al. used corn steep water (CSW) medium, similar to corn steep liquor medium, as a low-cost nutrient source for ABE production by C. beijerinckii BA101 at a pilot scale [Parekh et al., 1999]. The strain was able to produce as high as 17.8 g/l butanol and 23.6 g/l total ABE in CSW medium in a 200 liter pilot-scale fermentor [Parekh et al., 1999]. Recently, corn steep liquor was analyzed and considered as a complex nutrient source for ABE production by a C. acetobutylicum mutant [Choi et al., 2013]. It has been reported that in 6% CSL-containing medium, the mutant was capable of producing 14.5 g/l butanol and 21.4 g/l total ABE, which was comparable to ABE production in CGM medium (14.2 g/l butanol and 22.6 g/l total ABE) [Choi et al., 2013]. The butanol yield and productivity (0.28 g/g vs g/g, and 0.81 g/l/h vs g/l/h) in CSL medium, however, was significantly higher than those in CGM medium [Choi et al., 2013]. In this study, high-titer (~ 14.0 g/l), high-yield (> 0.30 g/g), and costeffective butanol production by engineered C. tyrobutyricum using corn steep liquor as a 185

215 superior nitrogen source was also achieved in the presence of methyl viologen or benzyl viologen Free-cell fermentation Butanol production from glucose Fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with glucose as a substrate in the presence of artificial electron carriers was shown in Figure 5.6 (A, no MV or BV; B, 500 μm MV; C, 25 μm BV). Without artificial electron carriers (Figure 5.6 (A)), acetate, butyrate, and butanol were the three major products with a titer of g/l, 8.05 g/l, and g/l, respectively. Due to the excessive accumulation of by-products, butanol yield was very low, only 0.15 g butanol/g glucose, much lower than a typical ABE fermentation via solventogenic clostridia ( g/g) [Lee et al., 2008]. A high specific growth rate (0.19 h -1 ) and cell density (OD 600 > 40), however, was observed, which might be caused by the fact that ATP was generated predominantly during acids synthesis pathways [Lutke-Eversloh and Bahl, 2011]. In the presence of 500 μm MV (Figure 5.6 (B)), butanol became the only major product with a titer of nearly 16 g/l. The generation of by-products, including acetate, butyrate, and ethanol, was significantly reduced with both acetate and ethanol less than 1 g/l. Because of the reduced accumulation of by-products, a remarkable improvement in butanol yield (0.33 g/g vs g/g) was achieved, an increase of over 100% (Table 5.3). In addition, a much lower specific growth rate (0.10 h -1 ) and cell density (OD 600 ~ 20) was observed due to the reduced generation of ATP (Table 1). The fermentation kinetics with 25 μm BV was very similar to that in the presence of 500 μm MV. As shown in 186

216 Figure 5.6 (C), butanol was produced dominantly with a titer of over 15 g/l. In addition, butanol yield was remarkably improved to 0.28 g/g, an over 80% increase compared to the control (Table 5.3). Moreover, the generation of by-products was significantly inhibited with very low titers of acetate, ethanol, and butyrate. Furthermore, a low specific growth rate (0.08 h -1 ) and cell density (OD 600 ~ 20) was observed (Table 5.3). It is clear that artificial electron carriers (MV or BV) can significantly improve butanol titer and yield at the expense of acetate, ethanol, and butyrate. These results were consistent with previous studies on the effects of artificial electron carriers on butanol production in C. acetobutylicum, a native solventogenic clostridia [Kim and Kim, 1988; Peguin et al., 1994; Peguin and Soucaille, 1995, 1996; Rao and Mutharasan, 1986, 1987; Girbal et al., 1995]. High butanol titer (>15 g/l) and yield (>0.30 g/g) in adhe2- overexpressed C. tyrobutyricum mutant was successfully achieved by introducing MV or BV, which can divert electron flow and drive carbon flux towards butanol synthesis pathway, the most reducing step in the metabolic network, by increasing NADH availability [Peguin et al., 1994; Fontaine et al., 2002; Shen et al., 2011; Lutke-Eversloh and Bahl, 2011]. In addition, butanol became the only major product with very low titers of by-products (acetate, ethanol, and butyrate), which can contribute significantly to costeffective butanol recovery from fermentation broth since butanol can be readily recovered through a preliminary separation step, such as pervaporation, adsorption, and gas tripping [Ezeji et al., 2010]. Moreover, it is interesting to note that the similar fermentation kinetics were observed in the presence of 500 μm MV or 25 μm BV, indicating that as an electron carrier, MV is less efficient than BV, which might be caused by the fact that they have different chemical structures and their monocation 187

217 radicals (the functional group) have different electron-carrying abilities [Girbal and Soucaille, 1998]. Actually, the standard redox potential of BV (-360 mv) is very close to that of ferredoxin (-330 mv), the native electron carrier in most anaerobic bacteria, whereas MV has a standard redox potential of -440 mv [Van der Zee and Cervantes, 2009] Butanol production from xylose Fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using xylose as a substrate without or with 10 μm BV is shown in Figure 5.7 (A, no BV; B, 10 μm BV). Without artificial electron carriers (Figure 5.7A), slightly higher titers of butanol and butyrate (12.52 and 8.87 g/l, respectively) was produced in xylose fermentation than in glucose fermentation (11.55 and 8.05 g/l, respectively). Acetic acid production in xylose fermentation, however, was much lower than that in glucose fermentation (6.56 g/l vs g/l). As a result, a higher butanol yield (0.20 g/g) was achieved when using xylose as the substrate, which was comparable to traditional ABE fermentation with glucose as a substrate. Because of reduced production of acids, xylose fermentation presented a lower specific growth rate (0.12 h -1 ) and cell density (OD 600 ~ 25) (Table 5.3). By supplementing 10 μm BV in the culture media, butanol became the predominant product (~ 18.0 g/l) with extremely low generation of acetate and ethanol (both of them less than 0.5 g/l), although the same level of butyric acid production was observed (~ 8.0 g/l) in xylose fermentation both with and without BV. Similar to glucose fermentation, redox mediators can significantly improve butanol yield (0.32 g/g) whereas inhibit cell growth (0.05 h -1 ) in xylose fermentation. 188

218 Microbial product profiles are usually affected by fermentation substrates since different substrates might have different reducing status (NADH/NAD + ratio), energy conservation, and metabolic pathways, all of which can profoundly impact the electron flow and carbon flux among metabolites synthesis pathways [Shinto et al., 2008]. It has been reported that higher butanol titer and yield could be achieved by using more reduced substrates, such as glycerol and mannitol [Andrade and Vasconcelos, 2003; Vasconcelos et al., 1994; Yu et al., 2011; Yu et al., 2012]. In our study, slightly higher butanol titer (12.50 g/l vs g/l) and much higher butanol yield (0.20 g/g vs g/g) was obtained with lower production of acetate and ethanol when xylose, a more reduced substrate, was used in the fermentation, compared to glucose as a carbon source, which further confirmed that reducing power (NADH/NAD + ratio) plays a critical role in redox balance and cellular metabolism [Peguin et al., 1994; Berrıos-Rivera et al., 2002; Bond-Watts et al., 2011; Shen et al., 2011]. In the development of biofuels from lignocellulosic materials, the ability to consume pentose has become an essential characteristic of a desired bacterium since xylose is one of the major components in lignocellulosic biomass hydrolysates [Papoutsakis, 2008; Green, 2011; Jang et al., 2012]. Previous studies have demonstrated that C. tyrobutyricum was an excellent xylose-consumer, which can convert xylose to various products, such as butyric acid [Liu and Yang, 2006; Jiang et al., 2010]. In this study, it was shown that C. tyrobutyricum mutant (CtΔack-adhE2) was capable of producing butanol with a high titer (~18 g/l) and high yield (~0.32 g/g) from xylose, an important characteristic that makes this mutant superior to traditional solventogenic clostridia. Consequently, it is very 189

219 promising to use C. tyrobutyricum for high-titer and high-yield butanol production from lignocellulosic biomass Immobilized-cell fermentation Butanol production from glucose In order to overcome poor solvent resistance, improve butanol titer, as well as evaluate process stability and reliability, repeated-batch fermentation of immobilized-cell CtΔackadhE2 in FBB with glucose as a substrate was used to investigate the effect of adaptation and evolution on fermentation kinetics, as shown in Figure 5.8. Totally, 13 repeated batches (RBs) were operated with using 500 μm MV in the first 9 RBs and 25 μm BV in the last 4 RBs (Figure 5.8A). Due to a continuous adaptation and evolution in FBB, the final butanol titer was steadily increased from ~14.0 g/l in the first RB to ~20.0 g/l in the last RB, indicating that a higher and higher butanol tolerance of immobilized cells was achieved. In addition, the production of acetate and ethanol was limited to a very low level (< 1.0 g/l) because of the supplementation of artificial electron carriers (MV or BV) in the culture medium. However, it is interesting to note that the production of butyric acid, one of the major by-products, was also gradually increased, from ~2.0 g/l to ~6.0 g/l, after continuous adaptation and evolution, which might be a limiting step in improving butanol yield via immobilized-cell fermentation in FBB. Figure 5.8B compared butanol productivity and yield for each repeated batch using glucose as a substrate. A consistent productivity (~0.35 g/l/h) and yield (~0.30 g/g) was obtained within each RB, suggesting that this process was very stable and reliable during a longterm operation. 190

220 The improved cell resistance to toxic metabolites such as butanol is predictable because the adapted cells are forced to contact with gradually increased butanol concentrations, which can provide a selection pressure to drive the evolution towards higher butanol tolerance. As a result, cells with high butanol-tolerating ability will survive and weakened and dead cells killed by the high butanol stress will be washed out from the FBB system [Zhang, 2009]. However, the improvement in butanol tolerance via immobilized-cell fermentation in FBB has an up limit (~20.0 g/l in this case), above which it is hard to survive for the adapted cells. An increasing production of butyric acid accompanied with a consistent low accumulation of acetate and ethanol during the repeated-batch fermentations was also noticed, which might be induced by the impact of adaptation and evolution on enzymatic activities and cellular metabolism. In response to external stresses such as product inhibition, the adapted cells have a tendency to drive more carbon flux towards butyryl-coa, the common precursor for both butanol and butyric acid. Moreover, higher butanol titer and yield and lower butyrate production was observed in the presence of 25 μm BV (the last 4 RBs), compared to 500 μm MV (the first 9 RBs), which might be caused by the fact that BV has a closer standard redox potential to ferredoxin than MV [Van der Zee and Cervantes, 2009]. Finally, a high-titer (~20.0 g/l) and high-yield (~0.30 g/g) butanol production with a stable and reliable process performance in FBB for nearly 40 days was successfully achieved, which might make the fermentative butanol production economically competitive to traditional fossil fuels since the cost for butanol recovery from fermentation broth will be significantly reduced. Actually, it is estimated that the production cost for butanol separation will be decreased by 50% if the final butanol titer can be improved from 12 g/l to 19 g/l [Papoutsakis et al., 2005]. 191

221 Screening C. tyrobutyricum mutants with high butanol-tolerating and butanol-producing abilities can be realized by collecting and sub-culturing the adapted cells from the FBB in stressful conditions. However, it is hard to maintain these improved abilities because adaptation and evolution process is basically a strategic response of adapted cells to various stressful conditions, such as high butanol concentrations. As a result, the cells will gradually lose their acquired abilities if the culture conditions are not stressful enough. Actually, the loss of butanol-producing ability in solventogenic clostridia, especially in adapted clostridia mutants, has been frequently observed in previous studies [Sillers et al., 2008]. Nevertheless, butanol production in C. tyrobutyricum mutants should be more stable than native solventogenic clostridia because it is highly possible that the heterologous butanol synthesis pathway in C. tyrobutyricum is not associated with sporulation, cell autolysis, and acidogenesis/solventogenesis regulation, which are expected to be the major factors limiting butanol production in native solventogenic clostridia [Ezeji et al., 2010; Yu et al., 2011] Butanol production from xylose The kinetics of immobilized-cell fermentation in FBB using xylose as a substrate is given in Figure 5.9A, and Figure 5.9B compares the butanol productivity and yield within each repeated batch. Different BV concentrations were used in the first five repeated batches to determine an optimal BV amount for butanol production (1 μm BV in RB1, 2 μm BV in RB2, 4 μm BV in RB3, 5 μm BV in RB4, and 10 μm BV in RB5-8). Since it was found that cysteine plays a crucial role in cellular metabolism in xylose fermentation, we also considered using 0.5 g/l cysteine in the last three repeated batches (RBs 6-8) 192

222 whereas there was no cysteine supplementation in the first five repeated batches (RBs 1-5). As shown in Figure 5.9A, in terms of butanol production, the fermentation kinetics can be divided into two groups: ~15 g/l in RBs 1-5 and ~17 g/l in RBs 6-8. The higher butanol production was probably due to the addition of cysteine in the last three repeated batches, which can control the oxidoreduction potential of the culture and impact cellular metabolism in xylose fermentation [Wang et al., 2012]. For butyric acid production, it also presented two categories: a slow decrease in butyrate production (from ~12 g/l to ~10 g/l) in the first five RBs because of the increase in BV dosage (from 1 μm to 10 μm), and a rapid decline in butyrate generation (from ~10 g/l to ~5 g/l) in the last four RBs because of the addition of cysteine in culture medium. Moreover, it is interesting to note that the production of acetate and ethanol was completely eliminated after RB3, indicating a 100% metabolic flux from acetyl-coa to butyryl-coa after certain cycles of adaptation and evolution. As shown in Figure 5.9B, higher butanol productivity and yield was obtained with increasing BV concentration (RBs 1-5); and a further improvement in butanol yield was achieved by adding cysteine in the culture medium (RBs 5-8). It was also noticed that a consistent butanol productivity ( g/l/h) and yield ( g/g) was observed when adding the same concentration of BV (10 μm) and cysteine (0.5 g/l) (RBs 6-8). Cysteine is an important amino acid that contains a thiol side chain, which is easily oxidized to form cystine, a disulfide derivative. Due to its antioxidant property via redox reactions, cysteine plays a critical role in fermentative production of various value-added chemicals, such as propionic acid and butanol [Chen et al., 2012; Wang et al., 2012]. It 193

223 has also been used to trigger an earlier initiation of solventogenesis and improve solvent productivity by controlling the ORP level of the culture medium of C. acetobutylicum [Wang et al., 2012]. Cysteine was not used in glucose fermentation because no significant difference was observed with and without the addition of cysteine when glucose was used as a substrate. In xylose fermentation, however, it is clear that cysteine was a crucial component for cell proliferation and cellular metabolism. Actually, a higher butanol titer and lower butyrate production with a remarkably increased butanol yield was achieved by supplementing 0.5 g/l cysteine in the repeated-batch fermentations using xylose as a substrate, compared to the results without cysteine addition, indicating the critical role of cysteine on metabolic flux redistribution (Figure 5.9). This might be caused by the fact that a preferable ORP range is required for microbial metabolism of a specific substrate since the syntheses and activities of certain enzymes are profoundly affected by ORP level [Wang et al., 2012]. Different metabolic pathways are used to generate pyruvate in glucose and xylose metabolism, in which different enzymes are involved [Pitkanen et al., 2003; Shinto et al., 2008]. Unfortunately, the essential impact of cysteine on cellular metabolism was not discovered until the sixth repeated batch (RB6) in the immobilizedcell fermentation in FBB using xylose as a substrate. As a result, there was no cysteine addition in the first five repeated batches (RBs 1-5). Nonetheless, the consistent high-titer (~17.0 g/l) and high-yield (>0.33 g/g) in the last three repeated batches (RBs 6-8) was sufficient to confirm the fundamental role of cysteine in xylose fermentation as well as a stable and reliable process for economically competitive butanol production from xylose. 194

224 Butanol production from glucose-xylose mixture Since glucose and xylose are the two major components of lignocellulosic biomass hydrolysates, it is necessary to investigate the fermentation kinetics using glucose and xylose mixture as a co-substrate, as shown in Figure 5.10A. In order to determine an optimal BV concentration for butanol production, a gradually increasing loading amount of BV was used in the first five repeated batches (from RB1 to RB5: 0, 5, 10, 20, and 25 μm BV, respectively) whereas the BV concentration in the last five repeated batches (RBs 5-9) was the same (25 μm). Also, different glucose/xylose ratios were considered in the co-fermentation to better simulate the carbon sources provided by lignocellulosic biomass hydrolysates. The glucose/xylose ratio (G/X, w/w) in the repeated-batch fermentation included: RBs 1-6, G/X=1; RB7, G/X=2; RB8, G/X=4; RB9, G/X=1/2. Figure 5.10B compares the butanol productivity and yield within each repeated batch using glucose-xylose mixture as a co-substrate. Apparently, BV loading amount has a significant effect on cellular metabolism and product profiles, as shown in Figure 5.10A. With increasing BV concentration from 0 in RB1 to 25 μm in RB5, a steadily improvement in butanol titer, from 10.0 g/l to 20.0 g/l, was observed whereas a stable butanol production (~20.0 g/l) was achieved in RBs 5-8 in the presence of 25 μm BV. The butanol titer, however, was reduced to ~17.0 g/l in RB9, probably because the G/X ratio was too low (1/2), although the same BV concentration (25 μm) was used. BV concentration presented a similar effect on butanol yield and productivity (Figure 5.10B). Basically, a higher butanol yield and productivity was obtained at a higher BV concentration whereas a similar butanol yield and productivity was observed at the same BV concentration with a G/X ratio 1. On the 195

225 other hand, a sharp decrease in the production of butyric acid was observed with increasing BV loading amount from 0 to 25 μm, which might be a major contribution to the improvement in butanol titer and yield, given that the metabolic flux towards butyryl- CoA, the precursor for both butanol and butyrate, was very stable. The generation of acetate and ethanol (very low titers), however, was not significantly affected by BV concentration. From Figure 5.10A, it is clear that the butanol-producing C. tyrobutyricum mutant was capable of consuming glucose and xylose simultaneously, especially after several cycles of adaptation and evolution in FBB, although the consumption rate of xylose was slower than that of glucose. During the development of biofuels from lignocellulosic materials, the ability to consume pentose, especially the synchronized utilization of hexose and pentose, such as glucose and xylose, becomes a fundamental objective in the discovery and improvement of a desired bacterial strain, since most lignocellulosic hydrolysates contain hexose and pentose as major components, both of which should be converted to target products to make the biofuels more economically competitive [Papoutsakis, 2008; Green, 2011]. Our adhe2-overexpressed C. tyrobutyricum mutant displayed this kind of capability (Figure 5.5), suggesting that it is a very promising strain for cost-effective production of biobutanol from lignocellulosic biomass. The consumption rate of xylose during the cofermentation of glucose and xylose was significantly affected by the cycling numbers of adaptation and evolution as well as glucose/xylose ratio. Much higher xylose consumption rate was observed in RBs 5-6 (~ 0.40 g/l/h), compared to RBs 1-2 (0.25 g/l/h), probably because the xylose uptake and metabolism enzymes were well-adapted after several repeated-batch fermentations in FBB. The consumption rate of xylose, 196

226 however, was dramatically reduced by increasing glucose/xylose ratio from 1:1 (~ 0.40 g/l/h in RBs 5-6) to 2:1 (0.20 g/l/h in RB 7) and even 4:1 (0.12 g/l/h in RB 8), indicating that the enzymes for xylose uptake and metabolism was partially inhibited at high G/X ratios, which is predictable because the cells preferred to consume glucose and were less likely to use xylose when the specific availability of glucose was high. The xylose consumption rate returned to 0.25 g/l/h in RB 9 in which the G/X ratio was reduced to 1/2; but low butanol titer, yield and productivity was obtained at low G/X ratio. By considering both butanol production and xylose utilization, 1:1 seems to be the optimal G/X ratio in glucose-xylose co-fermentation Scanning electron microscopy of immobilized cells in FBB In order to observe the cell morphology and better understand cell proliferation in the fibrous matrix, scanning electron microscopy was used to capture the immobilized cells on a single or multiple fibers, as shown in Figure The regularly rod-shaped cells with an average length of 3 μm looked very healthy and robust. However, instead of attaching and distributing on the fibers, the immobilized cells had a tendency to form cell clusters by connecting with each other very tightly, suggesting that the cell density inside the FBB was very high, which might contribute to the remarkably improved butanol tolerance and high butanol titers after adaptation and evolution. In addition, our cell viability test (data not shown) indicated that the immobilized cells were very active with a prolonged viability, another critical factor that can overcome poor solvent resistance and improve butanol titer. Moreover, cell contact and interaction frequently occurred within the immobilized cells since a lot of cell clusters were detected. Finally, it is clear that FBB is an advanced fermentation technology that can achieve high cell density, 197

227 enhance cell viability, and facilitate cell interaction, all of which have contributed significantly to the improved cell tolerance and butanol production Fed-batch fermentation with gas stripping for in situ butanol recovery In order to alleviate butanol-induced inhibition on cellular metabolism, gas stripping was used for in situ butanol recovery via recycling a gas mixture of CO 2 and H 2 generated during the fermentation process through the culture medium. The kinetics of the integrated fed-batch fermentation and gas stripping was shown in Figure 5.12A, and Figure 5.12B provided the product profiles based on glucose consumption. A continuous butanol production for over 300 hours with a final total butanol titer of ~ 60.0 g/l and a yield of ~ 0.35 g/g was achieved in this integrated process. Due to the addition of benzyl viologen in the culture medium, the production of acetate and ethanol was strongly inhibited with very low titers (<1.0 g/l). A gradually increasing accumulation of butyric acid, however, was observed during the fermentation process to a total titer of over 10.0 g/l. It was also noticed that a prolonged stationary phase with a stable optical cell density was obtained after gas stripping started because butanol titer in the fermentation broth was efficiently controlled below 10.0 g/l to minimize product inhibition on cell proliferation. From Figure 5.12B, it is clear that the slope for butanol production in terms of glucose consumption was almost a constant, indicating that this integrated process was very stable and reliable with butanol as the sole major product. Gas stripping, a simple but efficient separation technique, was successfully applied to realize synchronized butanol recovery and overcome product repression, resulting in a very high butanol titer (~60.0 g/l) and yield (0.35 g/g). In addition, no extra sterilized gases such as nitrogen gas is needed in this process because the gas mixture (CO 2 /H 2 ) 198

228 generated during the cellular metabolism was sufficient to remove the excessive butanol by recycling it through the fermentation broth, which can significantly reduce production cost. Moreover, butanol became the only leading end-product by using artificial electron carriers, which can effectively minimize the accumulation of by-products including ethanol, acetate and butyrate. Finally, it was confirmed that the integration of fed-batch fermentation and gas stripping is a stable and reliable process for cost-effective butanol production with high-titer and high-yield. 5.4 Conclusion High-titer (20.0 g/l) and high-yield (>0.30 g/g) butanol production from glucose and xylose was successfully achieved in C. tyrobutyricum mutant via the immobilized-cell fermentation in FBB by applying adaptive and evolutionary mutagenesis combined with NADH driving force. It was also confirmed that glucose and xylose can be consumed simultaneously during a co-fermentation using glucose and xylose as co-substrate. By integrating fed-batch fermentation and gas stripping for in situ butanol recovery, a continuous butanol production to a very high titer (60.0 g/l) and yield (0.35 g/g) with a stable and reliable process performance was successfully realized. This study has demonstrated a very promising process for economically competitive biobutanol production from lignocellulosic materials. 5.5 References Andrade JC, Vasconcelos I Continuous cultures of Clostridium acetobutylicum: culture stability and low-grade glycerol utilization. Biotechnol Letters 25:

229 Berrios-Rivera SJ, Bennett GN, San KY. 2002a. The effect of increasing NADH availability on the redistribution of metabolic fluxes in Escherichia coli chemostat cultures. Metab Eng 4: Bond-Watts BB, Bellerose RJ, Chang MCY Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways. Nat Chem Biol 7: Cascone R Biobutanol-A replacement for bioethanol? Chem Eng Prog 104:S4-S8. Chen F, Feng X, Liang J, Xu H, Ouyang P An oxidoreduction potential shift control strategy for high purity propionic acid production by Propionibacterium freudenreichii CCTCC M with glycerol as sole carbon source. Bioprocess Biosyst Eng DOI: /s Choi J, Jang YS, Cho JH, Seung D, Lee SY, Papoutsakis ET, Bennett GN, Song H Characterization and evaluation of corn steep liquid in acetone-butanol-ethanol production by Clostridium acetobutylicum. Biotechnol Bioprocess Eng 18: Durre P Biobutanol: An attractive biofuel. Biotechnol J 2: Ezeji T, Milne C, Price ND, Blaschek HP Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl Microbiol Biotechnol 85: Ezeji TC, Qureshi N, Blaschek HP Production of butanol by Clostridium beijerinckii BA101 and in-situ recovery by gas stripping. World J Microbiol Biotechnol 19: Ezeji TC, Qureshi N, Blaschek HP Acetone-butanol-ethanol (ABE) production from concentrated substrate: Reduction in substrate inhibition by fed-batch technique and product inhibition by gas stripping. Appl Microbiol Biotechnol 63: Fontaine L, Meynial-Salles I, Girbal L, Yang XH, Croux C, Soucaille P Molecular characterization and transcriptional analysis of adhe2, the gene encoding the NADHdependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol 184: Girbal L, Soucaille P Regulation of solvent production in Clostridium acetobutylicum. Trends Biotechnol 16:1-16. Girbal L, Vasconcelos I, Saint-Amans S, Soucaille P How neutral red modified carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph. FEMS Microbiol Rev 16: Green EM Fermentative production of butanol-the industrial perspective. Curr Opin Biotechnol 22:

230 Huang J, Cai J, Wang J, Zhu X, Huang L, Yang ST, Xu Z Efficient production of butyric acid from Jerusalem artichoke by immobilized Clostridium tyrobutyricum in a fibrous-bed bioreactor. Bioresour Technol 102: Huang YL, Wu Z, Zhang L, Cheung CM, Yang ST Production of carboxylic acids from hydrolyzed corn meal by immobilized cell fermentation in a fibrous-bed bioreactor. Bioresour Technol 82: Hull SR, Yang BY, Venzke D, Kulhavy K, Montgomery R Composition of corn steep water during steeping. J Agric Food Chem 44: Jang YS, Malaviya A, Cho C, Lee J, Lee SY Butanol production from renewable biomass by clostridia. Bioresour Technol 123: Jiang L, Wang JF, Liang SZ, Wang XN, Cen PL, Xu ZN Butyric acid fermentation in a fibrous bed bioreactor with immobilized Clostridium tyrobutyricum from cane molasses. Bioresour Technol 100: Jiang L, Wang JF, Liang SZ, Xu ZN, Cen PL, Yang ST, Li S Enhanced butyric acid tolerance and bioproduction by Clostridium tyrobutyricum immobilized in a fibrous bed bioreactor. Biotechnol Bioeng 108: Kim TS, Kim BH Electron flow shift in Clostridium acetobutylicum fermentation by electrochemically introduced reducing equivalent. Biotechnol Lett 10: Kumar M, Gayen K Developments in biobutanol production: New insights. Appl Energy 88: Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung SK Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: Liu S, Qureshi N How microbes tolerate ethanol and butanol. New Biotechnol 26: Liu X, Yang ST Kinetics of butyric acid fermentation of glucose and xylose by Clostridium tyrobutyricum wild type and mutant. Process Biochem 41: Liu X, Zhu Y, Yang ST Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Progr 22: Lu C, Zhao J, Yang ST, Wei D Fed-batch fermentation for n-butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour Technol 104: Lutke-Eversloh T, Bahl H Metabolic engineering of Clostridium acetobutylicum: recent advances to improve butanol production. Curr Opin Biotechnol 22:

231 Nicolaou SA, Gaida SM, Papoutsakis ET A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: From biofuels and chemicals, to biocatalysis and bioremediation. Metab Eng12: Oudshoorn A, van der Wielen LAM, Straathof AJJ Assessment of options for selective 1-butanol recovery from aqueous solution. Ind Eng Chem Res 48: Ouyang A, Ng R, Yang ST Long-term culturing of undifferentiated embryonic stem cells in conditioned media and three-dimensional fibrous matrices without extracellular matrix coating. Stem Cells 25: Papoutsakis ET, Tomas CA, Tesic M, Santiago JY, Increased cell resistance to toxic organic substances. US Patent Papoutsakis ET Engineering solventogenic clostridia. Curr Opin Biotechnol 19: Parekh M, Formanek J, Blaschek HP Pilot-scale production of butanol by Clostridium beijerinckii BA101 using a low-cost fermentation medium based on corn steep water. Appl Microbiol Biotechnol 51: Peguin S, Goma S, Delorme P, Soucaille P Metabolic flexibility of Clostridium acetobutylicum in response to methyl viologen. Appl Microbiol Biotechnol 42: Peguin S, Soucaille P Modulation of carbon and electron flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl Microbiol Biotechnol 61: Peguin S, Soucaille P Modulation of metabolism of Clostridium acetobutylicum grown in chemostat culture in a three-electrode potentiostatic system with methyl viologen as electron carrier. Biotechnol Bioeng 51: Pitkanen JP, Aristidou A, Salusjarvi L, Ruohonen L, Penttila M Metabolic flux analysis of xylose metabolism in recombinant Saccharomyces cerevisiae using continuous culture. Metab Eng 5: Qureshi N, Karcher P, Cotta M, Blaschek HP High productivity continuous biofilm reactor for butanol production. Appl Biochem Biotechnol : Rao G, Mutharasan R Alcohol production by Clostridium acetobutylicum induced by methyl viologen. Biotechnol Lett 8: Rao G, Mutharasan R Altered electron flow in continuous cultures of Clostridium acetobutylicum induced by viologen dyes. Appl Environ Microbiol 53:

232 Shen CR, Lan EI, Dekishima Y, Baez A, Cho KM, Liao JC Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl Environ Microbiol 77: Shim H, Shin E, Yang ST A continuous fibrous-bed bioreactor for BTEX biodegradation by a coculture of Pseudomonas putida and Pseudomonas fluorescens. Adv Environ Res7: Shinto H, Tashiro Y, Kobayashi G, Sekiguchi T, Hanai T, Kuriya Y, Okamoto M, Sonomoto K Kinetic study of substrate dependency for higher butanol production in acetone-butanol-ethanol fermentation. Process Biochem 43: Sillers R, Chowb A, Tracy B, Papoutsakis ET Metabolic engineering of the nonsporulating, non-solventogenic Clostridium acetobutylicum strain M5 to produce butanol without acetone demonstrate the robustness of the acid-formation pathways and the importance of the electron balance. Metab Eng 10: Suwannakham S, Yang ST Enhanced propionic acid fermentation by Propionibacterium acidipropionici mutant obtained by adaptation in a fibrous-bed bioreactor. Biotechnol Bioeng 91: Van der Zee FP, Cervantes FJ Impact and application of electron shuttles on the redox (bio)transformation of contaminants: A review. Biotechnol Advances 27: Vasconcelos I, Girbal L, Soucaille P Regulation of carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph on mixtures of glucose and glycerol. J Bacteriol 176: Wang S, Zhu Y, Zhang Y, Li Y Controlling the oxidoreduction potential of the culture of Clostridium acetobutylicum leads to an earlier initiation of solventogenesis, thus increasing solvent productivity. Appl Microbiol Biotechnol 93: Wang Z, Yang ST Propionic acid production in glycerol/glucose co-fermentation by Propionibacterium freudenreichii subsp. Shermanii. Bioresour Technol 137: Wei D, Liu X, Yang ST Butyric acid production from sugarcane bagasse hydrolysate by Clostridium tyrobutyricum immobilized in a fibrous-bed bioreactor. Bioresour Technol 129: Xue C, Zhao J, Lu C, Yang ST, Bai F, Tang IC High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping. Biotechnol Bioeng 109: Yang ST Extractive fermentation using convoluted fibrous bed bioreactor. United States Patent Application Publication. US Patent

233 Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol 93: Yu M, Zhang Y, Tang IC, Yang ST Metabolic engineeringof Clostridium tyrobutyricum for n-butanol production. Metab Eng 13: Zhang Y Metabolic engineering of Clostridium tyrobutyricum for production of biofuels and bio-based chemicals. Ph.D. thesis. The Ohio State University. Zheng YN, Li LZ, Xian M, Ma YJ, Yang JM, Xu X, He DZ Problems with the microbial production of butanol. J Ind Microbiol Biotechnol 36: Zhu Y, Yang ST Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Prog 19:

234 MV concentration (μm) μ (1/h) 0.189± ± ± ± ±0.017 Butanol Titer (g/l) 9.18± ± ± ± ±0.08 Yield (g/g) 0.212± ± ± ± ±0.008 Butyric acid Titer (g/l) 2.31± ± ± ± ±0.63 Yield (g/g) 0.050± ± ± ± ±0.017 Ethanol Titer (g/l) 2.26± ± ± ± ±0.05 Yield (g/g) 0.052± ± ± ± ±0.001 Acetic acid Titer (g/l) 5.21± ± ± ± ±0.45 Yield (g/g) 0.121± ± ± ± ±0.013 Solvents/Acids ratio (mol/mol) 1.53± ± ± ± ±2.69 Table 5.1 Effect of methyl viologen concentration on fermentation kinetics of CtΔackadhE2 mutant in CSL medium with glucose as a substrate. 205

235 BV concentration (μm) μ (1/h) 0.172± ± ± ±0.000 Lag phase (day) Butanol Titer (g/l) 12.29± ± ± ±0.04 Yield (g/g) 0.234± ± ± ±0.012 Butyric acid Titer (g/l) 2.60± ± ± ±0.33 Yield (g/g) 0.049± ± ± ±0.006 Ethanol Titer (g/l) 4.78± ± ± ±0.04 Yield (g/g) 0.091± ± ± ±0.001 Acetic acid Titer (g/l) 3.32± ± ± ±0.10 Yield (g/g) 0.063± ± ± ±0.003 Solvents/Acids ratio (mol/mol) 3.20± ± ± ±0.24 Table 5.2 Effect of benzyl viologen concentration on fermentation kinetics of CtΔackadhE2 mutant in CSL medium with glucose as a substrate. 206

236 Substrates Glucose Xylose MV or BV concentration ( μm) MV0 MV500 BV25 BV0 BV10 μ (h -1 ) Butanol Titer (g/l) Yield (g/g) Butyric acid Titer (g/l) Yield (g/g) Ethanol Titer (g/l) Yield (g/g) Acetic acid Titer (g/l) Yield (g/g) ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±0.000 Solvents/Acids ratio (mol/mol) Table 5.3 Comparison of specific growth rate, solvents/acids ratio, as well as metabolites accumulation using glucose or xylose as a substrate in CSL medium with or without artificial electron carriers. 207

237 Figure 5.1 Experimental setup for repeated-batch fermentation in a fibrous-bed bioreactor for butanol production from glucose, xylose, and glucose-xylose mixture by C. tyrobutyricum-adhe2 mutant, adapted from Zhang [Zhang, 2009]. 208

238 Glucose (g/l) Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) A MV0 MV100 MV250 MV500 MV1000 B MV0 MV100 MV250 MV500 MV OD Time (h) Time (h) C MV0 MV100 MV250 MV500 MV1000 D MV0 MV100 MV250 MV500 MV Time (h) Time (h) E MV0 MV100 MV250 MV500 MV1000 F MV0 MV100 MV250 MV500 MV Time (h) Time (h) Figure 5.2 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown on CSL medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 209

239 Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) Glucose (g/l) A BV0 BV10 BV25 BV50 B BV0 BV10 BV25 BV OD Time (h) Time (h) C BV0 BV10 BV25 BV50 D 5 BV0 BV10 BV25 BV Time (h) Time (h) E BV0 BV10 BV25 BV50 F 4 BV0 BV10 BV25 BV Time (h) Time (h) Figure 5.3 Effects of benzyl viologen (BV) on fermentation kinetics of CtΔack-adhE2 mutant grown on CSL medium in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 210

240 Specific growth rate (1/h) Solvents/Acids ratio (mol/mol) Butanol titer (g/l) A CGM CSL B Butanol yield (g/g glucose)0.35 CGM CSL 0 MV0 MV100 MV500 MV MV0 MV100 MV500 MV1000 C MV concentration (um) CGM CSL D CGM CSL MV concentration (um) MV0 MV100 MV500 MV MV0 MV100 MV500 MV1000 MV concentration (um) MV concentration (um) Figure 5.4 Comparison of butanol titer, butanol yield, specific growth rate, and solvents/acids ratio by CtΔack-adhE2 mutant in response to methyl viologen grown on glucose in CGM and CSL medium (A, butanol titer; B, butanol yield; C, specific growth rate; D, solvents/acids ratio). 211

241 Specific growth rate (1/h) Solvents/Acids ratio (mol/mol) Butanol titer (g/l) Butanol yield (g/g glucose) A CGM CSL B CGM CSL BV0 BV10 BV25 BV BV0 BV10 BV25 BV50 C BV concentration (um) CGM CSL D CGM CSL BV concentration (um) BV0 BV10 BV25 BV50 BV concentration (um) 0 BV0 BV10 BV25 BV50 BV concentration (um) Figure 5.5 Comparison of butanol titer, butanol yield, specific growth rate, and solvents/acids ratio by CtΔack-adhE2 mutant in response to benzyl viologen grown on glucose in CGM and CSL medium (A, butanol titer; B, butanol yield; C, specific growth rate; D, solvents/acids ratio). 212

242 OD, Glucose (g/l) Products (g/l) OD, Glucose (g/l) Products (g/l) OD, Glucose (g/l) Products (g/l) A Ethanol Butanol Acetate Butyrate OD Glucose Time (h) B Ethanol Butanol Acetate Butyrate OD Glucose Time (h) C Ethanol Butanol Acetate Butyrate OD Glucose Time (h) Figure 5.6 Fermentation kinetics for free-cell fermentation of CtΔack-adhE2 mutant grown in CSL medium using glucose as a substrate in the presence of artificial electron carriers (A, no MV or BV; B, 500 M MV; C, 25 M BV). 213

243 OD, Xylose (g/l) Products (g/l) OD, Xylose (g/l) Products (g/l) A Ethanol Butanol Acetate Butyrate OD Xylose Time (h) B Ethanol Butanol Acetate Butyrate OD Xylose Time (h) 0 Figure 5.7 Fermentation kinetics for free-cell fermentation of CtΔack-adhE2 mutant grown in CSL medium using xylose as a substrate in the presence of artificial electron carriers (A, no MV or BV; B, 10 M BV). 214

244 Butanol yield (g/g), productivity (g/l/h) Glucose (g/l) OD, Products (g/l) A Glucose OD Ethanol Butanol Acetate Butyrate B Time (h) 0.4 Productivity Yield Repeated Batches Figure 5.8 Fermentation kinetics for immobilized-cell fermentation with a repeated-batch model in FBB of CtΔack-adhE2 mutant grown in CSL medium using glucose as a substrate in the presence of artificial electron carriers (RBs 1-9, 500 M MV; RBs 10-13, 25 M BV) (A, fermentation kinetics; B, comparison of butanol productivity and yield within each repeated batch). 215

245 Butanol yield (g/g), productivity (g/l/h) Xylose (g/l) OD, Products (g/l) A Xylose OD Ethanol Butanol Acetate Butyrate B Time (h) 0.4 Productivity Yield Repeated Batches Figure 5.9 Fermentation kinetics for immobilized-cell fermentation with a repeated-batch model in FBB of CtΔack-adhE2 mutant grown in CSL medium using xylose as a substrate in the presence of artificial electron carriers with or without cysteine (BV concentration: 1 μm BV in RB1, 2 μm BV in RB2, 4 μm BV in RB3, 5 μm BV in RB4, and 10 μm BV in RB5-8; RBs 1-5, no cysteine; RBs 6-8, 0.5 g/l cysteine) (A, fermentation kinetics; B, comparison of butanol productivity and yield within each repeated batch). 216

246 Butanol yield (g/g), productivity (g/l/h) Glucose, Xylose (g/l) OD, Products (g/l) A Glucose Xylose OD Ethanol Butanol Acetate Butyrate B Time (h) 0.35 Productivity Yield Repeated Batches Figure 5.10 Fermentation kinetics for immobilized-cell fermentation with a repeatedbatch model in FBB of CtΔack-adhE2 mutant grown in CSL medium using glucosexylose mixture as a co-substrate in the presence of artificial electron carriers with different G/X ratios (BV concentration: from RB1 to RB4, 0, 5, 10, and 20 μm BV, respectively, RBs 5-9, 25 M BV; G/X ratio: RBs 1-6, G/X=1; RB7, G/X=2; RB8, G/X=4; RB9, G/X=1/2) (A, fermentation kinetics; B, comparison of butanol productivity and yield within each repeated batch). 217

247 A B C Figure 5.11 Scanning electron microscopy of immobilized cells in FBB with different magnifications (A, 10 m; B, 20 m; C, 50 m). 218

248 Products (g) Glucose (g) OD, Products (g) A Glucose Butanol in broth Total butanol OD Ethanol Acetate Butyrate Time (h) 0 B Butanol in broth Total butanol Ethanol Acetate Butyrate Glucose consumption (g) Figure 5.12 Fermentation performance of CtΔack-adhE2 mutant grown in CSL medium using glucose as a substrate supplemented with 500 M methyl viologen at ph 6.0 in an integrated fed-batch fermentation and gas stripping process (A, fermentation kinetics; B, product profiles based on glucose consumption). 219

249 Chapter 6: High-titer and high-yield butanol production from lignocellulosic feedstocks by engineered Clostridium tyrobutyricum Abstract Butanol production via acetone-butanol-ethanol (ABE) fermentation by solventogenic clostridia usually suffers from low butanol titer, low butanol yield, and high substrate cost. In order to overcome these issues, various cellulosic and lignocellulosic materials including cassava bagasse, Jerusalem artichoke, cotton stalk, sugarcane bagasse, soybean hull, and corn fiber were considered as alternative feedstocks for enhanced butanol production by metabolically engineered C. tyrobutyricum in both free-cell and immobilized-cell fermentations with a focus on improving substrate utilization efficiency and evaluating the long-term performance of the process. By combining NADH driving forces and FBB fermentation strategy, high-titer (> 15.0 g/l) and high-yield (> 0.30 g/g) butanol production from various abundant, renewable, and inexpensive raw materials was successfully achieved in this study with high substrate utilization efficiency and a stable and reliable long-term performance. In addition, synchronized consumption of glucose and xylose was observed in the immobilized-cell fermentation, an essential characteristic for development of liquid fuels from lignocellulosic materials. Moreover, by using corn steep liquor as a complex nitrogen source, various inhibitory compounds presented in the hydrolysates were efficiently removed or controlled at an extremely low level to eliminate the toxic impacts of these chemicals on cell growth, metabolism, and 220

250 fermentation performance. This is the first report on high-titer, high-yield, and costeffective butanol production from biomass hydrolysates in a heterologous butanol production platform. 6.1 Introduction Due to growing concerns over global warming issues, rapid depletion of crude oils, a hike in gasoline prices, as well as increasing demand on domestic energy security, the development of liquid fuels to replace petroleum-based transportation fuels from abundant, renewable, sustainable, and inexpensive feedstocks has become more and more important and attractive [Durre, 2007]. Butanol, a four carbon alcohol with a distinct odor, is currently used as an important industrial chemical or solvent with a variety of applications, including latex surface coating, enamels, lacquers, as well as production of antibiotics, vitamins and hormones [Lee et al., 2008]. Recently, butanol has been considered as an alternative transportation fuel to replace gasoline because its properties are very similar to gasoline, such as energy density, vaporization heat, air-fuel ratio, research octane number, and motor octane number [Cascone, 2008]. Before petrochemical process, butanol is mainly produced via acetone-butanol-ethanol (ABE) fermentation by solventogenic clostridia such as Clostridium acetobutylicum and Clostridium beijerinckii, which usually suffers from low butanol titer and yield due to the generation of acetone and low solvent resistance [Ezeji et al., 2010]. Previously, hightiter and high-yield butanol production from glucose and xylose in an adhe2- overexpressed C. tyrobutyricum mutant was successfully achieved, which is apparently a superior host for fermentative butanol production over traditional solventogenic clostridia [Yu et al., 2011, Yu et al., 2012]. 221

251 However, high substrate cost and the availability of raw materials is another big challenge in the development of biobutanol [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. It has been estimated that the cost of raw materials accounts for more than 50% of the total production cost in ABE fermentation, which has made the biochemical route not economically competitive to petrochemical process [Dürre, 2007; Garćia et al., 2011; Lu, 2012]. First generation biofuels derived from food crops including sugarcane and cereal grains have a potential to compete with food supply, cause food shortages, and increase food prices [Kumar and Gayen, 2011]. In addition, limited cropland is another issue that may obstruct the development of biofuels from food crops [Searchinger et al., 2008]. Recently, lignocellulosic biomass, such as agricultural residues, woody biomass, and industrial wastes, has been considered as the most promising alternative feedstocks for fermentative butanol production because they are the most abundant and low-cost raw materials on the earth [Buschke et al., 2011]. More importantly, it has been demonstrated that Clostridium spp. are able to efficiently consume a variety of carbohydrates including simple and complex sugars such as pentose and hexose, an essential characteristic for economical production of biobutanol from lignocellulosic materials [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. In fact, cost-effective butanol production from various agricultural residues and industrial wastes with low-cost and wide availability has been extensively studied [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. Corn-derived agricultural residues and industrial wastes including corn stover, corn fiber, corncob, degermed corn, and liquefied corn starch have been considered as reliable substrates for economical biobutanol production [Qureshi et al., 2008a; Qureshi et al., 2010a; Ni et al., 2012; Guo et al., 2013; 222

252 Du et al., 2013; Zhang et al., 2013]. In addition, various straw-based raw materials including barley straw, wheat straw, rice straw, rice bran, and switchgrass have also been utilized as alternative feedstocks for ABE production [Qureshi et al., 2007; Qureshi et al., 2008a; Qureshi et al., 2008b; Qureshi et al., 2008c; Qureshi et al., 2010b; Al-Shorgani et al., 2012]. Moreover, industrial and municipal wastes including domestic organic waste (DOW), dried distiller s grains and soluble (DDGS), cheese whey, cane molasses, wood pulp, packing peanuts, and oil palm decanter cake are another group of promising alternative substrates for economical production of biofuels [Claassen et al., 2000; Lopez-contreras et al., 2000; Ezeji and Blaschek, 2008; Wang et al., 2013; Jesse et al., 2002; Raganati et al., 2013; Razak et al., 2013; Survase et al., 2013; Li et al., 2013; Ni et al., 2012]. Recently, other starch-based cellulosic materials or lignocellulosic biomass including cassava bagasse, sago pith residues, and green seaweed Ulva lactuca have also been considered as alternative feedstocks for ABE production [Lu et al., 2012; Linggang et al., 2013; van der Wal et al., 2013]. However, in order to get access to the cellulosic structures and release fermentable sugars, physical, chemical, or biological pretreatment and enzymatic hydrolysis are usually required for efficient utilization of lignocellulosic materials as fermentation substrates [Ezeji et al., 2010; Jang et al., 2012]. Pretreatment process does not only significantly contribute to the high cost in biorefinery industry, but also generate numerous inhibitory compounds such as furfural, furan, acetic, ferulic, glucuronic, p-coumaric acids, phenolic compounds, and aldehydes, which can severely affect cell growth and metabolism, substrate utilization efficiency, as well as fermentation performance [Ezeji et al., 2007; Jang et al., 2012]. Therefore, development of advanced pretreatment and hydrolysis 223

253 processes that can limit the generation of inhibitory compounds as well as development of superior strains that can tolerate lignocellulosic materials derived inhibitors has become the primary concerns for economically competitive production of butanol from lignocellulosic feedstocks [Jang et al., 2012]. In this study, the effects of methyl viologen concentration on fermentation kinetics of CtΔack-adhE2 mutant using various cellulosic and lignocellulosic biomass hydrolysates including cassava bagasse, Jerusalem artichoke, cotton stalk, sugarcane bagasse, soybean hull, and corn fiber as substrates were first investigated and compared in serum bottles. Then, immobilized-cell fermentation in a fibrous-bed bioreactor (FBB) with a repeatedbatch mode was performed to achieve high-titer and high-yield butanol production from these abundant and low-cost alternative feedstocks with a focus on improving substrate utilization efficiency as well as evaluating the long-term performance of the FBB process. Moreover, the effects of various lignocelluloses-derived inhibitory compounds on cell growth, metabolism, and fermentation profiles were also examined. This study has demonstrated a promising strategy for high-titer, high-yield, and cost-effective butanol production from inexpensive, plentiful, and renewable raw materials with a stable and reliable long-term fermentation performance. 6.2 Materials and methods Pretreatment and enzymatic hydrolysis of cellulosic materials Pretreatment and enzymatic hydrolysis of cassava bagasse has been described in detail previously [Lu et al., 2012]. Briefly, dried cassava bagasse (brown powder) was first mixed with distilled water at a solid loading amount of 10% (w/v, 50 g dried cassava 224

254 bagasse powder plus 450 ml distilled water) and well-stirred in a 1000 ml flask, followed by autoclaving at 121 o C and 15 psi for 30 min to break down the fibrous structure of the biomass and release cellulose. After cooling to room temperature, the ph of the cassava bagasse meal was adjusted to by 10 N NaOH if necessary. Then, commercial glucoamylase (Distillase L-400, activity: 350 GAU/g, Genencor, NY) and cellulase (Accellerase 1500, endoglucanase activity: CMC U/g, β-glucosidase activity: pnpg U/g, Genencor, NY) was added into the mixture at a loading amount of 0.05 ml and 0.1 ml/g dry cassava bagasse, respectively, to hydrolyze the cellulose into glucose. The enzymatic hydrolysis process was operated at 50 o C, ph , and 150 rpm for 72 h. Then, the resulted enzymatic hydrolysate was centrifuged at 8,000 rpm for 10 min to remove the solid waste and obtain cassava bagasse hydrolysate (CBH), which contained 40 g/l glucose and trace amounts of xylose, arabinose, acetic acid and lactic acid. Finally, before use, the CBH was concentrated to a desirable concentration (60 g/l glucose) by rotary evaporation under vacuum at 60 o C. Pretreatment of Jerusalem artichoke was according to a previous report [Huang et al., 2011]. Dried Jerusalem artichoke (yellow powder) was well-mixed with 0.01 M H 2 SO 4 at a solid loading amount of 10% (50 g dry Jerusalem artichoke powder plus 450 ml 0.01 M H 2 SO 4 ) in a 1000 ml flask, followed by autoclaving at 121 o C and 15 psi for 30 min. Then centrifugation at 8,000 rpm for 10 min was applied to remove insoluble solid waste and obtain Jerusalem artichoke hydrolysate (JAH), which contained 50 g/l fructose and 10 g/l glucose. Before use, the ph of the JAH was adjusted to 6.0 by 10 N NaOH. 225

255 6.2.2 Pretreatment and enzymatic hydrolysis of lignocellulosic materials Pretreatment and enzymatic hydrolysis process of lignocellulosic materials including cotton stalk, sugarcane bagasse, soybean hull, and corn fiber was similar to that of cassava bagasse. Basically, dried cotton stalk (brown powder), sugarcane bagasse (brown powder), soybean hull (yellow pellet), and corn fiber (yellow pellet) was well-mixed with 0.04N HCl or 0.02 N H 2 SO 4 at a solid loading amount of 10% (w/v, 50 g dried lignocellulosic materials plus 450 ml 0.04N HCl or 0.02 N H 2 SO 4 ) in a 1000 ml flask, respectively, followed by autoclaving at 121 o C and 15 psi for 30 min to break down the fibrous structure of the biomass and release cellulose. After cooling to room temperature, the ph of various lignocellulosic biomass meals was adjusted to by 10 N NaOH, followed by addition of cellulase (Accellerase 1500, endoglucanase activity: CMC U/g, β-glucosidase activity: pnpg U/g, Genencor, NY) into the mixture at a loading amount of 0.10 ml/g dry lignocellulosic biomass, respectively, to hydrolyze the cellulose into glucose. The enzymatic hydrolysis process was operated at 50 o C, ph , and 150 rpm for 72 h. Then, the resulted enzymatic hydrolysates were centrifuged at 8,000 rpm for 10 min to remove the insoluble solid waste and obtain various lignocellulosic biomass hydrolysates including cotton stalk hydrolysate (CSH), sugarcane bagasse hydrolysate (SBH), soybean hull hydrolysate (SHH), and corn fiber hydrolysate (CFH). The compositions and corresponding concentrations in lignocellulosic biomass hydrolysates were substrate specific with glucose and xylose concentrations ranging from g/l and 5-15 g/l, respectively. Finally, before use, the CSH, SBH, SHH, and CFH was concentrated to a desirable concentration (60 g/l total sugar) by rotary evaporation under vacuum at 60 o C. 226

256 6.2.3 Bacterial strain and culture conditions C. tyrobutyricum mutant strain CtΔack-adhE2 with an overexpression of adhe2 gene and a partially knockout of ack gene was used in this study [Liu et al., 2006; Yu et al., 2011]. The stock culture of CtΔack-adhE2 was maintained anaerobically at -85 o C in Reinforced Clostridial Medium (RCM; Difco, Detroit, MI) supplemented with 30 μg/ml thiamphenicol. Unless otherwise noted, all fermentation studies were carried out at 37 o C in corn steep liquor (CSL) medium containing cellulosic or lignocellulosic biomass hydrolysates (CBH, JAH, CSH, SBH, SHH, and CFH, respectively, containing 60 g/l sugar (glucose and xylose mixture or glucose and fructose mixture)), 30 g/l corn steep liquor (Dow AgroSciences, Indianapolis, IN), 3 g/l (NH 4 ) 2 SO 4, 1.5 g/l K 2 HPO 4, 0.6 g/l MgSO 4.7H 2 O, 0.03 g/l FeSO 4.7H 2 O, 0.5 g/l cysteine, certain amount of methyl viologen (MV) or benzyl viologen (BV), and 30 μg/ml thiamphenicol Effects of methyl viologen The effects of methyl viologen (MV) as an artificial electron carrier on fermentation kinetics of CtΔack-adhE2 mutant using various cellulosic or lignocellulosic biomass hydrolysates (CBH, JAH, CSH, SBH, SHH, and CFH, respectively) as substrates were studied in serum bottles. The methyl viologen (Sigma-aldrich) stock solution (100 ) was sterilized by filtration and added into the medium to a final concentration (μm) of 0 (MV0), 100 (MV100), 250 (MV250), 500 (MV500), and 1000 (MV1000). Each bottle, containing 50 ml of the medium, was inoculated with 2.5 ml active cells of CtΔackadhE2 from an overnight culture in RCM at 37 o C anaerobically. After inoculation, these serum bottles were incubated at 37 o C with ph adjusted to 6.5 once a day by adding 10% (w/v) NaOH solution. Samples were taken periodically to monitor cell growth, glucose 227

257 consumption, and metabolites (ethanol, butanol, acetic acid, butyric acid, and lactate) production during the fermentation. Duplicate bottles were used for each substrate at each MV level Immobilized-cell fermentation in FBB Immobilized-cell fermentation in FBB was performed in a bench-scale stirred-tank reactor containing 1.5 liters of CSL medium connected with a fibrous-bed bioreactor (a glass column vessel packed with a spiral wound fibrous matrix, Yang, 1996) with a working volume of 400 ml to realize adaptation and evolution. The reactor setup and operation of the FBB system has been described in detail previously [Jiang et al., 2010] and also in the previous chapter (Chapter 5). The adaptation and evolution in FBB was operated in a repeated-batch model using various cellulosic or lignocellulosic biomass hydrolysates (CBH, JAH, CSH, SBH, SHH, and CFH, respectively) as substrates to evaluate the substrate utilization efficiency and long-term performance of the process. The immobilized-cell fermentation in FBB was conducted at 37 o C with ph controlled at 6.0 by saturated NH 4 OH solution. Cell growth, sugar consumption, and metabolites (ethanol, butanol, acetic acid, and butyric acid) accumulation was monitored by taking and analyzing samples periodically Analytical methods Cell density was measured as the optical density at 600 nm using a spectrophotometer (UV-16-1, Shimadzu, Columbia, MD). Volatile metabolites, including ethanol, acetic acid, butanol, and butyric acid, were analyzed with a gas chromatograph (GC-2014, Shimadzu, Columbia, MD). Glucose fructose, and xylose concentration was determined 228

258 by high performance liquid chromatography (HPLC, LC-20AD, Shimadzu, Columbia, MD). Detailed descriptions of GC and HPLC analyses can be found elsewhere [Yu et al., 2011]. The compositions and concentrations of various inhibitory compounds (FF, furfural; HMF, hydroxymethylfurfural; FMA, formic acid; FLA, ferulic acid; LA, levulinic acid; and p-ca, p-coumaric acid) presented in the cellulosic or lignocellulosic biomass hydrolysates were analyzed by HPLC equipped with a UV detector and a Rezex ROA-Organic Acid H + column (300 mm 7.80 mm, Phenomenex, Torrance, CA). For sample analysis, N H 2 SO 4 was used as the mobile phase with a flow rate of 0.60 ml/min and an injection volume of 15 μl at 280 nm. 6.3 Results Effects of methyl viologen with cellulosic biomass hydrolysates as substrates Effects of methyl viologen on fermentation kinetics using cassava bagasse hydrolysate (CBH) as a substrate The effects of methyl viologen concentration on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with CBH as a substrate were investigated in serum bottles. Five levels of MV concentrations were considered including (μm) 0 (MV0), 100 (MV100), 250 (MV250), 500 (MV500), and 1000 (MV1000). The results are given in Figure 6.1 and Table 6.1. It is clear that MV can improve butanol production with CBH as a substrate, resulting in a significant increase in butanol titer, from 8.0 g/l to > 12.0 g/l, and butanol yield, from 0.22 g/g to 0.34 g/g, with MV concentration increasing from 0 μm to 1000 μm. The production of ethanol and acetate, however, was dramatically reduced from 3.50 g/l to < 229

259 1.50 g/l for ethanol and from 6.0 g/l to < 1.50 g/l for acetic acid at MV concentrations higher than 250 μm. Actually, there was no net accumulation of acetate with MV100 and even a gradual decrease in acetic acid concentration was observed during the fermentation course, from 2.50 g/l initially to 1.50 g/l finally, in the presence of MV higher than 250 μm, indicating that acetate can be used as a carbon source for cell growth and metabolism. In addition, it seems that biosynthesis of acetate is not required for cell survival, although acetate formation pathway is an important source for ATP generation. Because of the improved butanol production and reduced acetate accumulation, a remarkable increase in solvents/acids ratio, from 1.50 mol/mol to 4.0 mol/mol, was obtained. Similar to the previous results, MV demonstrated an inhibitory impact on cell growth, resulting in a lower specific growth rate, from 0.17 /h to 0.10 /h, and a decline in optical cell density, from OD 20 to OD 13. It is interesting to note that butyrate titers at each MV concentration (ranging from 2.50 g/l to 3.40 g/l) were higher than the control (2.10 g/l), suggesting that MV can induce a redistribution of carbon flux from acetyl- CoA to butyryl-coa and thus increase butanol and butyrate production at the expense of ethanol and acetate Effects of methyl viologen on fermentation kinetics using Jerusalem artichoke hydrolysate (JAH) as a substrate The results for MV effects on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with JAH as a substrate in serum bottles were provided in Figure 6.2 and Table 6.2. Different from MV effects in CBH fermentation, no significant improvement in butanol production was observed in JAH fermentation, in which similar butanol titers ( g/l) were obtained at each MV level, although a remarkable increase in 230

260 butanol yield was achieved from 0.22 g/g at MV0 to >0.30 g/g at MV >250. Another difference is that in terms of butyric acid production, a reduction in butyrate titer was observed at MV >250 while it was slightly increased at MV100 in JAH fermentation. Moreover, the cell growth in JAH fermentation was not severely affected by MV. In fact, the specific growth rate at each MV concentration was very similar (0.15 /h), although the final optical cell density was decreased significantly from OD >17.0 at MV0 to OD <11.0 at MV 1000, which might be caused by the combinational inhibitory impacts of butanol and MV on cell proliferation. Similar to MV effects in CBH fermentation, a dramatic decline in ethanol and acetate production (from 4.0 g/l to <1.0 g/l for ethanol and from 5.0 g/l to <1.0 g/l for acetate) was observed in JAH fermentation in the presence of MV, which might contribute to the remarkable improvement in butanol yield (from 0.22 g/g to >0.30 g/g) and solvents/acids ratio (from 2.0 mol/mol to 4.6 mol/mol) Fermentation kinetics of CtΔack-adhE2 mutant with CBH or JAH as a substrate in the presence of 500 μm MV In order to better understand the effects of MV on product profiles and get an overview of the fermentation courses, fermentation kinetics of CtΔack-adhE2 mutant using either CBH or JAH as a substrate in the presence of 500 μm MV was provided in Figure 6.3 (A, CBH fermentation kinetics; B, JAH fermentation kinetics). Apparently, a similar fermentation performance in CBH and JAH fermentation with MV500 was observed. Butanol was the only leading end-product with final titers over 10.0 g/l whereas the production of by-products including ethanol, acetate, and butyrate was strongly inhibited by MV with final butyrate titers less than 3.0 g/l and final ethanol and acetate titers less than 1.0 g/l. In addition, for both CBH and JAH fermentation, a rapid consumption of 231

261 sugar (glucose or glucose and fructose mixture) along with a fast growth in cell optical density and a sharp increase in butanol concentration in the initial h was observed, followed by an immediate cease in sugar utilization, cell growth, and butanol accumulation at a certain point (butanol titers over 10.0 g/l), which might be caused by the fact that butanol concentration in the fermentation broth reached to an inhibitory level. Redox imbalance induced by redirected carbon flux and diverted electron flow might be another critical reason that leads to the cease in cell growth and metabolism. Moreover, slow generations of ethanol and butyrate during exponential phase while no net accumulation or even a decline in acetate concentration were spotted in both CBH and JAH fermentation. However, there were a couple of differences presented in CBH and JAH fermentations. The first difference is that glucose was almost depleted at the end of CBH fermentation whereas still ~ 40.0 g/l sugar remained unfermented during JAH fermentation due to the fact that higher initial sugar concentration (> 70.0 g/l vs. < 40.0 g/l) was used in JAH fermentation. Another difference is that higher butanol productivity was obtained in JAH fermentation than that in CBH fermentation (> 0.20 g/l/h vs g/l/h) Effects of methyl viologen with lignocellulosic biomass hydrolysates as substrates Effects of methyl viologen on fermentation kinetics using cotton stalk hydrolysate (CSH) as a substrate The effects for MV concentration on fermentation kinetics of CtΔack-adhE2 mutant with CSH as a substrate in serum bottles are shown in Figure 6.4 and Table 6.3. Surprisingly, with increasing MV concentration, a gradual decline in butanol titer (from g/l at 232

262 MV0 to 8.0 g/l at MV1000) was observed in CSH fermentation, which was completely different from our previous results of CBH and JAH fermentation in which butanol production was significantly improved by MV. In addition, the butanol yield in CSH fermentation was at the same level (~0.30 g/g) for each MV concentration, another important difference with CBH and JAH fermentation in which usually a higher butanol yield can be obtained at a higher MV concentration. Moreover, the solvents/acids ratio in CSH fermentation was also not significantly affected by MV since similar solvents/acids ratio (~3.0 mol/mol) was spotted at each MV level. During CBH and JAH fermentation, however, a remarkable improvement in solvents/acids ratio was usually achieved in the presence of MV. Similar to CBH and JAH fermentation, the production of ethanol and acetic acid was dramatically reduced, from 4.0 g/l to < 0.50 g/l for ethanol and from 3.60 g/l to < 0.50 g/l for acetate, whereas a slight increase in butyrate generation (from 2.50 g/l to 3.0 g/l) was observed in CSH fermentation with MV. In addition, a sharp decrease in final cell optical density, from OD 19.0 at MV0 to OD at MV1000, was spotted in CSH fermentation, which was also consistent with CBH and JAH fermentation, although the specific growth rate in CSH fermentation was not significantly affected by MV with only a slight decline from /h at MV0 to /h at MV1000. Moreover, in the presence of MV higher than 250 μm, acetate titer during the CSH fermentation course was gradually reduced from 1.50 g/l initially to 0.50 g/l finally, which further confirmed that acetic acid can be utilized as a carbon source for cell growth and metabolism. 233

263 Effects of methyl viologen on fermentation kinetics using sugarcane bagasse hydrolysate (SBH) as a substrate The effects for MV concentration on fermentation kinetics of CtΔack-adhE2 mutant with SBH as a substrate in serum bottles are illustrated in Figure 6.5 and Table 6.4. It is clear that MV effects in SBH fermentation were very similar to that in CSH fermentation. Basically, butanol titer was gradually declined from 12.0 g/l to 8.0 g/l with a slight improvement in butanol yield from 0.27 g/g to 0.31 g/g during SBH fermentation with increasing MV concentration from 0 to 1000 μm. The generation of ethanol and acetate, however, was significantly reduced from 3.50 g/l and 5.0 g/l at MV0 to 0 and 1.0 g/l at MV 1000 for ethanol and acetate, respectively. Moreover, MV presented a stimulatory impact on butyric acid production, which was boosted from 3.0 g/l at MV0 to 5.0 g/l at MV concentration higher than 100 μm. Furthermore, final cell density was severely affected by MV, which declined dramatically from OD 19.0 at MV0 to OD 11.0 at MV1000 with a slight decrease in specific growth rate from 0.15 /h at MV0 to 0.13 /h at MV1000. In terms of solvents/acids ratio, it was similar at each MV level (~1.50 mol/mol) in SBH fermentation, which was lower than that in CSH fermentation (~3.0 mol/mol), probably because higher acetic and butyric acids production was obtained in SBH fermentation. Finally, acetate accumulation was gradually reduced from 3.50 g/l initially to 1.0 g/l finally during the SBH fermentation course in the presence of MV >250 μm Effects of methyl viologen on fermentation kinetics using soybean hull hydrolysate (SHH) as a substrate The effects for MV concentration on fermentation kinetics of CtΔack-adhE2 mutant with SHH as a substrate in serum bottles are shown in Figure 6.6 and Table 6.5. Again, MV 234

264 effects in SHH fermentation was very similar to that in CSH and SBH fermentation. Briefly, a significant decline in butanol production (from g/l to 9.0 g/l), ethanol generation (from 4.75 g/l to 0.50 g/l), acetate accumulation (from 2.70 g/l to 0.50 g/l), as well as final cell density (from OD 19.0 to OD 12.0) was observed during SHH fermentation with increasing the MV concentration from 0 to 1000 μm. On the other hand, a slight improvement in butanol yield (from 0.27 g/g at MV0 to 0.32 g/g at MV1000) and butyric acid production (from 1.50 g/l at MV0 to g/l at MV >100) was obtained. Moreover, MV did not demonstrate a significant impact on specific growth rate (0.13 to 0.15 /h) and solvents/acids ratio ( mol/mol). Furthermore, a gradual decrease in acetate accumulation (from 1.0 g/l initially to <0.50 g/l finally) was observed during the SHH fermentation course with MV >250 μm Effects of methyl viologen on fermentation kinetics using corn fiber hydrolysate (CFH) as a substrate The effects for MV concentration on fermentation kinetics of CtΔack-adhE2 mutant with CFH as a substrate in serum bottles were shown in Figure 6.7 and Table 6.6. Similar to MV effects on the fermentation kinetics of previous lignocellulosic biomass hydrolysates including CSH, SBH, and SHH, a dramatic decline in ethanol production (from 5.0 g/l to <1.0 g/l), acetate accumulation (from 4.0 g/l to <1.0 g/l), and final cell density (from OD 20.0 to OD 13.5) as well as a slight decrease in specific growth rate (from 0.16 /h to 0.13 /h) was observed in CFH fermentation with increasing MV concentration from 0 to 1000 μm. In addition, acetate accumulation was gradually reduced from 1.25 g/l initially to 0.50 g/l finally during the fermentation course, which was consistent with previous results. However, different from CSH, SBH, and SHH fermentation in which a gradual 235

265 reduction in butanol production was obtained in response to an increase in MV concentration, a similar butanol titer (~11.0 g/l) was spotted in CFH fermentation at each MV level (MV100, 250, 500, and 1000), except for the control without MV, which had a butanol titer over 13.0 g/l. In addition, instead of stimulating butyrate generation at any MV level in previous results, production of butyric acid during CFH fermentation was improved at low MV concentrations (MV100 and MV250), whereas high MV levels (MV500 and MV1000) did not present a significant impact on butyrate production. Moreover, butanol yield and solvents/acids ratio was remarkably boosted from 0.24 g/g to 0.35 g/g and from 2.50 mol/mol to 4.50 mol/mol, respectively, in CFH fermentation in the presence of MV, another important difference with CSH, SBH, and SHH fermentation in which only a slight improvement in butanol yield and no significant effect on solvents/acids ratio was observed due to the addition of MV Fermentation kinetics of CtΔack-adhE2 mutant with CSH, SBH, SHH, or CFH as a substrate in the presence of 250 μm MV Fermentation kinetics of CtΔack-adhE2 mutant using CSH, SBH, SHH, or CFH as a substrate in the presence of 250 μm MV is shown in Figure 6.8, from which the effects of MV on glucose metabolism, cell growth, and product profiles with different substrates were presented and compared. It is clear that all of the four fermentations with CSH, SBH, SHH, or CFH as a substrate demonstrated a similar fermentation kinetics in response to 250 μm MV. Overall, butanol was the leading end-product ( g/l) with considerable amounts of butyrate production ( g/l) and extremely low generation of ethanol and acetate (< 1.0 g/l). In addition, a rapid consumption of glucose along with a fast cell growth and a sharp increase in butanol production accompanied 236

266 with a slow accumulation of ethanol and butyrate was observed in the first h, all of which ceased immediately at a certain point with a large amount of glucose (25-30 g/l) remaining unfermented. Moreover, a gradual decline in acetate accumulation was obtained in all of the four cases with 250 μm MV, which confirmed that acetate can be consumed as an additional carbon source for cell growth and metabolism and biosynthesis of acetic acid is not required for cell survival. However, butanol titer in CFH fermentation was considerably higher than those in CSH, SBH, and SHH fermentation (10.50 g/l vs. 9.0 g/l) whereas the highest butyrate production (5.50 g/l) was obtained in SBH fermentation, which was significantly higher than the other three fermentations (3.0 g/l) Comparison of MV effects in glucose, CBH, JAH, CSH, SBH, SHH, and CFH fermentations The effects of MV on several key parameters including butanol titer, butanol yield, specific growth rate and solvents/acids ratio using different substrates including glucose, CBH, JAH, CSH, SBH, SHH, and CFH are summarized and compared in Table 6.7. In terms of butanol titer, the effects of MV can be divided into three categories: stimulatory effect, inhibitory impact, and no significant influence. In glucose and CBH fermentations, butanol production was remarkably improved from g/l to g/l by MV whereas in CSH, SBH, and SHH fermentations, butanol production was dramatically reduced from g/l to g/l in the presence of MV. In JAH and CFH fermentations, however, MV did not present a significant impact on butanol production with butanol titers of g/l at each MV level. When it comes to 237

267 butanol yield, a remarkable improvement from g/g to g/g was achieved in glucose, CBH, JAH, and CFH fermentations whereas only a slight increase from g/g to g/g was observed in CSH, SBH, and SHH fermentations with increasing MV concentration from 0 to 1000 μm. With respect to specific growth rate, MV presented either a strong toxic impact or a slight inhibitory effect. In glucose and CBH fermentations, a dramatic decline in specific growth rate (from /h to /h) was spotted whereas in JAH, CSH, SBH, SHH, and CFH fermentations, only a slight decrease in specific growth rate (from /h to /h) was observed with increasing MV concentration. The effects of MV on solvents/acids ratio can also be considered as two groups: remarkable improvement influence and no significant impact. In glucose, CBH, JAH, and CFH fermentations, a remarkable improvement in solvents/acids ratio (from mol/mol to mol/mol) was achieved whereas in CSH, SBH, and SHH fermentations, MV did not demonstrate a significant impact on solvents/acids ratio (3.0 mol/mol, 1.50 mol/mol, and 4.0 mol/mol in CSH, SBH, and SHH fermentation, respectively, at each MV level) Immobilized-cell fermentation in FBB Butanol production from cassava bagasse hydrolysate (CBH) in FBB Repeated-batch (RB) fermentation of immobilized-cell CtΔack-adhE2 in FBB with CBH as a substrate in the presence of either MV or BV was investigated with a focus on improving substrate utilization efficiency and evaluating the long-term performance of the fermentation process for high-titer and high-yield butanol production from renewable raw materials. The repeated-batch fermentation kinetics is shown in Figure 6.9A while the comparison of butanol productivity and yield within each repeated-batch is presented 238

268 in Figure 6.9B. Totally, 7 repeated batches were operated for over 600 hours. Glucose supplemented with 500 μm MV was used in the first RB (RB 1) as a control whereas CBH was used in RBs 2-7 with MV500 in RB 2, MV250 in RB 3-5, and BV25 in RB 6-7. It is clear that a stable butanol production with a titer of over 15.0 g/l from CBH was achieved during the repeated-batch fermentation, which was comparable to the control with glucose as a substrate. In addition, a rapid consumption of glucose along with a sharp increase in butanol titer was observed for each repeated-batch, indicating that the substrate utilization efficiency is very high with less than 10.0 g/l residual glucose remaining unfermented. Moreover, the generation of ethanol and acetate, two major byproducts, was almost completely eliminated by the addition of artificial electron carriers with no observed accumulation of ethanol and acetate during the repeated-batch fermentation. However, the production of butyric acid, another major by-product, could not be effectively controlled by MV or BV with considerable amounts of butyrate ( g/l) accumulated in each repeated-batch, except for the control (3.0 g/l). As shown in Figure 6.9B, a stable butanol yield (0.30 g/g) was also achieved within each repeatedbatch during CBH fermentation, which was comparable to the control in glucose fermentation. However, butanol productivity, which was substrate and artificial electron carrier specific, was inconsistent within each repeated-batch; but it can be considered as three groups based on the substrate used and the artificial electron carriers added. The first group was the control with glucose as a substrate in the presence of 500 μm MV, which demonstrated the highest butanol productivity of 0.40 g/l/h. The second group was RB 3-5 with CBH as a substrate in the presence of 250 μm MV, which presented a moderate butanol productivity of g/l/h. The last group included RB 2 and RB 239

269 6-7 with also CBH as a substrate but in the presence of either 500 μm MV or 25 μm BV, which had a considerably low butanol productivity of less than 0.20 g/l/h, more than 50% lower than the first group. Nevertheless, a stable and reliable long-term performance of repeated-batch fermentation for high-titer (>15.0 g/l) and high-yield (>0.30 g/g) butanol production from CBH, a renewable and sustainable feedstock, was achieved with a consistent butanol titer and yield in each repeated-batch Butanol production from lignocellulosic biomass hydrolysates in FBB Butanol production from lignocellulosic biomass hydrolysates including CSH, SBH, SHH, and CFH with repeated-batch fermentation of immobilized-cell CtΔack-adhE2 in FBB in the presence of either MV or BV was also considered with a focus on achieving high-titer and high-yield butanol production from abundant, renewable, and inexpensive raw materials. The repeated-batch fermentation kinetics with different substrates is shown in Figure 6.10A while butanol productivity and yield within each repeated-batch was summarized and compared in Figure 6.10B. This time, 9 repeated batches were operated for nearly 1000 hours. Xylose supplemented with 10 μm BV was used in the first RB (RB 1) as a control whereas different lignocellulosic biomass hydrolysates with different MV or BV concentrations were used in RBs 2-9 (RB2: CSH, MV250; RB3: CSH, BV250; RB4: SBH, MV250; RB5: SBH, BV25; RB6: SHH, MV250; RB7: SHH, BV25; RB8: CFH, MV250; RB9: CFH, BV25). From Figure 6.10A, it is clear that the production of butanol and butyric acid during the repeated-batch fermentation was highly dependent on the substrates used and artificial electron carriers added. The highest butanol titer (>15.0 g/l) was achieved in CSH fermentation (RB 2-3), which was comparable to repeated-batch glucose and CBH 240

270 fermentation, whereas the lowest butanol titer (nearly 10.0 g/l) was observed in CFH fermentation (RB 8-9). A relatively high butanol production with a comparable titer (~ 15.0 g/l) to the control with xylose as a substrate was obtained in SHH fermentation (RB 6-7) while a relatively low butanol production with a moderate titer ( g/l) was spotted in SBH fermentation (RB 4-5). In terms of butyric acid production, CSH and SHH fermentations presented a similar and relatively low butyrate concentration ( g/l) whereas SBH and xylose fermentation (the control) produced considerable and relatively high butyrate ( g/l). The highest butyrate titer (~12.0 g/l) was observed in CFH fermentation in the presence of 25 μm BV (RB 9), which was even higher than butanol production, making it the leading product in RB 9. Despite the distinct product profiles of butanol and butyrate with different substrates, there were a couple of agreements in common in each repeated-batch. First, the generation of ethanol and acetate was efficiently limited to an extremely low level (< 0.50 g/l for acetate and no accumulation for ethanol) in each repeated-batch due to the use of artificial electron carriers. Second, a rapid consumption of glucose along with a steady increase in butanol and butyrate production was observed in each repeated-batch. Third, the glucose utilization efficiency for each repeated-batch was very high with less than 10.0 g/l residual glucose remaining unfermented in the fermentation broth. Finally, it has been demonstrated that acetate can be used as an additional carbon source for cell growth and metabolism since a gradual decline in acetate accumulation was observed in repeated-batch fermentations with lignocellulosic biomass hydrolysates as substrates. It should be noted that CtΔack-adhE2 mutant was capable of consuming glucose and xylose simultaneously, although the consumption rate of xylose was much lower than 241

271 that of glucose and it was highly dependent on glucose/xylose ratio (G/X ratio). During the repeated-batch fermentation with lignocellulosic biomass hydrolysates as substrates, the highest xylose consumption rate was achieved in SBH fermentation with an approximately G/X ratio of 2:1 whereas the lowest xylose consumption rate was observed in CSH fermentation with a G/X ratio nearly 6:1. A similar xylose consumption rate, which was higher than that in CSH fermentation and lower than that in SBH fermentation, was obtained in SHH and CFH fermentations with a similar G/X ratio (3:1 to 4:1). It is clear that a low G/X ratio, such as in SBH fermentation, can facilitate xylose uptake and utilization while high G/X ratio, such as in CSH fermentation, might obstruct xylose consumption because compared to xylose, glucose is a more favorable substrate. Butanol productivity and yield was also highly substrate specific, although it was not significantly affected by artificial electron carriers, as shown in Figure 6.10B. CSH fermentation demonstrated the highest butanol productivity ( g/l/h) and yield (0.30 g/g) whereas CFH fermentation gave the lowest butanol productivity (<0.15 g/l/h) and yield (<0.20 g/g). A moderate butanol productivity ( g/l/h) and yield ( g/g) was observed in SHH fermentation while a relatively low butanol productivity ( g/l/h) and yield ( g/g) was presented in SBH fermentation. The control with xylose fermentation provided a butanol productivity of 0.13 g/l/h with a yield of 0.21 g/g, which was close to SBH fermentation. The distinct performance in butanol productivity and yield during the repeated-batch fermentation with different lignocellulosic biomass hydrolysates as substrates might be perfectly explained by the compositions and concentrations of various components presented in the different 242

272 hydrolysates, including fermentable and non-fermentable sugars, various acids, and inhibitory compounds, which will be discussed later. 6.4 Discussion High-titer (>15.0 g/l) and high-yield (>0.30 g/g) butanol production from cellulosic and lignocellulosic feedstocks by metabolically engineered C. tyrobutyricum mutant was successfully achieved in this study, which has provided a very promising strategy for cost-effective production of liquid fuels from abundant, renewable, and inexpensive raw materials. To my knowledge, this is the first report on high-titer, high-yield, and costeffective butanol production from alternative feedstocks via a heterologous butanol synthesis platform. In fact, ABE production from various agricultural residues and industrial wastes by solventogenic clostridia has been extensively studied [Kumar and Gayen, 2011; Tracy et al., 2012; Jang et al., 2012]. Corn-derived agricultural residues and industrial wastes including corn stover, corn fiber, corncob, degermed corn, and liquefied corn starch have been considered as alternative feedstocks for economical biobutanol production. Ni et al. reported an ABE production from corn stover hydrolysate by Clostridium saccharobutylicum DSM in a continuous fermentation process with a total ABE titer of g/l and a productivity of 0.43 g/l/h at a dilution rate of 0.15 /h [Ni et al., 2012]. By using hemicellulosic hydrolysate of corn fiber treated with dilute sulfuric acid (SAHHC) as a substrate, C. beijerinckii RT66 produced 12.9 g/l total ABE with a yield of 0.35 g/g and a productivity of 0.18 g/l/h [Guo et al., 2013]. In another study using sulfuric acid treated corn fiber hydrolysate (SACFH) as a substrate, C. beijerinckii IB4 was able to produce 9.50 g/l butanol [Du et al., 2013]. In addition to corn derived feedstocks, various straw-based raw materials including barley straw, wheat 243

273 straw, rice straw, rice bran, and switchgrass have also been considered as alternative substrates for ABE production. In batch fermentation, C. beijerinckii P260 produced 25.0 g/l total ABE with a yield of 0.42 g/g and a productivity of 0.60 g/l/h from wheat straw hydrolysate [Qureshi et al., 2007]. Recently, by using dilute sulfuric acid pretreated deoiled rice bran as a substrate, C. saccharoperbutylacetonicum N1-4 was able to produce g/l ABE with a productivity of 0.1 g/l/h and a yield of 0.44 g/g [Al-Shorgani et al., 2012]. Industrial and municipal wastes including domestic organic waste (DOW), dried distiller s grains and soluble (DDGS), cheese whey, cane molasses, wood pulp, packing peanuts, and oil palm decanter cake are another group of promising alternative feedstocks for economical production of biofuels. In a study using DDGS as an alternative substrate, C. saccharobutylicum 262 and C. butylicum 592 could produce 12.1 g/l and 12.9 g/l total ABE, respectively [Ezeji and Blaschek, 2008]. Recently, fiber-enhanced DDGS pretreated with electrolyzed water was considered for ABE production by C. beijerinckii BA 101, which could generate 5.35 g ABE from 100 g dry fiber-enhanced DDGS [Wang et al., 2013]. Razak et al. reported a butanol production from oil palm decanter cake by C. acetobutylicum ATCC 824, which produced 6.03 g/l butanol with a yield of 0.11 g/g [Razak et al., 2013]. In another study using sago pith residue hydrolysate as an alternative carbon source, C. acetobutylicum ATCC 824 was able to produce 8.84 g/l ABE with a productivity and yield of 0.12 g/l/h and 0.30 g/g, respectively [Linggang et al., 2013]. In this study, various cellulosic and lignocellulosic materials including cassava bagasse, Jerusalem artichoke, cotton stalk, sugarcane bagasse, soybean hull, and corn fiber were considered as alternative feedstocks for cost-effective butanol production by a C. tyrobutyricum mutant in both free-cell and immobilized-cell fermentations. A butanol 244

274 titer of over 15.0 g/l with a yield of over 0.30 g/g was successfully achieved, which was comparable to or even higher than traditional ABE production by solventogenic clostridia. It has been reported that ABE production via solventogenic clostridia is usually severely affected by the inhibitory compounds presented in the biomass hydrolysates generated during pretreatment and enzymatic hydrolysis process and detoxification treatment is usually required for efficient utilization of lignocellulosic feedstocks [Ezeji et al., 2007]. Qureshi et al. utilized corn stover hydrolysate as a substrate for ABE production by C. beijerinckii P260, which exhibited no growth and no ABE production with untreated substrate whereas produced as high as g/l ABE after inhibitor removal by treating the hydrolysate with Ca(OH) 2 [Qureshi et al., 2010a]. In another study, Qureshi et al. reported that sulfuric acid treated corn fiber hydrolysate (SACFH) could inhibit cell growth and butanol production with 1.7 g/l ABE generated by C. beijerinckii BA101 whereas 9.3 g/l ABE was produced after treatment of SACFH with XAD-4 resin [Qureshi et al., 2008b]. Qureshi et al. evaluated the utilization of dilute sulfuric acid treated barley straw hydrolysate (BSH) for ABE production by C. beijerinckii P260, which produced 7.09 g/l ABE with a yield of 0.33 g/g and a productivity of 0.10 g/l/h in the original BSH whereas reached g/l ABE with a yield of 0.43 g/g and a productivity of 0.39 g/l/h after inhibitor removal by lime Ca(OH) 2 treatment [Qureshi et al., 2010b]. Alkaline peroxide wheat straw hydrolysate (APWSH) was also considered as a suitable substrate for ABE production by C. beijerinckii P260, in which less than 2.59 g/l ABE was produced in the original APWSH whereas as high as 22.17g/L ABE was successfully reached in the salt removed APWSH by electrodialysis [Qureshi et al., 2008c]. Switchgrass hydrolysate (SGH) is another possible raw material for ABE 245

275 production by C. beijerinckii P260 in batch fermentations, during which the cell growth and ABE production (1.48 g/l) was severely inhibited in untreated SGH whereas ABE production was improved to g/l in SGH after inhibitors removal [Qureshi et al., 2010b]. Ezeji et al. investigated the effects of some inhibitory compounds present in lignocellulosic hydrolysate on cell growth and ABE production by C. beijerinckii BA101 and confirmed that as low as 0.3 g/l p-coumaric and ferulic acids can significantly inhibit cell growth and reduce ABE production in C. beijerinckii BA101 whereas interestingly, furfural and hydroxymethylfurfural demonstrated some stimulatory effect on the growth of C. beijerinckii BA101 and ABE production [Ezeji et al., 2007]. In this study, no significant inhibition on cell growth and metabolism was observed during butanol production by C. tyrobutyricum mutant from various cellulosic and lignocellulosic hydrolysates including CBH, JAH, CSH, SBH, SHH, and CFH. Actually, a comparable to or even higher butanol titer and yield was achieved during these fermentations in serum bottles, compared to glucose fermentation without MV. The concentrations of some typical inhibitory compounds presented in various hydrolysates were analyzed, as shown in Table 6.8. It is clear that ferulic acid and p-coumaric acid, which have been reported as highly toxic chemicals on cell growth and metabolism in previous studies, was almost undetectable with less than 0.01 g/l ferulic acid and ~ 0.05 g/l p-coumaric acid in our tested hydrolysates. Although considerable amounts of hydroxymethylfurfural ( g/l) and formic acid ( g/l) were detected in most hydrolysates, cell growth and fermentation performance in these fermentations was not significantly affected by hydroxymethylfurfural and formic acid, which was consistent with previous reports confirming that these two chemicals were not very toxic or even 246

276 presented a stimulatory effect on cell growth and ABE production [Ezeji et al., 2007]. The extremely low generation of some typical inhibitory compounds such as ferulic acid and p-coumaric acid in our hydrolysates might be caused by the fact that instead of using traditional yeast extract and tryptone, corn steep liquor (CSL) was used as an alternative and cost-effective organic nitrogen source for fermentative butanol production. CSL is a complex nutritional source that might be used to remove toxic chemicals via either physical adsorption or chemical reaction or both. Actually, it has been demonstrated that corn steep liquor contains various trace elements, nitrogenous components, proteins and amino acids that can stimulate cell growth and metabolism, support high cell density, improve cell viability, and facilitate cell survival during stressful culture conditions [Choi et al., 2013]. Nevertheless, without detoxification treatment, these cellulosic and lignocellulosic feedstocks combined with corn steep liquor was successfully used for economically competitive production of butanol by C. tyrobutyricum mutant with a hightiter (>15.0 g/l) and high-yield (>0.30 g/g). A distinct fermentation performance in response to MV concentration was observed in fermentation kinetics using either cellulosic materials (CBH and JAH) or lignocellulosic feedstocks (CSH, SBH, SHH, and CFH) as substrates. Similar to glucose fermentation, a remarkable improvement in butanol titer and yield as well as solvents/acids ratio was achieved in CBH and JAH fermentations whereas in CSH, SBH, SHH, and CFH fermentations, a gradual decline in butanol production, only a slight improvement in butanol yield as well as no significant impact on solvents/acids ratio was spotted with increasing MV concentration. In addition, MV presented a severe inhibitory effect on cell growth in CBH and JAH fermentations, resulting in dramatically lower specific growth 247

277 rate at high MV levels while in CSH, SBH, SHH, and CFH fermentations, cell growth was not significantly affected by MV with only a slight decrease in specific growth rate in the presence of high MV concentrations. These results might be explained by the fact that during the pretreatment and hydrolysis process of cellulosic and lignocellulosic hydrolysates, distinct compositions and concentrations of various components including fermentable and non-fermentable sugars, various acids, inhibitory compounds, trace elements, insoluble substances, and proteins are released, all of which have a fundamental impact on cell growth and metabolism, metabolic regulation and transcription, electron flow, carbon flux, redox balance, and finally product profiles [Ezeji et al., 2010; Jang et al., 2012]. A further investigation on the effects of these components on fermentation kinetics could help us better understand the distinct fermentation performance with different biomass hydrolysates. FBB was successfully applied to achieve high-titer and high-yield butanol production with extremely low accumulation of ethanol and acetate from various alternative feedstocks, which was comparable to our previous results of glucose or xylose fermentation in FBB. In addition, a consistent butanol titer, yield, and productivity was observed during the repeated-batch fermentation in FBB using CBH as a substrate for over 600 hours (Figure 6.9), indicating that the long-term performance of this system is very stable and reliable. Moreover, synchronized utilization of glucose and xylose was spotted during the repeated-batch fermentation with CSH, SBH, SHH, and CFH as a substrate, suggesting that the substrate utilization efficiency is very high, although the consumption rate of xylose was much lower than that of glucose and it was highly dependent on glucose/xylose ratio presented in the hydrolysates. The ability to consume 248

278 pentose and hexose simultaneously has become an essential characteristic of a desired bacterial strain for the development of liquid fuels from lignocellulosic materials since most lignocellulosic hydrolysates contain hexose and pentose as major components, both of which should be efficiently converted to target products to make the biofuels more economically competitive [Papoutsakis, 2008; Green, 2011]. Furthermore, compared to free-cell fermentations, higher butanol titers (>15.0 g/l) and productivities ( g/l/h) was achieved in immobilized-cell fermentation in FBB, which is predictable because it has been demonstrated that FBB can support high cell density, prolong cell viability, allow cell interactions, as well as facilitate the achievement of high cell tolerance to toxic metabolites such as butanol and butyric acid [Yang, 1996; Zhu and Yang, 2003; Liu and Yang, 2006; Jiang et al., 2011, 2012]. For example, by adaptation and evolution in FBB, the maximum specific growth rate of adapted C. tyrobutyricum cells was increased by 2.3-fold and its tolerance to butyrate inhibition increased by 29- fold, compared to the wild type [Zhu and Yang, 2003]. In another study of butyric acid production by C. tyrobutyricum immobilized in a fibrous bed bioreactor, the adapted culture demonstrated significantly higher tolerance to butyric acid and reduced inhibition on specific growth rate with elevated intracellular ph and elongated rod morphology, compared with the original culture [Jiang et al., 2011]. Similarly, by adaptation and evolution in a fibrous bed bioreactor, a hyper-butanol-tolerant and production mutant, C. acetobutylicum JB200, which can produce 21.0 g/l butanol in free-cell fermentation and up to 28.2 g/l butanol in immobilized-cell fermentation, was screened, isolated, and identified [Lu et al., 2012; Xue et al., 2012]. 249

279 However, it should be noted that butanol titer, yield, and productivity during the repeated-batch fermentation in FBB using different hydrolysates was highly substrate specific. Basically, in CBH and CSH fermentations, a very high butanol titer (>15.0 g/l), yield (>0.30 g/g), and productivity ( g/l/h), which was comparable to the control in glucose and xylose fermentations, was achieved whereas in SBH and CFH fermentations, a relatively low butanol titer (<12.0 g/l), yield (<0.25 g/g), and productivity (<0.20 g/l/h) was observed (Figures 6.9 and 6.10). In SHH fermentation, a moderate butanol titer ( g/l), yield ( g/g), and productivity ( g/l/h) were obtained. The distinct performances in FBB with different substrates might be caused by two reasons. First, different substrates have different glucose/xylose ratios (G/X) with G/X > 10 in CBH, G/X=6 in CSH, G/X=5 in SHH, G/X=3 in CFH, and G/X=2 in SBH, which can significantly affect fermentation performance. It is clear that high G/X ratios is beneficial for butanol production with a high titer, yield, and productivity whereas low G/X ratios usually provides lower butanol titer, yield, and productivity, which is understandable because glucose is a more favorable substrate than xylose and high xylose content may obstruct substrate uptake and consumption, resulting in lower butanol production and substrate utilization efficiency. More importantly, inhibitory compounds presented in the hydrolysates are another fundamental reason for the distinct fermentation performances with different substrates [Ezeji et al., 2010; Jang et al., 2012]. The concentrations of some typical inhibitory compounds in CBH, CSH, SBH, SHH, and CFH were analyzed and presented in Table 6.9. It is clear that CBH has the lowest concentrations of various inhibitors with ferulic acid and p-coumaric acid, which have been recognized as highly toxic chemicals on cell growth and metabolism in 250

280 previous studies, less than 0.20 g/l and 0.05 g/l, respectively, whereas CFH gives the highest inhibitors concentrations with ferulic acid and p-coumaric acid exceeding 1.0 g/l and 0.1 g/l, respectively. In particular, nearly 7.0 g/l formic acid and as high as 10.0 g/l levulinic acid was detected in CFH, which apparently can severely affect cell growth and fermentation performance. This is perfectly consistent with our results of repeatedbatch fermentation in FBB in which the highest butanol titer, yield, and productivity was achieved in CBH fermentation while in CFH fermentation, the lowest butanol titer, yield, and productivity was observed. Since CSH has a similar profile of inhibitory compounds with CBH, similar fermentation performances were obtained in CSH and CBH fermentations. SBH and SHH presented similar and moderate concentrations of inhibitors, which were higher than those in CBH and CSH but lower than those in CFH. Therefore, a moderate butanol titer, yield, and productivity was spotted in SBH and SHH fermentations. However, it is interesting to note that SHH demonstrated a better fermentation performance with a significantly higher butanol titer, yield, and productivity than SBH, probably because a higher G/X ratio and lower ferulic acid and p-coumaric acid concentrations were detected in SHH. Nevertheless, it was confirmed that FBB is an advanced fermentation technology that can facilitate the achievement of high-titer, highyield, and high-productivity butanol production from various cellulosic and lignocellulosic feedstocks with high substrate utilization efficiency and a stable and reliable long-term performance. 6.5 Conclusion High-titer, high-yield, and cost-effective butanol production from various cellulosic and lignocellulosic materials including cassava bagasse, Jerusalem artichoke, cotton stalk, 251

281 sugarcane bagasse, soybean hull, and corn fiber by metabolically engineered C. tyrobutyricum was successfully achieved in both free-cell and immobilized-cell fermentations. In addition, it was confirmed that corn steep liquor as a superior complex nutritional source can not only stimulate cell growth and metabolism and support high cell density by providing rich nitrogen nutrients, but also improve cell viability and facilitate cell survival during stressful culture conditions by removing inhibitory compounds and detoxifying the production medium. Moreover, FBB fermentation strategy was successfully applied to achieve high cell tolerance to toxic metabolites including butanol and butyric acid as well as realize synchronized consumption of glucose and xylose with significantly improved substrate utilization efficiency and a stable and reliable long-term performance. However, distinct fermentation performances with large variations in butanol titer, yield, and productivity using different substrates were observed in both free-cell and immobilized-cell fermentations, which might be explained by the fact that different levels of inhibitory compounds and glucose/xylose ratios were presented in different hydrolysates. A further investigation on the effects of these components on fermentation kinetics could be beneficial to understand the fundamental mechanisms for the distinct fermentation performances with different biomass hydrolysates. Nevertheless, this is the first report on high-titer, high-yield, and cost-effective butanol production from abundant, renewable, and inexpensive raw materials via a heterologous butanol synthesis pathway in C. tyrobutyricum. 6.6 References Al-Shorgani NK, Kalil MS, Yusoff WM Biobutanol production from rice bran and de-oiled rice bran by Clostridium saccharoperbutylacetonicum N1-4. Bioproc Biosyst Eng 35:

282 Buschke N, Schroder H, Wittmann C Metabolic engineering of Corynebacterium glutamicum for production of 1,5-diaminopentane from hemicellulose. Biotechnol. J. 6: Cascone R Biobutanol-A replacement for bioethanol? Chem Eng Prog 104:S4-S8. Choi J, Jang YS, Cho JH, Seung D, Lee SY, Papoutsakis ET, Bennett GN, Song H Characterization and evaluation of corn steep liquid in acetone-butanol-ethanol production by Clostridium acetobutylicum. Biotechnol Bioprocess Eng 18: Claassen PAM, Budde MAW, Contreras AML Acetone, butanol and ethanol production from domestic organic waste by solventogenic Clostridia. J Microbiol Biotechnol 2: Du T, He A, Wu H, Chen J, Kong X, Liu J, Jiang M, Ouyang P Butanol production from acid hydrolyzed corn fiber with Clostridium beijerinckii mutant. Bioresour Technol 135: Durre P Biobutanol: An attractive biofuel. Biotechnol J 2: Ezeji T, Blaschek HP Fermentation of dried distillers' grains and solubles (DDGS) hydrolysates to solvents and value-added products by solventogenic clostridia. Bioresour Technol 99: Ezeji T, Milne C, Price ND, Blaschek HP Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl Microbiol Biotechnol 85: Ezeji TC, Qureshi N, Blaschek HP Butanol production from agricultural residues: Impact of degradation products on Clostridium beijerinckii growth and butanol fermentation. Biotechnol Bioeng 97: Garćia V, PäkkiläJ, Ojamo H, Muurinen E, Keiski RL Challenges in biobutanol production: How to improve the efficiency. Renew Sustain Ener Reviews 15: Green EM Fermentative production of butanol-the industrial perspective. Curr Opin Biotechnol 22: Guo T, He A, Du T, Zhu D, Liang D, Jiang M, Wei P, Ouyang P Butanol production from hemicellulosic hydrolysate of corn fiber by a Clostridium beijerinckii mutant with high inhibitor-tolerance. Bioresour Technol 135: Huang J, Cai J, Wang J, Zhu X, Huang L, Yang ST, Xu Z Efficient production of butyric acid from Jerusalem artichoke by immobilized Clostridium tyrobutyricum in a fibrous-bed bioreactor. Bioresour Technol 102: Jang YS, Malaviya A, Cho C, Lee J, Lee SY Butanol production from renewable biomass by clostridia. BioresourcTechnol 123:

283 Jesse TW, Ezeji TC, Qureshi N, Blaschek HP Production of butanol from starchbased waste packing peanuts and agricultural waste. J Ind Microbiol Biotechnol 29: Jiang L, Li S, Hu Y, Xu Q, Huang H Adaptive evolution for fast growth on glucose and the effects on the regulation of glucose transport system in Clostridium tyrobutyricum. Biotechnol Bioeng 109: Jiang L, Wang J, Liang S, Cai J, Xu Z, Cen P, Yang S, Li S Enhanced butyric acid tolerance and bioproduction by Clostridium tyrobutyricum immobilized in a fibrous bed bioreactor. Biotechnol Bioeng 108: Jiang L, Wang J, Liang S, Wang X, Cen P, Xu Z Production of Butyric Acid from Glucose and Xylose with Immobilized Cells of Clostridium tyrobutyricum in a Fibrous-bed Bioreactor. Appl Biochem Biotechnol 1602: Kumar M, Gayen K Developments in biobutanol production: New insights. Appl Energy 88: Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung SK Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: Li H, Luo W, Gu Q, Wang Q, Hu W, Yu X Acetone, butanol, and ethanol production from cane molasses using Clostridium beijerinckii mutant obtained by combined low-energy ion beam implantation and N-methyl-N-nitro-Nnitrosoguanidine induction. Bioresour Technol 137: Linggang S, Phang LY, Wasoh H, Abd-Aziz S Acetone-Butanol-Ethanol Production by Clostridium acetobutylicum ATCC 824 Using Sago Pith Residues Hydrolysate. Bioenergy Research 6: Liu X, Zhu Y, Yang ST Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Progr 22: Liu XG, Yang ST Kinetics of butyric acid fermentation of glucose and xylose by Clostridium tyrobutyricum wild type and mutant. Process Biochem 41: Lopez-Contreras AM, Claassen PA, Mooibroek H, De Vos WM, Utilization of saccharides in extruded domestic organic waste by Clostridium acetobutylicum ATCC 824 for production of acetone, butanol and ethanol. Appl Microbiol Biotechnol 54: Lu C, Zhao J, Yang ST, Wei D Fed-batch fermentation for n-butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour Technol 104:

284 Ni Y, Xia Z, Wang Y, Sun Z Continuous butanol fermentation from inexpensive sugar-based feedstocks by Clostridium saccharobutylicum DSM Bioresour Technol 129: Papoutsakis ET Engineering solventogenic clostridia. Curr Opin Biotechnol 19: Qureshi N, Ezeji TC, Ebener J, Dien BS, Cotta MA, Blaschek HP. 2008a. Butanol production by Clostridium beijerinckii. Part I. Use of acid and enzyme hydrolyzed corn fiber. Bioresour Technol 99: Qureshi N, Saha BC, Cotta MA Butanol production from wheat straw hydrolysate using Clostridium beijerinckii. Bioproc Biosys Eng 30: Qureshi N, Saha BC, Cotta MA. 2008c. Butanol production from wheat straw by simultaneous saccharification and fermentation using Clostridium beijerinckii: part II fed-batch fermentation. Biomass Bioenergy 32: Qureshi N, Saha BC, Dien B, Hector RE, Cotta MA. 2010b. Production of butanol (a biofuel) from agricultural residues: part I use of barley straw hydrolysate. Biomass Bioenergy 34: Qureshi N, Saha BC, Hector RE, Dien B, Hughes S, Liu S, Iten L, Bowman MJ, Sarath G, Cott MA. 2010a. Production of butanol (a biofuel) from agricultural residues: part II use of corn stover and switchgrass hydrolysates. Biomass Bioenergy 34: Qureshi N, Saha BC, Hector RE, Hughes SR, Cotta MA. 2008b. Butanol production from wheat straw by simultaneous saccharification and fermentation using Clostridium beijerinckii: part I batch fermentation. Biomass Bioenergy 32: Raganati F, Olivieri G, Procentese A, Russo ME, Salatino P, Marzocchella A Butanol production by bioconversion of cheese whey in a continuous packed bed reactor. Bioresour Technol 138: Razak MNA, Ibrahim MF, Yee PL, Hassan MA, Abd-Aziz S Statistical Optimization of Biobutanol Production from Oil Palm Decanter Cake Hydrolysate by Clostridium acetobutylicum ATCC 824. Bioresour 8: Searchinger T, Heimlich R, Houghton RA, Dong F, Elobeid A, Fabiosa J, Tokgoz S, Hayes D, Yu TH Use of U.S. croplands for biofuels increases greenhouse gases through emissions from land-use change. Science 319: Survase SA, van Heiningen A, Granstrom T Wood pulp as an immobilization matrix for the continuous production of isopropanol and butanol. J Ind Microbiol Biotechnol 40:

285 Tracy BP, Jones SW, Fast AG, Indurthi DC, Papoutsakis ET Clostridia: the importance of their exceptional substrate and metabolite diversity for biofuel and biorefinery applications. Curr Opin Biotechnol 23: van der Wal H, Sperber B, Houweling-Tan B, Bakker RRC, Brandenburg W, Lopez- Contreras AM Production of acetone, butanol, and ethanol from biomass of the green seaweed Ulva lactuca. Bioresour Technol 128: Wang X, Wang Y, Wang B, Blaschek H, Feng H, Li Z Biobutanol production from fiber-enhanced DDGS pretreated with electrolyzed water. Renewable Energy 52: Xue C, Zhao J, Lu C, Yang ST, Bai F, Tang IC High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping. Biotechnol Bioeng 109: Yang ST Extractive fermentation using convoluted fibrous bed bioreactor. United States Patent Application Publication. US Patent Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol 93: Yu M, Zhang Y, Tang IC, Yang ST Metabolic engineeringof Clostridium tyrobutyricum for n-butanol production. Metab Eng 13: Zhang J, Wang M, Gao M, Fang X, Yano S, Qin S, Xia R Efficient acetonebutanol-ethanol production from corncob with a new pretreatment technology-wet disk milling. Bioenergy Research 6: Zhu Y, Yang ST Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Progr 19:

286 MV concentration (μm) μ (h -1 ) 0.169± ± ± ± ±0.002 OD ± ± ± ± ±0.32 Butanol Titer (g/l) 7.99± ± ± ± ±0.03 Yield (g/g) 0.224± ± ± ± ±0.004 Butyric acid Titer (g/l) 2.13± ± ± ± ±0.09 Yield (g/g) 0.059± ± ± ± ±0.001 Ethanol Titer (g/l) 3.52± ± ± ± ±0.10 Yield (g/g) 0.098± ± ± ± ±0.004 Acetic acid Titer (g/l) 5.90± ± ± ± ±0.01 Yield (g/g) 0.100± Solvents/Acids ratio (mol/mol) 1.52± ± ± ± ±0.10 Table 6.1 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with cassava bagasse hydrolysate (CBH) as a substrate in serum bottles. 257

287 MV concentration (μm) μ (h -1 ) 0.149± ± ± ± ±0.002 OD ± ± ± ± ±0.01 Butanol Titer (g/l) 11.91± ± ± ± ±0.27 Yield (g/g) 0.219± ± ± ± ±0.002 Butyric acid Titer (g/l) 3.02± ± ± ± ±0.08 Yield (g/g) 0.056± ± ± ± ±0.003 Ethanol Titer (g/l) 3.85± ± ± ± ±0.07 Yield (g/g) 0.071± ± ± ± ±0.002 Acetic acid Titer (g/l) 5.09± ± ± ± ±0.02 Yield (g/g) 0.094± ± ± ± ±0.000 Solvents/Acids ratio (mol/mol) 2.05± ± ± ± ±0.21 Table 6.2 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with Jerusalem artichoke hydrolysate (JAH) as a substrate in serum bottles. 258

288 MV concentration (μm) μ (h -1 ) 0.161± ± ± ± ±0.001 OD ± ± ± ± ±0.06 Butanol Titer (g/l) 13.54± ± ± ± ±0.13 Yield (g/g) 0.283± ± ± ± ±0.014 Butyric acid Titer (g/l) 2.41± ± ± ± ±0.03 Yield (g/g) 0.050± ± ± ± ±0.001 Ethanol Titer (g/l) 3.93± ± ± ± ±0.02 Yield (g/g) 0.082± ± ± ± ±0.000 Acetic acid Titer (g/l) 3.62± ± ± ± ±0.06 Yield (g/g) 0.046± ± Solvents/Acids ratio (mol/mol) 3.10± ± ± ± ±0.01 Table 6.3 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with cotton stalk hydrolysate (CSH) as a substrate in serum bottles. 259

289 MV concentration (μm) μ (h -1 ) 0.156± ± ± ± ±0.003 OD ± ± ± ± ±0.14 Butanol Titer (g/l) 11.84± ± ± ± ±0.06 Yield (g/g) 0.273± ± ± ± ±0.014 Butyric acid Titer (g/l) 3.19± ± ± ± ±0.03 Yield (g/g) 0.073± ± ± ± ±0.008 Ethanol Titer (g/l) 3.49± ± ± ± Yield (g/g) 0.079± ± ± ± Acetic acid Titer (g/l) 5.17± ± ± ± ±0.02 Yield (g/g) 0.041± ± Solvents/Acids ratio (mol/mol) 1.93± ± ± ± ±0.01 Table 6.4 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with sugarcane bagasse hydrolysate (SBH) as a substrate in serum bottles. 260

290 MV concentration (μm) μ (h -1 ) 0.146± ± ± ± ±0.001 OD ± ± ± ± ±0.29 Butanol Titer (g/l) 11.57± ± ± ± ±0.07 Yield (g/g) 0.270± ± ± ± ±0.002 Butyric acid Titer (g/l) 1.51± ± ± ± ±0.02 Yield (g/g) 0.035± ± ± ± ±0.001 Ethanol Titer (g/l) 4.75± ± ± ± ±0.04 Yield (g/g) 0.111± ± ± ± ±0.001 Acetic acid Titer (g/l) 2.71± ± ± ± ±0.01 Yield (g/g) 0.042± Solvents/Acids ratio (mol/mol) 4.14± ± ± ± ±0.07 Table 6.5 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with soybean hull hydrolysate (SHH) as a substrate in serum bottles. 261

291 MV concentration (μm) μ (h -1 ) 0.162± ± ± ± ±0.003 OD ± ± ± ± ±0.63 Butanol Titer (g/l) 13.12± ± ± ± ±0.79 Yield (g/g) 0.239± ± ± ± ±0.002 Butyric acid Titer (g/l) 2.76± ± ± ± ±0.15 Yield (g/g) 0.050± ± ± ± ±0.005 Ethanol Titer (g/l) 4.88± ± ± ± ±0.07 Yield (g/g) 0.089± ± ± ± ±0.002 Acetic acid Titer (g/l) 4.04± ± ± ± ±0.02 Yield (g/g) 0.050± ± Solvents/Acids ratio (mol/mol) 2.87± ± ± ± ±0.48 Table 6.6 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium with corn fiber hydrolysate (CFH) as a substrate in serum bottles. 262

292 Parameters Substrates MV concentrations (μm) Butanol titer (g/l) Glucose 9.18± ± ± ± ±0.08 CBH 7.99± ± ± ± ±0.03 JAH 11.91± ± ± ± ±0.27 CSH 13.54± ± ± ± ±0.13 SBH 11.84± ± ± ± ±0.06 SHH 11.57± ± ± ± ±0.07 CFH 13.12± ± ± ± ±0.79 Butanol yield (g/g) Glucose 0.212± ± ± ± ±0.008 CBH 0.224± ± ± ± ±0.004 JAH 0.219± ± ± ± ±0.002 CSH 0.283± ± ± ± ±0.014 SBH 0.273± ± ± ± ±0.014 SHH 0.270± ± ± ± ±0.002 CFH 0.239± ± ± ± ±0.002 μ (1/h) Glucose 0.189± ± ± ± ±0.017 CBH 0.169± ± ± ± ±0.002 JAH 0.149± ± ± ± ±0.002 CSH 0.161± ± ± ± ±0.001 SBH 0.156± ± ± ± ±0.003 SHH 0.146± ± ± ± ±0.001 CFH 0.162± ± ± ± ±0.003 Solvents/ Acids ratio (mol/mol) Glucose 1.53± ± ± ± ±2.69 CBH 1.52± ± ± ± ±0.10 JAH 2.05± ± ± ± ±0.21 CSH 3.10± ± ± ± ±0.01 SBH 1.93± ± ± ± ±0.01 SHH 4.14± ± ± ± ±0.07 CFH 2.87± ± ± ± ±0.48 Table 6.7 Comparison of some key parameters including butanol titer, butanol yield, specific growth rate, and solvents/acids ratio of CtΔack-adhE2 mutant in response to methyl viologen in CSL medium with various substrates including glucose, CBH, JAH, CSH, SBH, SHH, and CFH. 263

293 Substrates FF HMF FMA FLA LA p-ca (g/l) (g/l) (g/l) (g/l) (g/l) (g/l) JAH < CBH < <0.01 <0.01 < CSH < <0.01 < SBH < < SHH < CFH <0.01 < Table 6.8 Detection and comparison of various inhibitory compounds presented in various biomass hydrolysates after pretreatment, enzymatic hydrolysis, centrifuge, evaporating concentration, and being sterilized together with CSL (FF, furfural; HMF, hydroxymethylfurfural; FMA, formic acid; FLA, ferulic acid; LA, levulinic acid; p-ca, p-coumaric acid). 264

294 Substrates FF HMF FMA FLA LA p-ca (g/l) (g/l) (g/l) (g/l) (g/l) (g/l) CBH CSH SBH SHH CFH Table 6.9 Detection and comparison of various inhibitory compounds presented in various biomass hydrolysates after pretreatment, enzymatic hydrolysis, centrifuge, and evaporating concentration (FF, furfural; HMF, hydroxymethylfurfural; FMA, formic acid; FLA, ferulic acid; LA, levulinic acid; p-ca, p-coumaric acid). 265

295 Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) Glucose (g/l) A MV0 MV100 MV250 MV500 MV1000 B MV0 MV100 MV250 MV500 MV OD Time (h) Time (h) C MV0 MV100 MV250 MV500 MV1000 D MV0 MV100 MV250 MV500 MV Time (h) Time (h) E MV0 MV100 MV250 MV500 MV1000 F MV0 MV100 MV250 MV500 MV Time (h) Time (h) Figure 6.1 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using cassava bagasse hydrolysate (CBH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 266

296 Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) Total Sugar (g/l) A MV0 MV100 MV250 MV500 MV1000 B MV0 MV100 MV250 MV500 MV OD Time (h) Time (h) C MV0 MV100 MV250 MV500 MV1000 D MV0 MV100 MV250 MV500 MV Time (h) Time (h) E MV0 MV100 MV250 MV500 MV1000 F 5 4 MV0 MV100 MV250 MV500 MV Time (h) Time (h) Figure 6.2 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using Jerusalem artichoke hydrolysate (JAH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 267

297 Sugar (g/l) OD, Products (g/l) Glucose (g/l) OD, Products (g/l) A 40 Glucose OD Ethanol Butanol Acetate Butyrate Time (h) 0 B Sugar OD Ethanol Butanol Acetate Butyrate Time (h) Figure 6.3 Fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium in serum bottles in the presence of 500 μm methyl viologen using cassava bagasse hydrolysate (CBH) or Jerusalem artichoke hydrolysate (JAH) as a substrate (A, CBH; B, JAH). 268

298 Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) Glucose (g/l) A MV0 MV100 MV250 MV500 MV1000 B MV0 MV100 MV250 MV500 MV OD Time (h) Time (h) C 14 MV0 MV100 MV MV500 MV D MV0 MV100 MV250 MV500 MV Time (h) Time (h) E MV0 MV100 MV250 MV500 MV1000 F MV0 MV100 MV250 MV500 MV Time (h) Time (h) Figure 6.4 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using cotton stalk hydrolysate (CSH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 269

299 Glucose (g/l) Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) A 40 MV0 MV100 MV250 MV500 MV1000 B MV0 MV100 MV250 MV500 MV OD Time (h) Time (h) C 12 MV0 MV100 MV MV500 MV1000 D MV0 MV100 MV250 MV500 MV Time (h) Time (h) E MV0 MV100 MV250 MV500 MV1000 F MV0 MV100 MV250 MV500 MV Time (h) Time (h) Figure 6.5 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using sugarcane bagasse hydrolysate (SBH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 270

300 Glucose (g/l) Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) A 40 MV0 MV100 MV250 MV500 MV1000 B MV0 MV100 MV250 MV500 MV OD Time (h) Time (h) C MV0 MV100 MV250 MV500 MV1000 D 5 4 MV0 MV100 MV250 MV500 MV Time (h) Time (h) E MV0 MV100 MV250 MV500 MV1000 F MV0 MV100 MV250 MV500 MV Time (h) Time (h) Figure 6.6 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using soybean hull hydrolysate (SHH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 271

301 Glucose (g/l) MV0 MV100 MV250 MV500 MV1000 Butyrate (g/l) Acetate (g/l) Butanol (g/l) Ethanol (g/l) A B MV0 MV100 MV250 MV500 MV OD Time (h) Time (h) C MV0 MV100 MV250 MV500 MV1000 D MV0 MV100 MV250 MV500 MV Time (h) Time (h) E MV0 MV100 MV250 MV500 MV1000 F 5 4 MV0 MV100 MV250 MV500 MV Time (h) Time (h) Figure 6.7 Effects of methyl viologen (MV) on fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium using corn fiber hydrolysate (CFH) as a substrate in serum bottles (A, glucose consumption; B, cell optical density at 600 nm; C, butanol production; D, ethanol production; E, butyrate production; F, acetate production). 272

302 Glucose (g/l) OD, Products (g/l) Glucose (g/l) OD, Products (g/l) A Glucose OD Ethanol Butanol Acetate Butyrate B Time (h) Glucose OD Ethanol Butanol Acetate Butyrate Time (h) Continued Figure 6.8 Fermentation kinetics of CtΔack-adhE2 mutant grown in CSL medium in serum bottles in the presence of 250 μm methyl viologen using cotton stalk hydrolysate (CSH), sugarcane bagasse hydrolysate (SBH), soybean hull hydrolysate (SHH), or corn fiber hydrolysate (CFH) as a substrate (A, CSH; B, SBH; C, SHH; D, CFH)

303 Glucose (g/l) OD, Products (g/l) Glucose (g/l) OD, Products (g/l) Figure 6.8 continued C Glucose OD Ethanol Butanol Acetate Butyrate D Time (h) Glucose OD Ethanol Butanol Acetate Butyrate Time (h) 0 274

304 Butanol Productivity (g/l/h), Yield (g/g) Glucose (g/l) OD, Products (g/l) A Glucose OD Ethanol Butanol Acetate Butyrate B Time (h) Productivity Yield Repeated batches (#) Figure 6.9 Fermentation kinetics for immobilized-cell fermentation with a repeated-batch model in FBB of CtΔack-adhE2 mutant grown in CSL medium using cassava bagasse hydrolysate (CBH) as a substrate in the presence of artificial electron carriers (RB1, glucose as a control; RB 2-7, CBH as a substrate; RB 1-2, MV500; RB 3-5, MV250; RB 6-7, BV25) (A, fermentation kinetics; B, comparison of butanol productivity and yield within each repeated batch). 275

305 Butanol productivity (g/l/h), yield (g/g) Glucose, Xylose (g/l) OD, Products (g/l) A Glucose Xylose OD Ethanol Butanol Acetate Butyrate B Time (h) 0.4 Productivity Yield Repeated Batches (#) Figure 6.10 Fermentation kinetics for immobilized-cell fermentation with a repeatedbatch model in FBB of CtΔack-adhE2 mutant grown in CSL medium using various lignocellulosic feedstocks as substrates including cotton stalk hydrolysate (CSH), sugarcane bagasse hydrolysate (SBH), soybean hull hydrolysate (SHH), or corn fiber hydrolysate (CFH) in the presence of artificial electron carriers (RB1: xylose as a control, BV10; RB2: CSH, MV250; RB3: CSH, BV250; RB4: SBH, MV250; RB5: SBH, BV25; RB6: SHH, MV250; RB7: SHH, BV25; RB8: CFH, MV250; RB9: CFH, BV25) (A, fermentation kinetics; B, comparison of butanol productivity and yield within each repeated batch). 276

306 Chapter 7: Conclusions and Recommendations 7.1 Conclusions In this study, a stable and reliable fermentation process was successfully developed for high-titer, high-yield, and cost-effective butanol production from lignocellulosic feedstocks by metabolically engineered C. tyrobutyricum via creating NADH driving forces to improve butanol yield and reduce by-products generation, optimizing medium formula to enhance butanol synthesis and reduce production cost, applying adaptation and evolution strategy in FBB to overcome butanol tolerance and achieve high butanol titers, integrating fed-batch fermentation and gas stripping to alleviate butanol-induced inhibition and realize in situ butanol recovery, and finally using abundant, renewable, and inexpensive raw materials as alternative feedstocks to make the fermentative butanol production process more economically competitive. In order to compare the fermentation performance between adhe and adhe2 overexpressed C. tyrobutyricum mutants as well as evaluate the effects of disruption of either acetate or butyrate synthesis pathway in C. tyrobutyricum on fermentation kinetics, heterologous expression of clostridial butanol pathway with over-expression of adhe gene as well as single knockout of either ack/pta or ptb gene in C. tyrobutyricum was investigated in this study. Gene adhe under the control of native promoter thl was successfully cloned and transferred into C. tyrobutyricum and various mutants were obtained, which demonstrated the ability to produce butanol at a titer of ~ 100 mg/l. 277

307 Although this titer cannot be comparable with that in adhe2 over-expressed C. tyrobutyricum mutants and the recently developed butanol-producing E. coli mutants, it presented a similar butanol production to other alternative platforms. Disruption of either ack/pta gene involved in acetate synthesis pathway or ptb gene involved in butyrate synthesis pathway in C. tyrobutyricum increased acetate production, decreased butyrate generation, and remarkably improved acetate/butyrate ratio, which was partially inconsistent with previous studies on genetic manipulations of acid formation pathways in solventogenic clostridia. This study has revealed that adhe and adhe2 over-expressed C. tyrobutyricum mutants demonstrated distinct fermentation performances and these two genes presented a couple of fundamental differences. It was also confirmed that in terms of heterologous butanol synthesis in alternative platforms, adhe2 gene is more favorable with a higher butanol titer. By using methyl viologen or benzyl viologen as artificial electron carriers to replace ferredoxin, the native electron donor, and create NADH driving forces, a remarkable improvement in butanol titer and yield was achieved in C. tyrobutyricum. It was demonstrated that MV or BV has a profound effect on the fermentation kinetics of butanol-producing C. tyrobutyricum mutant. Generally, high levels of methyl viologen (MV500 and MV1000) can significantly reduce the generation of acids (acetate and butyrate) and strongly promote the production of solvents (ethanol and butanol). Compared to the results without methyl viologen, the titers of butanol and ethanol were increased from 3.27 g/l to g/l and from 0.78 g/l to 1.41 g/l, respectively, whereas the titers of butyrate and acetate were decreased from 6.00 g/l to 1.47 g/l and from 3.31 g/l to 0.48 g/l, respectively, in the presence of 1000 μm methyl viologen. A 278

308 remarkable improvement in butanol yield (g/g glucose, from 0.10 to 0.28) and solvents/acids ratio (mol/mol, from 0.5 to 7.4) was also achieved with MV1000. The remarkable improvement in butanol production should be resulted from the significant increase in NADH availability in the presence of MV or BV. In fact, metabolic flux analysis revealed that butanol production was consistent with NADH availability; higher NADH flux induces more butanol whereas less butanol was generated at lower NADH flux. It was also confirmed that artificial electron carriers can divert electron flow from hydrogen generation to NADH accumulation by affecting the activities of both hydrogenase and NAD + reductase, resulting in a sharp decline in hydrogen generation and a significant improvement in NADH availability. It is interesting to note that similar fermentation kinetics were observed in the presence of 500 μm MV or 25 μm BV, indicating that as an electron carrier, BV is more efficient than MV. Actually, the standard redox potential of BV (-360 mv) is very close to that of ferredoxin (-330 mv), the native electron carrier in most anaerobic bacteria, whereas MV has a standard redox potential of -440 mv. Corn steep liquor (CSL), a complex nutritional source, was considered as an alternative superior organic nitrogen source to replace yeast extract and tryptone in traditional clostridium growth medium (CGM) for enhanced butanol production by C. tyrobutyricum mutant. It is clear that for each MV level, higher butanol titers and yields were achieved in CSL medium than in CGM medium, indicating that CSL is a more favorable nitrogen source for butanol production by clostridium spp. In particular, without MV, a butanol titer of ~3.0 g/l with a yield of less than 0.10 g/g was observed in CGM medium while in CSL medium, the butanol titer and yield reached as high as 9.0 g/l and over 0.20 g/g, 279

309 respectively. In batch fermentations in the presence of 500 μm MV, ~12.0 g/l butanol was produced in CGM medium whereas in CSL medium, the butanol titer was higher than 15.0 g/l. It was noticed that a significant inhibitory impact on cell growth was observed in CGM medium with MV500 whereas in CSL medium, the cell growth was not severely affected until MV concentration reached 1000 μm. Moreover, except for MV1000, higher solvents/acids ratios were obtained in CSL medium than in CGM medium, which would suggest that CSL is more favorable for solvents production. Higher butanol titer, butanol yield, specific growth rate, and solvents/acids ration achieved in CSL medium than those in CGM medium is predictable because it has been demonstrated that corn steep liquor contains various trace elements, nitrogenous components, proteins and amino acids that can stimulate cell growth and metabolism, support high cell density, improve cell viability, and facilitate cell survival during stressful culture conditions. More importantly, CSL is inexpensive, abundant, renewable, and easy to use, making it an excellent and cost-effective nutritional source for economically competitive production of biobutanol. Adaptation and evolution strategy in FBB with a repeated-batch fermentation mode was successfully applied in this study for enhanced butanol production with a very high butanol titer (~20.0 g/l), yield (~0.35 g/g), and productivity (~0.40 g/l/h) from glucose, xylose, glucose-xylose mixture, and various cellulosic and lignocellulosic feedstocks in engineered C. tyrobutyricum mutant for over 1000 hours. Due to a continuous adaptation and evolution, the final butanol titer was steadily increased from ~14.0 g/l to ~20.0 g/l in glucose fermentation with an extremely low level of acetate and ethanol (<0.50 g/l). In addition, a consistent productivity (~0.35 g/l/h) and yield (~0.30 g/g) was obtained 280

310 within each repeated-batch, suggesting that this process has a very stable and reliable long-term performance. Moreover, simultaneous consumption of glucose and xylose was observed during immobilized-cell fermentation in FBB, providing high substrate utilization efficiency, although the consumption rate of xylose was much lower than that of glucose and it was highly dependent on glucose/xylose ratio. In fact, the ability to consume pentose and hexose simultaneously has become an essential characteristic of a desired bacterial strain for the development of liquid fuels from lignocellulosic materials since most lignocellulosic hydrolysates contain hexose and pentose as major components, both of which should be efficiently converted to target products to make the biofuels more economically competitive. Furthermore, compared to free-cell fermentations, higher butanol titers (~20.0 g/l vs. ~15.0 g/l) and productivities (~0.35 g/l/h vs. ~0.25 g/l/h) was achieved in immobilized-cell fermentation in FBB, which is predictable because it has been demonstrated that FBB can support high cell density, prolong cell viability, allow cell interactions, as well as facilitate the achievement of high cell tolerance to toxic metabolites such as butanol and butyric acid. Finally, high-titer (>15.0 g/l) and high-yield (>0.30 g/g) butanol production was also achieved in FBB with xylose, glucose-xylose mixture, and various biomass hydrolysates as substrates. In order to alleviate butanol-induced inhibition and further improve butanol production, fed-batch fermentation integrated with gas stripping was used for in situ butanol recovery via recycling a gas mixture of CO 2 and H 2 generated during the cellular metabolism through the culture medium. A continuous butanol production for over 300 hours with a final total butanol titer of ~60.0 g/l and a yield of ~0.35 g/g was successfully achieved in this integrated process. Due to the use of artificial electron carriers, the production of 281

311 acetate and ethanol was strongly inhibited with very low titers (<1.0 g/l). It was also noticed that a prolonged stationary phase with a stable optical cell density was obtained after gas stripping started because butanol titer in the fermentation broth was efficiently controlled below 10.0 g/l to minimize product inhibition on cell proliferation. It was confirmed that this integrated process has demonstrated a stable and reliable long-term performance with butanol as the only leading product since the slope for butanol production in terms of glucose consumption was almost a constant. Gas stripping is a simple but efficient technique to minimize butanol inhibition, improve fermentation performance, and facilitate butanol recovery without disrupting cell culture, nutrient supply, and intermediate product accumulation. In addition, gas tripping also has a couple of advantages over other separation techniques, including easier operation, lower capital investment and energy input, no requirement of extra steps and chemicals, ability to operate under fermentation temperature, and flexibility in solids removal. Finally, various cellulosic and lignocellulosic materials including cassava bagasse, Jerusalem artichoke, cotton stalk, sugarcane bagasse, soybean hull, and corn fiber were considered as alternative feedstocks for high-titer, high-yield, and cost-effective butanol production by metabolically engineered C. tyrobutyricum in both free-cell and immobilized-cell fermentations. A stable butanol production with a titer over 15.0 g/l, a yield over 0.30 g/g, and a productivity over 0.30 g/l/h with a steady long-term performance was successfully achieved during the repeated-batch fermentation using CBH and CSH as substrates, which was comparable to the control with glucose as a substrate. In addition, the generation of ethanol and acetate, two major by-products, was almost completely eliminated by the addition of artificial electron carriers with no 282

312 observed accumulation of ethanol and acetate. Moreover, a rapid consumption of glucose along with a sharp increase in butanol production was observed in each repeated-batch with less than 10.0 g/l residual glucose remaining unfermented in the fermentation broth, providing high substrate utilization efficiency. Synchronized utilization of glucose and xylose was also observed during the repeated-batch fermentation with CSH, SBH, SHH, and CFH as a substrate with distinct xylose consumption rates due to significantly different glucose/xylose ratios in different biomass hydrolysates. It was also confirmed that corn steep liquor as a superior complex nutritional source can not only stimulate cell growth and metabolism and support high cell density by providing rich nitrogen nutrients, but also improve cell viability and facilitate cell survival during stressful culture conditions by removing inhibitory compounds and detoxifying the production medium. However, it should be noted that distinct fermentation performances with significant variations in butanol titer, yield, and productivity using different biomass hydrolysates as substrates were observed in both free-cell and immobilized-cell fermentations, which might be caused by the fact that distinct compositions and concentrations of various components are released during the pretreatment and hydrolysis process of these materials. Nevertheless, this is the first report on high-titer, high-yield, and cost-effective butanol production from abundant, renewable, and inexpensive raw materials via a heterologous butanol production platform in C. tyrobutyricum. 7.2 Recommendations In order to make fermentative butanol production more economically competitive and replace current petroleum-based transportation fuels, substantial efforts on both strain improvement and process development are needed. For strain improvement, since 283

313 promoter plays an important role in controlling the expression levels of specific genes, utilization of stronger promoters with more specific roles and higher enzyme activities to replace the native promoter thl might be a promising strategy to improve butanol production in butanol-producing C. tyrobutyricum mutants. The most attractive candidate is the sol promoter from C. acetobutylicum sol operon (adhe is a part of this operon), which is responsible for producing solvents in solventogenic clostridia [Fischer et al., 1993; Nolling et al., 2001]. Another interesting candidate is the phosphotransbutyrylase (ptb) promoter, from C. acetobutylicum ptb-buk operon, because previous studies have demonstrated that the expression levels from ptb promoter were significantly higher than those from other promoters, such as sol promoter and thl promoter [Tummala et al., 1999; Feustel et al., 2004; Sillers et al., 2008; Heap et al., 2007]. Double knock-out of both acetate and butyrate synthesis pathways in C. tyrobutyricum has a potential to improve butanol yield by directing more carbon flux towards butanol synthesis pathway. The recently developed ClosTron gene knockout system has made directed mutagenesis of specific genes in clostridium species easier, faster, more stable and reliable [Heap et al., 2010]. Actually, they have developed a standardized modular system for Clostridium-Escherichia coli shuttle plasmids, which provides various replicons, different selection markers, a multiple cloning site, and blue/white screening methods, as shown in Figure 2.4 [Heap et al., 2009]. By using flippase-mediated marker rescue system, developing clostridial mutants with multiple knockouts of targeted genes can be easily realized [Heap et al., 2010]. However, the production of acetic and butyric acids cannot be completely eliminated in the double knockout mutants due to the presence of some unknown pathways which can synthesize acetate and butyrate. It has 284

314 been reported that instead of using phosphotransbutyrylase (PTB) and butyrate kinase (BK), two key enzymes involved in butyrate synthesis pathways, high-level butyrate can be produced via butyryl-coa: acetate-coa transferase [Duncan et al., 2002]. Two CoA transferase genes that present high homology with butyryl-coa: acetate-coa transferase gene have been identified in C. tyrobutyricum genome. It has been demonstrated that both of them can convert coenzyme A between acetate and other fatty acids including butyrate, suggesting that these two CoA-transferases most likely also play a critical role in butyrate synthesis in C. tyrobutyricum. A study on inactivation or overexpression of these two genes and their effects on fermentation kinetics can be helpful to better understand the metabolic regulation and carbon flux distribution in C. tyrobutyricum and thus develop effective strategies to improve butanol production. It is well-known that heterologous expression of adhe2 gene in C. tyrobutyricum is highly dependent on the availability of NADH and NADH/NAD + ratio [Nair et al., 1994; Fontaine et al., 2002; Girbal and Soucaille, 1994]. Adequate NADH supply is the prerequisite for high titer and high yield butanol synthesis, since four molecules of NADH are needed to make one molecule butanol from glucose [Shen et al., 2011, Yu et al., 2011]. However, NADH availability in bacteria is balanced by ferredoxin/hydrogenase or other hydrogenases with hydrogen generation, which means less NADH will be available if more hydrogen was generated and vice versa [Lutke- Eversloh and Bahl, 2011]. Therefore, in order to direct more carbon flux towards butanol synthesis pathway, reduced ferredoxin (FdH2) must be used to generate NADH, instead of H2. A promising strategy to achieve this goal is to inactivate ferredoxin/hydrogenase activity to inhibit hydrogen generation, so that the redox balance will be pushed towards 285

315 NADH accumulation [Junelles et al., 1988; Peguin et al., 1995; Nakayama et al., 2008]. In order to achieve redox balance, more carbon flux will be directed to produce butanol, the most reducing end-product during the metabolic pathways, for the regeneration of NAD +. Another promising target gene that directly related to NAD + /NADH balance is formate dehydrogenase gene (fdh), which is responsible for regenerating NADH from NAD +. Formate dehydrogenase can catalyze the oxidation of formate to CO 2 and the simultaneous reduction of NAD + to NADH [Berrios-Rivera et al., 2002; Tishkov and Popov, 2006]. This reaction can be considered as irreversible because of the release of CO 2 into the atmosphere. Basically, gene fdh can be divided into two types, NAD + - independent and NAD + -dependent [Berrios-Rivera et al., 2002]. NAD + -dependent formate dehydrogenase will be considered because it is one of the best enzymes for NADH regeneration [Burton, 2003; Liese, 2005; Wichmann and Vasic-Racki, 2005; Tishkov and Popov, 2006]. Previous studies have demonstrated that a significant improvement in NADH availability (from 2 to 4 mol NADH/mol glucose consumed) was observed by the overexpression of NAD + -dependent fdh in various host cells [Berrios- Rivera et al., 2002; Lu et al., 2010; Shen et al., 2011]. Significant changes in metabolites concentration and distribution favorable for accumulation of more reduced products in these host cells were also observed due to the altered metabolic flux [Berrios-Rivera et al., 2002a; Berrios-Rivera et al., 2002b; Berrios-Rivera et al., 2004; Lu et al., 2010]. For process development, developing hyper-butanol-tolerant C. tyrobutyricum mutants via adaptation and evolution in FBB seems to be a very promising strategy to significantly improve butanol production. By using a repeated-batch fermentation mode, 286

316 the adapted cells are forced to contact with gradually increased butanol concentrations, which in turn could provide a selection pressure to drive the evolution towards higher butanol titers. As a result, cells with high butanol-tolerating ability will survive and weakened and dead cells killed by the high butanol stress will be washed out from the FBB system. Also, as a non-directed mutagenesis and evolution, it does not require extensive information at metabolic and physiological levels and is not dependent on available genetic modifications and functional knowledge. Once the FBB adaptation process is completed, the remaining cells in the fibrous bed will be washed down, collected, and then plated. Single colonies on the plates will be selected and cultured in serum bottles to identify and isolate C. tyrobutyricum mutants with high butanoltolerating and butanol-producing ability. In fact, through this strategy, a hyper-butanoltolerant and production mutant, C. acetobutylicum JB200, which can produce 21 g/l butanol in free-cell fermentation and up to 28.2 g/l butanol in immobilized-cell fermentation was screened, isolated, and identified. However, the maintenance of the superior abilities such as high butanol tolerance and butanol production rate of the mutants developed via adaptation and evolution is very difficult because they are very likely to lose their acquired abilities during subculture. The combination of adaptive mutagenesis and metabolic engineering might provide a better approach to develop hyper butanol-tolerant clostridial mutants with more stable and reliable performance. In addition to gas stripping, development of advanced separation techniques that can efficiently remove butanol from fermentation broth without disrupting cell culture, nutrient supply, and intermediate product accumulation and realize effective butanol recovery with low capital investment, energy input, and operation cost is desirable. 287

317 Recently, considerable research efforts have been put on improving the process performance of pervaporation, a membrane-based separation technique, which can allow volatile species to diffuse through the membrane, evaporate into permeate, and finally be condensed in cooling trap [Vane, 2005; 2008; Thongsukmak and Sirkar, 2007]. Since the performance of pervaporation is highly dependent on the choice of membranes, development of advanced membranes that have high butanol selectivity, high butanol recovery efficiency, and low cost with a stable and reliable characteristic during a longterm operation has become the primary objective. However, a number of inherent limitations including loss of nutrients and fermentation intermediate products, membrane fouling, complexity in operation, and high equipment investments might greatly obstruct the wide use of this advanced separation method. During the pretreatment and enzymatic hydrolysis process of lignocellulosic materials, numerous inhibitory compounds such as furfural, furan, acetic, ferulic, glucuronic, p- coumaric acids, phenolic compounds, and aldehydes are usually released, which can severely affect cell growth and metabolism, substrate utilization efficiency, as well as fermentation performance [Ezeji et al., 2007; Jang et al., 2012]. The generation of inhibitors from lignocellulosic materials is usually pretreatment and substrate specific. Currently, steam explosion liquid hot water pretreatment, ammonia fiber explosion, acid pretreatment, as well as alkaline pretreatment are commonly used pretreatment techniques to release fermentable sugars with less inhibitory compounds and lower concentrations generated during thermal pretreatments than those in acid and alkaline pretreatments [Ezeji et al., 2010]. In order to improve substrate utilization efficiency and make lignocellulosic butanol more economically competitive, development of advanced 288

318 pretreatment and hydrolysis processes that can significantly reduce the generation of inhibitory compounds has become more and more attractive. In addition, development of superior microbes that can tolerate lignocellulosic materials derived inhibitors provides another promising strategy to overcome the poor fermentation performance with lignocellulosic feedstocks as substrates [Jang et al., 2012]. Moreover, a further investigation on the typical inhibitory compounds and their effects on fermentation kinetics could be beneficial to better understand the fundamental mechanisms for the distinct fermentation performances with different biomass hydrolysates and thus develop better strategies to improve fermentative butanol production. Controlling oxidoreduction potential (ORP) of the fermentation process via redox engineering is another possible approach to improve butanol production by diverting the native electron flow and redirecting carbon flux towards butanol synthesis pathway. ORP is an important physicochemical parameter that can reflect the oxidative or reductive property of a specific chemical. The ORP of a culture medium is usually determined by the compositions and concentrations of various components presented in the medium, which means different medium formula usually have different ORP range [Wang et al., 2012]. It has been reported that different microbes usually requires different optimal ORP for cell growth and metabolism, and medium ORP has a profound impact on cell activities and product profiles [Wang et al., 2012]. In a recent study by controlling the ORP of the fermentation broth at -290 mv, an earlier initiation of solventogenesis with an improved solvent production and dramatically changed product patterns was observed in C. acetobutylicum [Wang et al., 2012]. Wietzke and Bahl investigated the function of a redox sensing transcriptional repressor Rex and revealed its important role in the 289

319 metabolic shift in C. acetobutylicum ATCC 824 [Wietzke and Bahl, 2012]. Higher amounts of ethanol and butanol with an earlier initiation of solvents formation was successfully achieved in the Rex-negative mutant [Wietzke and Bahl, 2012]. They also found that Rex was closely coupled with the expression of butanol biosynthetic genes and the cellular NADH/NAD + ratio, both of which play an essential role in controlling butanol synthesis [Wietzke and Bahl, 2012]. By manipulating the native redox cofactor regeneration system in E. coli, Lim et al. successfully achieved high-yield production of butyric acid from glucose in a heterologous platform, indicating the important roles of redox in controlling electron flow and carbon flux distribution [Lim et al., 2013]. Therefore, enhanced butanol production with very high butanol titer, yield, and productivity might be realized through redox engineering of C. tyrobutyricum. 7.3 References Berrios-Rivera SJ, Bennett GN, San KY. 2002a. The effect of increasing NADH availability on the redistribution of metabolic fluxes in Escherichia coli chemostat cultures. Metab Eng 4: Berrios-Rivera SJ, Bennett GN, San KY. 2002b. Metabolic engineering of Escherichia coli: increase of NADH availability by overexpressing an NAD + dependent formate dehydrogenase. Metab Eng 4: Berrios-Rivera SJ, Sanchez AM, Bennett GN, San KY Effect of different levels of NADH availability on metabolite distribution in Escherichia coli fermentation in minimal and complex media. Appl Microbiol Biotechnol 65: Burton SG Oxidizing enzymes as biocatalysts. Trends Biotechnol 21: Duncan SH, Barcenilla A, Stewart CS, Pryde SE, Flint HJ Acetate utilization and butyryl coenzyme A (CoA): acetate-coa transferase in butyrate-producing bacteria from the human large intestine. Appl Environ Microbiol 68: Ezeji T, Milne C, Price ND, Blaschek HP Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl Microbiol Biotechnol 85:

320 Ezeji TC, Qureshi N, Blaschek HP Butanol production from agricultural residues: Impact of degradation products on Clostridium beijerinckii growth and butanol fermentation. Biotechnol Bioeng 97: Feustel L, Nakotte S, Durre P Characterization and development of two reporter gene systems for Clostridium acetobutylicum. Appl Environ Microbiol 70: Fischer RJ, Helms J, Durre P Cloning, sequencing, and molecular analysis of the sol operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J Bacteriol 175: Fontaine L, Meynial-Salles I, Girbal L, Yang XH, Croux C, Soucaille P Molecular characterization and transcriptional analysis of adhe2, the gene encoding the NADHdependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol 184: Girbal L, Soucaille P Regulation of Clostridium acetobutylicum metabolism as revealed by mixed-substrate steady-state continuous cultures: role of NADH/NAD + ratio and ATP pool. J Bacteriol 176: Heap JT, Kuehne SA, Ehsaan M, Cartman ST, Cooksley CM, Scott JC, Minton NP The ClosTron: mutagenesis in Clostridium refined and streamlined. J Microbiol Methods 80: Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP The clostron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods 70: Heap JT, Pennington OJ, Cartman ST, Minton NP A modular system for Clostridium shuttle plasmids. J Microbiol Methods 78: Jang YS, Malaviya A, Cho C, Lee J, Lee SY Butanol production from renewable biomass by clostridia. BioresourcTechnol 123: Junelles AM, Janiti-Idrissi R, Petitdemange H, Gay R Iron effect on acetonebutanol fermentation. Curr Microbiol 17: Liese A Technical application of biological principles in asymmetric catalysis. Adv Biochem Eng/Biotechnol 92: Lim JH, Seo SW, Kim SY, Jung GY Refactoring redox cofactor regeneration for high-yield biocatalysis of glucose to butyric acid in Escherichia coli. Bioresour Technol 135: Lu Y, Zhao H, Zhang C, Lai Q, Wu X, Xing XH Alteration of hydrogen metabolism of ldh-deleted Enterobacter aerogenes by overexpression of NAD(+)- dependent formate dehydrogenase. Appl Microbiol Biotechnol 86:

321 Lutke-Eversloh T, Bahl H Metabolic engineering of Clostridium acetobutylicum: recent advances to improve butanol production. Curr Opin Biotechnol 22: Nair RV, Bennett GN, Papoutsakis ET Molecular characterization of an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC 824. J Bacteriol 176: Nakayama S, Kosaka T, Hirakawa H, Matsuura K, Yoshino S, Furukawa K Metabolic engineering for solvent productivity by downregulation of the hydrogenase gene cluster hupcba in Clostridium saccharoperbutylacetonicum strain N1-4. Appl Microbiol Biotechnol 78: Nolling J, Breton G, Omelchenko MV, Makarova KS, Zeng Q, Gibson R, Lee HM, Dubois J, Qiu D, Hitti J, Wolf YI, Tatusov RL, Sabathe F, Doucette-Stamm L, Soucaille P, Daly MJ, Bennett GN, Koonin EV, Smith DR Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J Bacteriol 183: Peguin S, Soucaille P Modulation of carbon and electron flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl Environ Microbiol 61: Shen CR, Lan EI, Dekishima Y, Baez A, Cho KM, Liao JC Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl Environ Microbiol 77: Sillers R, Chowb A, Tracy B, Papoutsakis ET Metabolic engineering of the nonsporulating, non-solventogenic Clostridium acetobutylicum strain M5 to produce butanol without acetone demonstrate the robustness of the acid-formation pathways and the importance of the electron balance. Metab Eng 10: Thongsukmak A, Sirkar KK Pervaporation membranes highly selective for solvents present in fermentation broth. J Memb Sci 302: Tishkov VI, Popov VO Protein engineering of formate dehydrogenase. Biomol Eng 23: Tummala SB, Welker NE, Papoutsakis ET Development and characterization of a gene expression reporter system for Clostridium acetobutylicum ATCC824. Appl Environ Microbiol 65: Vane LM Review: A review of Pervaporation for product recovery from biomass fermentation processes. J Chem Technol Biotechnol 80: Vane LM Separation technologies for the recovery and dehydration of alcohols from fermentation broths. Biofuels Bioprod Bioref 2:

322 Wang S, Zhu Y, Zhang Y, Li Y Controlling the oxidoreduction potential of the culture of Clostridium acetobutylicum leads to an earlier initiation of solventogenesis, thus increasing solvent productivity. Appl Microbiol Biotechnol 93: Wichmann R, Vasic-Racki D Cofactor regeneration at the lab scale. Adv Biochem Eng/Biotechnol 92: Wietzke M, Bahl H The redox-sensing protein Rex, a transcriptional regulator of solventogenesis in Clostridium acetobutylicum. Appl Microbiol Biotechnol 96: Yu M, Zhang Y, Tang IC, Yang ST Metabolic engineeringof Clostridium tyrobutyricum for n-butanol production. Metab Eng 13:

323 Bibliography Adams MWW, Mortenson LE The physical and catalytic properties of hydrogenase II of Clostridium pasteurianum. A comparison with hydrogenase I. J Biol Chem 259: Alemdar A, Sain M Isolation and characterization of nanofibers from agricultural residues - wheat straw and soy hulls. Bioresour Technol 99: Alsaker KV, Paredes C, Papoutsakis ET Metabolite stress and tolerance in the production of biofuels and chemicals: gene-expression based systems analysis of butanol, butyrate and acetate stresses in the anaerobe Clostridium acetobutylicum. Biotechnol Bioeng 105: Alsaker KV, Spitzer TR, Papoutsakis ET Transcriptional analysis of spo0a over expression in Clostridium acetobutylicum and its effect on the cell's response to butanol stress. J Bacteriol 186: Al-Shorgani NK, Kalil MS, Yusoff WM Biobutanol production from rice bran and de-oiled rice bran by Clostridium saccharoperbutylacetonicum N1-4. Bioproc Biosyst Eng 35: Andrade JC, Vasconcelos I Continuous cultures of Clostridium acetobutylicum: culture stability and low-grade glycerol utilisation. Biotechnol Lett 25: Atsumi S, Cann AF, Connor MR, Shen CR, Smith KM, Brynildsen MP, Chou KJY, Hanai T, Liao JC Metabolic engineering of Escherichia coli for 1-butanol production. Metab Eng 10: Atsumi S, Hanai T, Liao JC Non-fermentative pathways for synthesis of branchedchain higher alcohols as biofuels. Nature 451: Atsumi S, Liao JC Metabolic engineering for advanced biofuel production from Escherichia coli. Curr Opin Biotechnol 19: Baer SH, Blaschek HP, Smith TL Effect of butanol challenge and temperature on lipid composition and membrane fluidity of butanol-tolerant Clostridium acetobutylicum. Appl Environ Microbiol 53: Bahl H, Andersch W, Gottschalk G Continuous production of acetone and butanol by Clostridium acetobutylicum in a two stage phosphate limited chemostat. Eur J Appl Microbiol Biotechnol 15:

324 Berezina OV, Zakharova NV, Brandt A, Yarotsky SV, Schwarz WH, Zverlov VV Reconstructing the clostridial n-butanol metabolic pathway in Lactobacillus brevis. Appl Microbiol Biotechnol 87: Berrios-Rivera SJ, Bennett GN, San KY. 2002a. The effect of increasing NADH availability on the redistribution of metabolic fluxes in Escherichia coli chemostat cultures. Metab Eng 4: Berrios-Rivera SJ, Bennett GN, San KY. 2002b. Metabolic engineering of Escherichia coli: increase of NADH availability by overexpressing an NAD + dependent formate dehydrogenase. Metab Eng 4: Berrios-Rivera SJ, Sanchez AM, Bennett GN, San KY Effect of different levels of NADH availability on metabolite distribution in Escherichia coli fermentation in minimal and complex media. Appl Microbiol Biotechnol 65: Blaschek H, Annous B, Formanek J, Chen CK Method of producing butanol using a mutant strain of Clostridium beijerinckii. US patent 6,358,717. Bond-Watts BB, Bellerose RJ, Chang MCY Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways. Nat Chem Biol 7: Borden JR, Papoutsakis ET Dynamics of genomic-library enrichment and identification of solvent tolerance genes for Clostridium acetobutylicum. Appl Environ Microbiol 73: Bose BK Global warming: energy, environmental pollution, and the impact of power electronics. Industrial Electronics Magazine, IEEE 4:6-17. Boynton Z, Bennett G, Rudolph R Cloning, sequencing, and expressing of genes encoding phosphotransacetylase and acetate kinase from C. acetobutylicum ATCC824. Appl Environ Microbiol 62: Branduardi P, Longo V, Berterame NM, Rossi G, Porro D A novel pathway to produce butanol and isobutanol in Saccharomyces cerevisiae. Biotechnol Biofuels 6: Burton SG Oxidizing enzymes as biocatalysts. Trends Biotechnol 21: Buschke N, Schroder H, Wittmann C Metabolic engineering of Corynebacterium glutamicum for production of 1,5-diaminopentane from hemicellulose. Biotechnol. J. 6: Cai G, Jin B, Saintd C, Monisc P Genetic manipulation of butyrate formation pathways in Clostridium butyricum. J Biotechnol 155: Cascone R Biobutanol-A replacement for bioethanol? Chem Eng Prog 104:S4-S8. 295

325 Chen F, Feng X, Liang J, Xu H, Ouyang P An oxidoreduction potential shift control strategy for high purity propionic acid production by Propionibacterium freudenreichii CCTCC M with glycerol as sole carbon source. Bioprocess Biosyst Eng DOI: /s Chen F, Feng X, Xu H, Zhang D, Ouyang P Propionic acid production in a plant fibrous-bed bioreactor with immobilized Propionibacterium freudenreichii CCTCC M Biotechnol J 164: Chen J, Chen H, Zhu X, Lu Y, Yang ST, Xu Z, Cen P Long-term production of soluble human Fas ligand through immobilization of Dictyostelium discoideum in a fibrous bed bioreactor. Appl Microbiol Biotechnol 82: Chen W, Chen Y, Lin J Evaluation of biobutanol production from non-pretreated rice straw hydrolysate under non-sterile environmental conditions. Bioresour Technol 135: Chen Y, Liu Q, Zhou T, Li B, Yao S, Wu J, Ying H Ethanol production by repeated batch and continuous fermentations by Saccharomyces cerevisiae immobilized in a fibrous bed bioreactor. J Microbiol Biotechnol 23: Cherepanov PP, Wackernagel W Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene, 158: Choi J, Jang YS, Cho JH, Seung D, Lee SY, Papoutsakis ET, Bennett GN, Song H Characterization and evaluation of corn steep liquid in acetone-butanol-ethanol production by Clostridium acetobutylicum. Biotechnol Bioprocess Eng 18: Claassen PAM, Budde MAW, Contreras AML Acetone, butanol and ethanol production from domestic organic waste by solventogenic Clostridia. J Microbiol Biotechnol 2: Cooksley CM, Zhang Y, Wang HZ, Redl S, Winzer K, Minton NP Targeted mutagenesis of the Clostridium acetobutylicum acetone-butanol-ethanol fermentation pathway. Metab Eng 14: Datta R, Zeikus JG Modulation of acetone butanol ethanol fermentation: utilization of carbon monoxide to inhibit hydrogen production and to enhance butanol yields. Appl Environ Microbiol 48: de Vrije T, Budde M, van der Wal H, Claassen PAM, Lopez-Contreras AM "In situ" removal of isopropanol, butanol and ethanol from fermentation broth by gas stripping. Bioresour Technol 137: Dellomonaco C, Fava F, Gonzalez R The path for next generation biofuels: successes and challenges in the era of synthetic biology. Microb Cell Fact 9:

326 Doremus MG, Linden JC, Moreira AR Agitation and pressure effect on acetone butanol fermentation. Biotechnol Bioeng 27: Du T, He A, Wu H, Chen J, Kong X, Liu J, Jiang M, Ouyang P Butanol production from acid hydrolyzed corn fiber with Clostridium beijerinckii mutant. Bioresour Technol 135: Duncan SH, Barcenilla A, Stewart CS, Pryde SE, Flint HJ Acetate utilization and butyryl coenzyme A (CoA): acetate-coa transferase in butyrate-producing bacteria from the human large intestine. Appl Environ Microbiol 68: Durre P, Bohringer M, Nakotte S, Schaffer S, Thormann K, Zickner B Transcriptional regulation of solventogenesis in Clostridium acetobutylicum. J Mol Microbiol Biotechnol 4: Durre P, Kuhn A, Gottwald M, Gottschalk G Enzymatic investigationson butanol dehydrogenase and butyraldehyde dehydrogenase in extracts of Clostridium acetobutylicum. Appl Microbiol Biotechnol 26: Durre P Biobutanol: An attractive biofuel. Biotechnol J 2: Dwidar M, Kim S, Jeon BS, Um Y, Mitchell RJ, Sang BI Co-culturing a novel Bacillus strain with Clostridium tyrobutyricum ATCC to produce butyric acid from sucrose. Biotechnol Biofuels 6: Earle MJ, Seddon KR Ionic liquids. Green solvents for the future. Pure Appl Chem 72: Emerson JE, Reynolds CB, Fagan RP, Shaw HA, Goulding D, Fairweather NF A novel genetic switch controls phase variable expression of CwpV, a Clostridium difficile cell wall protein. Mol Microbiol 74: Evans PJ, Wang HY Enhancement of butanol formation by Clostridium acetobutylicum in the presence of decanol-oleyl alcohol mixed extractants. Appl Environ Microbiol 54: Ezeji T, Blaschek HP Fermentation of dried distillers' grains and solubles (DDGS) hydrolysates to solvents and value-added products by solventogenic clostridia. Bioresour Technol 99: Ezeji T, Milne C, Price ND, Blaschek HP Achievements and perspectives to overcome the poor solvent resistance in acetone and butanol-producing microorganisms. Appl Microbiol Biotechnol 85: Ezeji T, Qureshi N, Blaschek HP. 2007a. Production of acetone-butanol-ethanol (ABE) in a continuous flow bioreactor using degermed corn and Clostridium beijerinckii. Process Biochem 42:

327 Ezeji TC, Qureshi N, Blaschek HP Production of butanol by Clostridium beijerinckii BA101 and in-situ recovery by gas stripping. World J Microbiol Biotechnol 19: Ezeji TC, Qureshi N, Blaschek HP. 2004a. Acetone butanolethanol (ABE) production from concentrated substrate: Reduction in substrate inhibition by fed-batch technique and product inhibition by gas stripping. Appl Microbiol Biotechnol 63: Ezeji TC, Qureshi N, Blaschek HP. 2004b. Butanol fermentation research: upstream and downstream manipulations. Chem Rec 4: Ezeji TC, Qureshi N, Blaschek HP. 2007b. Butanol production from agricultural residues: Impact of degradation products on Clostridium beijerinckii growth and butanol fermentation. Biotechnol Bioeng 97: Ezeji TC, Qureshi N, Blaschek HP Microbial production of a biofuel (acetonebutanol-ethanol) in a continuous bioreactor: impact of bleed and simultaneous product removal. Bioproc Biosys Eng 36: Fadeev AG, Kelley SS, McMillan JD, Selinskaya Y, Khotimsky VS, Volkov VV Effect of yeast fermentation by-products on poly(1-trimethylsilyl-1-propyne) pervaporative performance. J Membr Sci 214: Fadeev AG, Meagher MM Opportunities for ionic liquids in recovery of biofuels. Chem Commun 34: Fadeev AG, Selinskaya Y, Kelley SS, Meagher MM, Litvinova EG, Khotimsky VS, Volkov VV Extraction of butanol from aqueous solutions by pervaporation through poly(1-trimethylsilyl-1-propyne). J Membr Sci 186: Feustel L, Nakotte S, Durre P Characterization and development of two reporter gene systems for Clostridium acetobutylicum. Appl Environ Microbiol 70: Fischer CR, Klein-Marcuschamer D, Stephanopoulos G Selection and optimization of microbial hosts for biofuels production. Metab Eng 10: Fischer RJ, Helms J, Durre P Cloning, sequencing, and molecular analysis of the sol operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J Bacteriol 175: Fontaine L, Meynial-Salles I, Girbal L, Yang XH, Croux C, Soucaille P Molecular characterization and transcriptional analysis of adhe2, the gene encoding the NADHdependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol 184:

328 Formanek J, Mackie R, Blaschek HP Enhanced butanol production by Clostridium beijerinckii BA101 grown in semidefined P2 medium containing 6 percent maltodextrin or glucose. Appl Environ Microbiol 63: Frazier CL, SanFilippo J, Lambowitz AM, Mills DA Genetic manipulation of Lactococcus lactis by using targeted group II introns: generation of stable insertions without selection. Appl Environ Microbiol 69: Garćia V, PäkkiläJ, Ojamo H, Muurinen E, Keiski RL Challenges in biobutanol production: How to improve the efficiency. Renew Sustain Ener Reviews 15: Ghim CM, Kim T, Mitchell RJ, Lee SK Synthetic biology for biofuels: Building designer microbes from the scratch. Biotechnol Bioproc Eng 15: Girbal L, Soucaille P Regulation of Clostridium acetobutylicum metabolism as revealed by mixed-substrate steady-state continuous cultures: role of NADH/NAD + ratio and ATP pool. J Bacteriol 176: Girbal L, Soucaille P Regulation of solvent production in Clostridium acetobutylicum. Trends Biotechnol 16:1-16. Girbal L, Vasconcelos I, Saint-Amans S, Soucaille P How neutral red modified carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph. FEMS Microbiol Rev 16: Green EM, Bennett GN Inactivation of an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC824. Appl Biochem Biotechnol 57: Green EM, Boynton ZL, Harris LM, Ruldolph FB, Papoutsakis ET, Bennett GN Genetic manipulation of acid formation pathways by gene inactivation in Clostridium acetobutylicum ATCC 824. Microbiology 142: Groot WJ, van der Lans RGJM, Luyben KCAM Technologies for butanol recovery integrated with fermentations. Proc Biochem 27: Grupe H, Gottschalk G Physiological events in Clostridium acetobutylicum during the shift from acidogenesis to solventogenesis in continuous culture and presentative of a model for shift induction. Appl Environ Microbiol 58: Guo T, He A, Du T, Zhu D, Liang D, Jiang M, Wei P, Ouyang P Butanol production from hemicellulosic hydrolysate of corn fiber by a Clostridium beijerinckii mutant with high inhibitor-tolerance. Bioresour Technol 135: Hagiwara R, Ito Y Room temperature ionic liquids of alkylimidazolium cations and fluoroanions. J Fluor Chem 105: Harris LM, Blank L, Desai RP, Welker NE, Papoutsakis ET Fermentation characterization and flux analysis of recombinant strains of Clostridium 299

329 acerobutylicum with an inactivated solr gene. J Ind Microbiol Biotechnol 27: Harris LM, Desai RP, Welker NE, Papoutsakis ET Characterization of recombinant strains of the Clostridium acetobutylicum butyrate kinase inactivation mutant: Need for new phenomenological models for solventogenesis and butanol inhibition? Biotechnol Bioeng 67:1-11. Harris LM, Welker NE, Papoutsakis ET Northern, morphological, and fermentation analysis of spo0a inactivation and overexpression in Clostridium acetobutylicum ATCC824. J Bacteriol 184: Haus S, Jabbari S, Millat T, Janssen H, Fischer RJ, Bahl H, King JR, Wolkenhauer O A systems biology approach to investigate the effect of ph-induced gene regulation on solvent production by Clostridium acetobutylicum in continuous culture. BMC Systems Biology 5: He Q, Chen H Improved efficiency of butanol production by absorbed lignocellulose fermentation. J Biosci Bioeng 115: Heap JT, Kuehne SA, Ehsaan M, Cartman ST, Cooksley CM, Scott JC, Minton NP The ClosTron: mutagenesis in Clostridium refined and streamlined. J Microbiol Methods 80: Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP The clostron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods 70: Heap JT, Pennington OJ, Cartman ST, Minton NP A modular system for Clostridium shuttle plasmids. J Microbiol Methods 78: Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP A broad-hostrange Flp-FRT recombination system for site-specific excision of chromosomallylocated DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212: Holtzapple MT, Brown RF Conceptual design for a process to recover volatile solutes from aqueous solutions using silicalite. Sep Technol 4: Howard RL, Abotsi E, Jansen van Rensburg EL, Howard S Lignocellulosic biotechnology: issues of bioconversion and enzyme production. African J Biotechnol 2: Huang J, Cai J, Wang J, Zhu X, Huang L, Yang ST, Xu Z Efficient production of butyric acid from Jerusalem artichoke by immobilized Clostridium tyrobutyricum in a fibrous-bed bioreactor. Bioresour Technol 102:

330 Huang WC, Ramey DE, Yang ST Continuous production of butanol by Clostridium acetobutylicum immobilized in a fibrous bed bioreactor. Appl Biochem Biotechnol 113: Hull SR, Yang BY, Venzke D, Kulhavy K, Montgomery R Composition of corn steep water during steeping. J Agric Food Chem 44: Inui M, Suda M, Kimura S, Yasuda K, Suzuki H, Toda H, Yamamoto S, Okino S, Suzuki N, Yukawa H Expression of Clostridium acetobutylicum butanol synthetic genes in Escherichia coli. Appl Microbiol Biotechnol 77: Jang YS, Malaviya A, Cho C, Lee J, Lee SY Butanol production from renewable biomass by clostridia. BioresourcTechnol 123: Janssen H, Döring C, Ehrenreich A, Voigt B, Hecker M, Bahl H, Fischer RJ A proteomic and transcriptional view of acidogenic and solventogenic steady-state cells of Clostridium acetobutylicum in a chemostat culture. Appl Microbiol Biotechnol 87: Janssen H, Grimmler C, Ehrenreich A, Bahl H, Fischer RJ A transcriptional study of acidogenic chemostat cells of Clostridium acetobutylicum-solvent stress caused by a transient n-butanol pulse. Biotechnol J 161: Jesse TW, Ezeji TC, Qureshi N, Blaschek HP Production of butanol from starchbased waste packing peanuts and agricultural waste. J Ind Microbiol Biotechnol 29: Jia K, Zhu Y, Zhang Y, Li Y Group II Intron-Anchored Gene Deletion in Clostridium. Plos one 6:1-10. Jiang L, Li S, Hu Y, Xu Q, Huang H Adaptive evolution for fast growth on glucose and the effects on the regulation of glucose transport system in Clostridium tyrobutyricum. Biotechnol Bioeng 109: Jiang L, Wang J, Liang S, Cai J, Xu Z, Cen P, Yang S, Li S Enhanced butyric acid tolerance and bioproduction by Clostridium tyrobutyricum immobilized in a fibrous bed bioreactor. Biotechnol Bioeng 108: Jiang L, Wang J, Liang S, Wang X, Cen P, Xu Z Butyric acid fermentation in a fibrous bed bioreactor with immobilized Clostridium tyrobutyricum from cane molasses. Bioresour Technol 100: Jiang L, Wang J, Liang S, Wang X, Cen P, Xu Z Production of Butyric Acid from Glucose and Xylose with Immobilized Cells of Clostridium tyrobutyricum in a Fibrous-bed Bioreactor. Appl Biochem Biotechnol 1602:

331 Jo JH, Lee DS, Park JM The effects of ph on carbon material and energy balances in hydrogen-producing Clostridium tyrobutyricum JM1. Bioresour Technol 99: Jones DT, Woods DR Acetone butanol fermentation revisited. Microbiol Rev 50: Junelles AM, Janiti-Idrissi R, Petitdemange H, Gay R Iron effect on acetonebutanol fermentation. Curr Microbiol 17: Karberg, M., Guo, H., Zhong, J., Coon, R., Perutka, J., Lambowitz, A.M., Group II introns as controllable gene targeting vectors for genetic manipulation of bacteria. Nat. Biotechnol. 19: Kilonzo PM, Margaritis A, Bergougnou MA Repeated-batch production of glucoamylase using recombinant Saccharomyces cerevisiae immobilized in a fibrous bed bioreactor. J Ind Microbiol Biotechnol 37: Kim TS, Kim BH Electron flow shift in Clostridium acetobutylicum fermentation by electrochemically introduced reducing equivalent. Biotechnol Lett 10: Kirby JM, Ahern H, Roberts AK, Kumar V, Freeman Z, Acharya KR, Shone CC Cwp84, a surface-associated, cysteine protease, plays a role in the maturation of the surface layer of Clostridium difficile. J Biol Chem 284: Knoshaug EP, Zhang M Butanol tolerance in a selection of microorganisms. Appl Biochem Biotechnol 153: Kuit W, Minton NP, López-Contreras AM, Eggink G Disruption of the acetate kinase (ack) gene of Clostridium acetobutylicum results in delayed acetate production. Appl Microbiol Biotechnol 94: Kumar M, Gayen K Developments in biobutanol production: New insights. Appl Energy 88: Lan IE, Liao JC Metabolic engineering of cyanobacteria for 1-butanol production from carbon dioxide. Metab Eng13: Lan TQ, Wei D, Yang ST, Liu X Enhanced cellulase production by Trichoderma viride in a rotating fibrous bed bioreactor. Bioresour Technol 133: Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung SK Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: Lehmann D, Hönicke D, Ehrenreich A, Schmidt M, Weuster-Botz D, Bahl H, Lütke- Eversloh T Modifying the product pattern of Clostridium acetobutylicum: Physiological effects of disrupting the acetate and acetone formation pathways. Appl Microbiol Biotechnol 94:

332 Lepage C, Fayolle F, Hermann M, Vandecasteele JP Changes in membrane lipid composition of Clostridium acetobutylicum during acetone-butanol fermentation: effects of solvents, growth temperature and ph. J Gen Microbiol 133: Li H, Luo W, Gu Q, Wang Q, Hu W, Yu X Acetone, butanol, and ethanol production from cane molasses using Clostridium beijerinckii mutant obtained by combined low-energy ion beam implantation and N-methyl-N-nitro-Nnitrosoguanidine induction. Bioresour Technol 137: Li S, Tuan VA, Falconer JL, Noble RD Properties and separation performance of Ge-ZSM-5 membranes. Micropor Mesopor Mater 58: Li SY, Srivastava R, Parnas RS Separation of 1-butanol by pervaporation using novel tri-layer PDMS composite membrane. J Membr Sci 363: Liang ZX, Li L, Li S, Cai Y-H, Yang ST, Wang JF Enhanced propionic acid production from Jerusalem artichoke hydrolysate by immobilized Propionibacterium acidipropionici in a fibrous-bed bioreactor. Bioproc Biosys Eng 35: Liese A Technical application of biological principles in asymmetric catalysis. Adv Biochem Eng/Biotechnol 92: Lim JH, Seo SW, Kim SY, Jung GY Refactoring redox cofactor regeneration for high-yield biocatalysis of glucose to butyric acid in Escherichia coli. Bioresour Technol 135: Lin YL, Blaschek HP Butanol production by a butanol-tolerant strain of Clostridium acetobutylicum in extruded corn broth. Appl Environ Microbiol 45: Linggang S, Phang LY, Wasoh H, Abd-Aziz S Acetone-Butanol-Ethanol Production by Clostridium acetobutylicum ATCC 824 Using Sago Pith Residues Hydrolysate. Bioenergy Research 6: Liu S, Qureshi N How microbes tolerate ethanol and butanol. New Biotechnol 26: Liu X, Zhu Y, Yang ST. 2006a. Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Progr 22: Liu X, Zhu Y, Yang ST. 2006b. Butyric acid and hydrogen production by Clostridium tyrobutyricum ATCC and mutants. Enz Microb Technol 38: Liu XG, Yang ST. 2006c. Kinetics of butyric acid fermentation of glucose and xylose by Clostridium tyrobutyricum wild type and mutant. Process Biochem 41:

333 Lopez-Contreras AM, Claassen PA, Mooibroek H, De Vos WM, Utilization of saccharides in extruded domestic organic waste by Clostridium acetobutylicum ATCC 824 for production of acetone, butanol and ethanol. Appl Microbiol Biotechnol 54: Lu C, Zhao J, Yang ST, Wei D Fed-batch fermentation for n-butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour Technol 104: Lu C Butanol production from lignocellulosic feedstocks by acetone-butanolethanol fermentation with integrated product recovery. Ph.D. Thesis, The Ohio State University. Lutke-Eversloh T, Bahl H Metabolic engineering of Clostridium acetobutylicum: recent advances to improve butanol production. Curr Opin Biotechnol 22: Maddox IS The actone-butanol-ethanol fermentation: recent progress in technology. Genet Eng Rev 7: Mao S, Luo Y, Zhang T, Li J, Bao G, Zhu Y, Chen Z, Zhang Y, Li Y, Ma Y Proteome reference map and comparative proteomic analysis between a wild type Clostridium acetobutylicum DSM 1173 and its mutant with enhanced butanol tolerance and butanol yield. J Proteome Res 9: Meinecke B, Bertram J, Gottschalk G Purification and characterization of the pyruvate ferredoxin oxidoreductase from Clostridium acetobutylicum. Arch Microbiol 152: Meyer CL, Roos JW, Papoutsakis ET Carbon monoxide gasing leads to alcohol production and butyrate uptake without acetone formation in continuous cultures of Clostridium acetobutylicum. Appl Microbiol Biotechnol 24: Mohr G, Smith D, Belfort M, Lambowitz AM Rules for DNA target-site recognition by a lactococcal group II intron enable retargeting of the intron to specific DNA sequences. Genes Dev. 14: Mussatto SI, Roberto IC Alternatives for detoxification of diluted-acid lignocellulosic hydrolysates for use in fermentative processes: a review. Bioresour Technol 93:1-10. Naik SN, Goud VV, Rout PK, Dalai AK Production of first and second generation biofuels: a comprehensive review. Renew Sustain Energy Rev 14: Nair RV, Bennett GN, Papoutsakis ET Molecular characterization of an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC 824. J Bacteriol 176:

334 Nair RV, Green EM, Watson DE, Bennett GN, Papoutsakis ET Regulation of the sol locus genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 by a putative transcriptional repressor. J Bacteriol 181: Nair RV, Papoutsakis ET Expression of plasmid-encoded aad in Clostridium acetobutylicum M5 restores vigorous butanol production. J Bacteriol 176: Nakayama S, Kosaka T, Hirakawa H, Matsuura K, Yoshino S, Furukawa K Metabolic engineering for solvent productivity by downregulation of the hydrogenase gene cluster hupcba in Clostridium saccharoperbutylacetonicum strain N1-4. Appl Microbiol Biotechnol 78: Naylor RL, Liska AJ, Burke MB, Falcon WP, Gaskell JC, Rozelle SD, Cassman KG The ripple effect: biofuels, food security, and the environment. Environ 49: Ni Y, Xia Z, Wang Y, Sun Z Continuous butanol fermentation from inexpensive sugar-based feedstocks by Clostridium saccharobutylicum DSM Bioresour Technol 129: Nicolaou SA, Gaida SM, Papoutsakis ET A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: From biofuels and chemicals, to biocatalysis and bioremediation. Metab Eng 12: Nielsen DR, Leonard E, Yoon SH, Tseng HC, Yuan C, Prather KLJ Engineering alternative butanol production platforms in heterologous bacteria. Metab Eng 11: Nielsen DR, Prather KJ In situ product recovery of n-butanol using polymeric resins. Biotechnol Bioeng 102: Nolling J, Breton G, Omelchenko MV, Makarova KS, Zeng Q, Gibson R, Lee HM, Dubois J, Qiu D, Hitti J, Wolf YI, Tatusov RL, Sabathe F, Doucette-Stamm L, Soucaille P, Daly MJ, Bennett GN, Koonin EV, Smith DR Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J Bacteriol 183: Oudshoorn A, van der Wielen LAM, Straathof AJJ. 2009a. Adsorption equilibria of biobased butanol solutions using zeolite. Biochem. Eng J 48: Oudshoorn A, van der Wielen LAM, Straathof AJJ. 2009b. Assessment of options for selective 1-butanol recovery from aqueous solution. Ind Eng Chem Res 48: Ouyang A, Yang ST A two-stage perfusion fibrous bed bioreactor system for mass production of embryonic stem cells. Expert Opin Biologic Therapy 8: Papoutsakis ET, Tomas CA, Tesic M, Santiago JY, Increased cell resistance to toxic organic substances. US Patent

335 Papoutsakis ET Engineering solventogenic clostridia. Curr Opin Biotechnol 19: Paredes C, Alsaker KV, Papoutsakis ET A comparative genomic view of clostridial sporulation and physiology. Nat Rev 3: Parekh M, Formanek J, Blaschek HP Pilot-scale production of butanol by Clostridium beijerinckii BA101 using a low-cost fermentation medium based on corn steep water. Appl Microbiol Biotechnol 51: Peguin S, Goma S, Delorme P, Soucaille P. 1994a. Metabolic flexibility of Clostridium acetobutylicum in response to methyl viologen. Appl Microbiol Biotechnol 42: Peguin S, Goma S, Delorme P, Soucaille P. 1994b. Enhanced alcohol yields in batch cultures of Clostridium acetobutylicum using a three-electrode potentiometric system with methyl viologen as electron carrier. Biotechnol Lett 16: Peguin S, Soucaille P Modulation of carbon and electron flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl Environ Microbiol 61: Peguin S, Soucaille P Modulation of metabolism of Clostridium acetobutylicum grown in chemostat culture in a three-electrode potentiostatic system with methyl viologen as electron carrier. Biotech Bioeng 51: Pierrot P, Fick M, Engasser JM Continuous acetone butanol fermentationwith high productivity by cell ultrafiltration and recycling. Biotech Lett 8: Pitkanen JP, Aristidou A, Salusjarvi L, Ruohonen L, Penttila M Metabolic flux analysis of xylose metabolism in recombinant Saccharomyces cerevisiae using continuous culture. Metab Eng 5: Purdy D, O Keeffe TAT, Elmore M, Herbert M, McLeod A, Bokori-Brown M, Ostrowski A, Minton NP Conjugative transfer of clostridial shuttle vectors from Escherichia coli to Clostridium difficile through circumvention of the restriction barrier. Mol Microbiol 46: Qureshi N, Blaschek HP Butanol production using Clostridium beijerinckii BA101 hyper-butanol producing mutant strain and recovery by pervaporation. Appl Biochem Biotechnol 86: Qureshi N, Ezeji TC, Ebener J, Dien BS, Cotta MA, Blaschek HP. 2008a. Butanol production by Clostridium beijerinckii. Part I. Use of acid and enzyme hydrolyzed corn fiber. Bioresour Technol 99: Qureshi N, Karcher P, Cotta M, Blaschek HP High productivity continuous biofilm reactor for butanol production. Appl Biochem Biotechnol :

336 Qureshi N, Maddox IS, Friedl A Application of continuous substrate feeding to the ABE fermentation: relief of product inhibition using extraction, perstraction, stripping and pervaporation. Biotechnol Prog 8: Qureshi N, Saha BC, Cotta MA Butanol production from wheat straw hydrolysate using Clostridium beijerinckii. Bioproc Biosys Eng 30: Qureshi N, Saha BC, Cotta MA. 2008c. Butanol production from wheat straw by simultaneous saccharification and fermentation using Clostridium beijerinckii: part II fed-batch fermentation. Biomass Bioenergy 32: Qureshi N, Saha BC, Dien B, Hector RE, Cotta MA. 2010b. Production of butanol (a biofuel) from agricultural residues: part I use of barley straw hydrolysate. Biomass Bioenergy 34: Qureshi N, Saha BC, Hector RE, Dien B, Hughes S, Liu S, Iten L, Bowman MJ, Sarath G, Cott MA. 2010a. Production of butanol (a biofuel) from agricultural residues: part II use of corn stover and switchgrass hydrolysates. Biomass Bioenergy 34: Qureshi N, Saha BC, Hector RE, Hughes SR, Cotta MA. 2008b. Butanol production from wheat straw by simultaneous saccharification and fermentation using Clostridium beijerinckii: part I batch fermentation. Biomass Bioenergy 32: Raganati F, Olivieri G, Procentese A, Russo ME, Salatino P, Marzocchella A Butanol production by bioconversion of cheese whey in a continuous packed bed reactor. Bioresour Technol 138: Ranganathan S, Maranas CD Microbial 1-butanol production: identification of non-native production routes and in silico engineering interventions. Biotechnol J 5: Rao G, Mutharasan R Alcohol production by Clostridium acetobutylicum induced by methyl viologen. Biotechnol Lett 8: Rao G, Mutharasan R Altered electron flow in continuous cultures of Clostridium acetobutylicum induced by viologen dyes. Appl Environ Microbiol 53: Razak MNA, Ibrahim MF, Yee PL, Hassan MA, Abd-Aziz S Statistical Optimization of Biobutanol Production from Oil Palm Decanter Cake Hydrolysate by Clostridium acetobutylicum ATCC 824. Bioresour 8: Sadowski PD The Flp recombinase of the 2-Mu-M plasmid of Saccharomyces cerevisiae. Prog Nucleic Acid Res Mol Biol, 51: Saha BC Hemicellulose bioconversion. J Ind Microbiol Biotechnol 30:

337 Sano T, Yanagishita H, Kiyouzumi Y, Mizukami F, Haraya H Sepation of ethanol/water mixture by silicalite membrane on pervaporation. J Membr Sci 95: Searchinger T, Heimlich R, Houghton RA, Dong F, Elobeid A, Fabiosa J, Tokgoz S, Hayes D, Yu TH Use of U.S. croplands for biofuels increases greenhouse gases through emissions from land-use change. Science 319: Shao L, Hu S, Yang Y, Gu Y, Chen J, Yang Y, Jiang W, Yang S Targeted gene disruption by use of a group II intron (targetron) vector in Clostridium acetobutylicum. Cell Research 17: Shen CR, Lan EI, Dekishima Y, Baez A, Cho KM, Liao JC Driving forces enable high-titer anaerobic 1-butanol synthesis in Escherichia coli. Appl Environ Microbiol 77: Shen CR, Liao JC Metabolic engineering of Escherichia coli for 1-butanol and 1- propanol production via the keto-acid pathways. Metab Eng 10: Shi Z, Blaschek HP Transcriptional analysis of Clostridium beijerinckii NCIMB 8052 and the hyper-butanol-producing mutant BA101 during the shift from acidogenesis to solventogenesis. Appl Environ Microbiol 74: Shi Z, Wei P, Zhu X, Cai J, Huang L, Xu Z Efficient production of L-lactic acid from hydrolysate of Jerusalem artichoke with immobilized cells of Lactococcus lactis in fibrous bed bioreactors. Enzyme Microb Technol 51: Shim H, Shin E, Yang ST A continuous fibrous-bed bioreactor for BTEX biodegradation by a coculture of Pseudomonas putida and Pseudomonas fluorescens. Adv Environ Res7: Shinto H, Tashiro Y, Kobayashi G, Sekiguchi T, Hanai T, Kuriya Y, Okamoto M, Sonomoto K Kinetic study of substrate dependency for higher butanol production in acetone-butanol-ethanol fermentation. Process Biochem 43: Sillers R, Chowb A, Tracy B, Papoutsakis ET Metabolic engineering of the nonsporulating, non-solventogenic Clostridium acetobutylicum strain M5 to produce butanol without acetone demonstrate the robustness of the acid-formation pathways and the importance of the electron balance. Metab Eng 10: Steen EJ, Chan R, Prasad N, Myers S, Petzold CJ, Redding A, Ouellet M, Keasling JD Metabolic engineering of Saccharomyces cerevisiae for the production of n- butanol. Microb Cell Fact 7:36. Survase SA, van Heiningen A, Granstrom T Wood pulp as an immobilization matrix for the continuous production of isopropanol and butanol. J Ind Microbiol Biotechnol 40:

338 Suwannakham S, Huang Y, Yang ST Construction and characterization of ack knock-out mutants of Propionibacterium acidipropionici for enhanced propionic acid fermentation. Biotechnol Bioeng 94: Suwannakham S, Yang ST Enhanced propionic acid fermentation by Propionibacterium acidipropionici mutant obtained by adaptation in a fibrous-bed bioreactor. Biotechnol Bioeng 91: Swana J, Yang Y, Behnam M, Thompson R An analysis of net energy production and feedstock availability for biobutanol and bioethanol. Bioresour Technol 102: Tay A, Yang ST Production of L(+)-lactic acid from glucose and starch by immobilized cells of Rhizopus oryzae in a rotating fibrous bed bioreactor. Biotechnol Bioeng 80:1-12. Thongsukmak A, Sirkar KK Pervaporation membranes highly selective for solvents present in fermentation broth. J Memb Sci 302: Tishkov VI, Popov VO Protein engineering of formate dehydrogenase. Biomol Eng 23: Toh SLI, McFarlane J, Tsouris C, DePaoli DW, Luo H, Dai S Room-temperature ionic liquids in liquid-liquid extraction: effects of solubility in aqueous solutions on surface properties. Solvent Extraction and Ion Exchange 24: Tomas CA, Bonarius H, Alsaker K, Yang H, Hendriksen W, Beamish J, Paredes C, Papoutsakis ET. 2003a. DNA-array based transcriptional analysis of Clostridium acetobutylicum sporulation (SK01) and degenerate (M5) mutants. J Bacteriol 185: Tomas CA, Welker NE, Papoutsakis ET. 2003b. Overexpression of groesl in Clostridium acetobutylicum results in increased solvent production and tolerance, prolonged metabolism, and changes in the cell's transcriptional program. Appl Environ Microbiol 69: Tracy BP, Jones SW, Fast AG, Indurthi DC, Papoutsakis ET Clostridia: the importance of their exceptional substrate and metabolite diversity for biofuel and biorefinery applications. Curr Opin Biotechnol 23: Tummala SB, Junne SG, Papoutsakis ET Antisense RNA downregulation of coenzyme A transferase combined with alcohol-aldehyde dehydrogenase overexpression leads to predominantly alcohologenic Clostridium acetobutylicum fermentations. J Bacteriol 185: Tummala SB, Welker NE, Papoutsakis ET Development and characterization of a gene expression reporter system for Clostridium acetobutylicum ATCC824. Appl Environ Microbiol 65:

339 Twine SM, Reid CW, Aubry A, McMullin DR, Fulton KM, Austin J, Logan SM Motility and flagellar glycosylation in Clostridium difficile. J Bacteriol 191: Underwood S, Guan S, Vijayasubhash V, Baines SD, Graham L, Lewis RJ, Wilcox MH, Stephenson K Characterisation of the sporulation initiation pathway of Clostridium difficile and the role in toxin production. J Bacteriol 191: van der Wal H, Sperber B, Houweling-Tan B, Bakker RRC, Brandenburg W, Lopez- Contreras AM Production of acetone, butanol, and ethanol from biomass of the green seaweed Ulva lactuca. Bioresour Technol 128: Van der Zee FP, Cervantes FJ Impact and application of electron shuttles on the redox (bio)transformation of contaminants: A review. Biotechnol Advances 27: Vane LM Review: A review of Pervaporation for product recovery from biomass fermentation processes. J Chem Technol Biotechnol 80: Vane LM Separation technologies for the recovery and dehydration of alcohols from fermentation broths. Biofuels Bioprod Bioref 2: Vasconcelos I, Girbal L, Soucaille P Regulation of carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral ph on mixtures of glucose and glycerol. J Bacteriol 176: Volkov VV, Fadeev AG, Khotimsky VS, Litvinova EG, Selinskaya Y, McMillan JD, Kelley SS Effects of synthesis conditions on the pervaporation properties of poly[-1-(trimethylsilyl)-1-propyne] useful for membrane bioreactors. J Appl Polym Sci 91: Volkov VV, Khotimsky VS, Litvinova EG, Fadeev AG, Selinskaya Y, Plate NA, McMillan JD, Kelley SS Development of novel poly[-1-(trimethylsilyl)-1- propyne] based materials for pervaporation separation in biofuel production. Polym Mater Sci Eng 77: Vrana DL, Meagher MM, Hutkins RW, Duffield B Pervaporation of model acetone-butanol-ethanol fermentation product solutions using Polytetrafluoroethylene membranes. Sep Sci Technol 28: Walter K, Nair R, Cary J, Bennett G Sequence and arrangement of two genes of the butyrate-synthesis pathway of Clostridium acetobutylicum ATCC824. Gene 134: Wang S, Zhu Y, Zhang Y, Li Y Controlling the oxidoreduction potential of the culture of Clostridium acetobutylicum leads to an earlier initiation of solventogenesis, thus increasing solvent productivity. Appl Microbiol Biotechnol 93:

340 Wang X, Wang Y, Wang B, Blaschek H, Feng H, Li Z Biobutanol production from fiber-enhanced DDGS pretreated with electrolyzed water. Renewable Energy 52: Wang Z, Wang Y, Yang ST, Wang R, Ren H A novel honeycomb matrix for cell immobilization to enhance lactic acid production by Rhizopus oryzae. Bioresour technol101: Wang Z, Yang ST Propionic acid production in glycerol/glucose co-fermentation by Propionibacterium freudenreichii subsp. shermanii. Bioresour Technol 137: Wei D, Liu X, Yang ST Butyric acid production from sugarcane bagasse hydrolysate by Clostridium tyrobutyricum immobilized in a fibrous-bed bioreactor. Bioresour Technol 129: Wichmann R, Vasic-Racki D Cofactor regeneration at the lab scale. Adv Biochem Eng/Biotechnol 92: Wietzke M, Bahl H The redox-sensing protein Rex, a transcriptional regulator of solventogenesis in Clostridium acetobutylicum. Appl Microbiol Biotechnol 96: Wisenborn DP, Rudolph FB, Papoutsakis ET Phosphotransbutyrylase from Clostridium acetobutylicum ATCC824 and its role in acidogenesis. Appl Environ Microbiol 66: Wu ZT, Yang ST Extractive fermentation for butyric acid production from glucose by Clostridium tyrobutyricum. Biotech. Bioeng. 82: Xu Z, Yang ST Production of mycophenolic acid by Penicillium brevicompactum immobilized in a rotating fibrous-bed bioreactor. Enzyme Microb Technol 40: Xue C, Zhao J, Liu F, Lu C, Yang S-T, Bai F-W Two-stage in situ gas stripping for enhanced butanol fermentation and energy-saving product recovery. Bioresour Technol 135: Xue C, Zhao J, Lu C, Yang ST, Bai F, Tang IC High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping. Biotechnol Bioeng 109: Yang ST Extractive fermentation using convoluted fibrous bed bioreactor. United States Patent Application Publication. US Patent Yao J, Lambowitz AM Gene targeting in Gram-negative bacteria by use of amobile group II intron (Targetron) expressed from a broad-host-range vector. Appl Environ Microbiol 73:

341 Yerushaimi L, Volesky B Importance of agitation in acetone butanol fermentation. Biotechnol Bioeng 27: Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol 93: Yu M, Zhang Y, Tang IC, Yang ST Metabolic engineeringof Clostridium tyrobutyricum for n-butanol production. Metab Eng 13: Zhang J, Wang M, Gao M, Fang X, Yano S, Qin S, Xia R Efficient acetonebutanol-ethanol production from corncob with a new pretreatment technology-wet disk milling. Bioenergy Research 6: Zhang Y Metabolic engineering of Clostridium tyrobutyricum for production of biofuels and bio-based chemicals. Ph.D. thesis. The Ohio State University. Zhao H, Xia S, Ma P Review: use of ionic liquids as green solvents for extractions. J Chem Technol Biotechnol 80: Zheng YN, Li LZ, Xian M, Ma YJ, Yang JM, Xu X, He DZ Problems with the microbial production of butanol. J Ind Microbiol Biotechnol 36: Zhu L, Wei P, Cai J, Zhu X, Wang Z, Huang L, Xu Z Improving the productivity of propionic acid with FBB-immobilized cells of an adapted acid-tolerant Propionibacterium acidipropionici. Bioresour Technol 112: Zhu Y, Liu X, Yang ST Construction and characterization of pta gene-deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotech Bioeng 90: Zhu Y, Wu ZT, Yang ST Butyric acid production from acid hydrolysate of corn fibre by Clostridium tyrobutyricum in a fibrous-bed bioreactor. Process Biochem 38: Zhu Y, Yang ST Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Progr 19: Zhu Y, Yang ST Effect of ph on metabolic pathway shift in fermentation of xylose by Clostridium tyrobutyricum. J Biotechnol 110: Zverlov VV, Berezina O, Velikodvorskaya GA, Schwarz WH Bacterial acetone and butanol production by industrial fermentation in the Soviet Union: Use of hydrolyzed agricultural waste for biorefinery. Appl Microbiol Biotechnol 71:

342 Appendix A: Gene sequences A.1 Gene adhe sequence ATGAAAGTCACAACAGTAAAGGAATTAGATGAAAAACTCAAGGTAATTAAA GAAGCTCAAAAAAAATTCTCTTGTTACTCGCAAGAAATGGTTGATGAAATCT TTAGAAATGCAGCAATGGCAGCAATCGACGCAAGGATAGAGCTAGCAAAAG CAGCTGTTTTGGAAACCGGTATGGGCTTAGTTGAAGACAAGGTTATAAAAAA TCATTTTGCAGGCGAATACATCTATAACAAATATAAGGATGAAAAAACCTGC GGTATAATTGAACGAAATGAACCCTACGGAATTACAAAAATAGCAGAACCTA TAGGAGTTGTAGCTGCTATAATCCCTGTAACAAACCCCACATCAACAACAAT ATTTAAATCCTTAATATCCCTTAAAACTAGAAATGGAATTTTCTTTTCGCCTC ACCCAAGGGCAAAAAAATCCACAATACTAGCAGCTAAAACAATACTTGATGC AGCCGTTAAGAGTGGTGCCCCGGAAAATATAATAGGTTGGATAGATGAACCT TCAATTGAACTAACTCAATATTTAATGCAAAAAGCAGATATAACCCTTGCAA CTGGTGGTCCCTCACTAGTTAAATCTGCTTATTCTTCCGGAAAACCAGCAATA GGTGTTGGTCCGGGTAACACCCCAGTAATAATTGATGAATCTGCTCATATAA AAATGGCAGTAAGTTCAATTATATTATCCAAAACCTATGATAATGGTGTTATA TGTGCTTCTGAACAATCTGTAATAGTCTTAAAATCCATATATAACAAGGTAAA AGATGAGTTCCAAGAAAGAGGAGCTTATATAATAAAGAAAAACGAATTGGA TAAAGTCCGTGAAGTGATTTTTAAAGATGGATCCGTAAACCCTAAAATAGTC GGACAGTCAGCTTATACTATAGCAGCTATGGCTGGCATAAAAGTACCTAAAA CCACAAGAATATTAATAGGAGAAGTTACCTCCTTAGGTGAAGAAGAACCTTT TGCCCACGAAAAACTATCTCCTGTTTTGGCTATGTATGAGGCTGACAATTTTG ATGATGCTTTAAAAAAAGCAGTAACTCTAATAAACTTAGGAGGCCTCGGCCA TACCTCAGGAATATATGCAGATGAAATAAAAGCACGAGATAAAATAGATAG ATTTAGTAGTGCCATGAAAACCGTAAGAACCTTTGTAAATATCCCAACCTCAC AAGGTGCAAGTGGAGATCTATATAATTTTAGAATACCACCTTCTTTCACGCTT GGCTGCGGATTTTGGGGAGGAAATTCTGTTTCCGAGAATGTTGGTCCAAAAC ATCTTTTGAATATTAAAACCGTAGCTGAAAGGAGAGAAAACATGCTTTGGTT TAGAGTTCCACATAAAGTATATTTTAAGTTCGGTTGTCTTCAATTTGCTTTAA AAGATTTAAAAGATCTAAAGAAAAAAAGAGCCTTTATAGTTACTGATAGTGA CCCCTATAATTTAAACTATGTTGATTCAATAATAAAAATACTTGAGCACCTAG ATATTGATTTTAAAGTATTTAATAAGGTTGGAAGAGAAGCTGATCTTAAAAC CATAAAAAAAGCAACTGAAGAAATGTCCTCCTTTATGCCAGACACTATAATA GCTTTAGGTGGTACCCCTGAAATGAGCTCTGCAAAGCTAATGTGGGTACTAT ATGAACATCCAGAAGTAAAATTTGAAGATCTTGCAATAAAATTTATGGACAT AAGAAAGAGAATATATACTTTCCCAAAACTCGGTAAAAAGGCTATGTTAGTT GCAATTACAACTTCTGCTGGTTCCGGTTCTGAGGTTACTCCTTTTGCTTTAGTA ACTGACAATAACACTGGAAATAAGTACATGTTAGCAGATTATGAAATGACAC CAAATATGGCAATTGTAGATGCAGAACTTATGATGAAAATGCCAAAGGGATT 313

343 AACCGCTTATTCAGGTATAGATGCACTAGTAAATAGTATAGAAGCATACACA TCCGTATATGCTTCAGAATACACAAACGGACTAGCACTAGAGGCAATACGAT TAATATTTAAATATTTGCCTGAGGCTTACAAAAACGGAAGAACCAATGAAAA AGCAAGAGAGAAAATGGCTCACGCTTCAACTATGGCAGGTATGGCATCCGCT AATGCATTTCTAGGTCTATGTCATTCCATGGCAATAAAATTAAGTTCAGAACA CAATATTCCTAGTGGCATTGCCAATGCATTACTAATAGAAGAAGTAATAAAA TTTAACGCAGTTGATAATCCTGTAAAACAAGCCCCTTGCCCACAATATAAGTA TCCAAACACCATATTTAGATATGCTCGAATTGCAGATTATATAAAGCTTGGAG GAAATACTGATGAGGAAAAGGTAGATCTCTTAATTAACAAAATACATGAACT AAAAAAAGCTTTAAATATACCAACTTCAATAAAGGATGCAGGTGTTTTGGAG GAAAACTTCTATTCCTCCCTTGATAGAATATCTGAACTTGCACTAGATGATCA ATGCACAGGCGCTAATCCTAGATTTCCTCTTACAAGTGAGATAAAAGAAATG TATATAAATTGTTTTAAAAAACAACCTTAA A.2 Gene adhe2 sequence ATGAAAGTTACAAATCAAAAAGAACTAAAACAAAAGCTAAATGAATTGAGA GAAGCGCAAAAGAAGTTTGCAACCTATACTCAAGAGCAAGTTGATAAAATTT TTAAACAATGTGCCATAGCCGCAGCTAAAGAAAGAATAAACTTAGCTAAATT AGCAGTAGAAGAAACAGGAATAGGTCTTGTAGAAGATAAAATTATAAAAAA TCATTTTGCAGCAGAATATATATACAATAAATATAAAAATGAAAAAACTTGT GGCATAATAGACCATGACGATTCTTTAGGCATAACAAAGGTTGCTGAACCAA TTGGAATTGTTGCAGCCATAGTTCCTACTACTAATCCAACTTCCACAGCAATT TTCAAATCATTAATTTCTTTAAAAACAAGAAACGCAATATTCTTTTCACCACA TCCACGTGCAAAAAAATCTACAATTGCTGCAGCAAAATTAATTTTAGATGCA GCTGTTAAAGCAGGAGCACCTAAAAATATAATAGGCTGGATAGATGAGCCAT CAATAGAACTTTCTCAAGATTTGATGAGTGAAGCTGATATAATATTAGCAAC AGGAGGTCCTTCAATGGTTAAAGCGGCCTATTCATCTGGAAAACCTGCAATT GGTGTTGGAGCAGGAAATACACCAGCAATAATAGATGAGAGTGCAGATATA GATATGGCAGTAAGCTCCATAATTTTATCAAAGACTTATGACAATGGAGTAA TATGCGCTTCTGAACAATCAATATTAGTTATGAATTCAATATACGAAAAAGTT AAAGAGGAATTTGTAAAACGAGGATCATATATACTCAATCAAAATGAAATAG CTAAAATAAAAGAAACTATGTTTAAAAATGGAGCTATTAATGCTGACATAGT TGGAAAATCTGCTTATATAATTGCTAAAATGGCAGGAATTGAAGTTCCTCAA ACTACAAAGATACTTATAGGCGAAGTACAATCTGTTGAAAAAAGCGAGCTGT TCTCACATGAAAAACTATCACCAGTACTTGCAATGTATAAAGTTAAGGATTTT GATGAAGCTCTAAAAAAGGCACAAAGGCTAATAGAATTAGGTGGAAGTGGA CACACGTCATCTTTATATATAGATTCACAAAACAATAAGGATAAAGTTAAAG AATTTGGATTAGCAATGAAAACTTCAAGGACATTTATTAACATGCCTTCTTCA CAGGGAGCAAGCGGAGATTTATACAATTTTGCGATAGCACCATCATTTACTCT TGGATGCGGCACTTGGGGAGGAAACTCTGTATCGCAAAATGTAGAGCCTAAA CATTTATTAAATATTAAAAGTGTTGCTGAAAGAAGGGAAAATATGCTTTGGTT TAAAGTGCCACAAAAAATATATTTTAAATATGGATGTCTTAGATTTGCATTAA AAGAATTAAAAGATATGAATAAGAAAAGAGCCTTTATAGTAACAGATAAAG 314

344 ATCTTTTTAAACTTGGATATGTTAATAAAATAACAAAGGTACTAGATGAGAT AGATATTAAATACAGTATATTTACAGATATTAAATCTGATCCAACTATTGATT CAGTAAAAAAAGGTGCTAAAGAAATGCTTAACTTTGAACCTGATACTATAAT CTCTATTGGTGGTGGATCGCCAATGGATGCAGCAAAGGTTATGCACTTGTTAT ATGAATATCCAGAAGCAGAAATTGAAAATCTAGCTATAAACTTTATGGATAT AAGAAAGAGAATATGCAATTTCCCTAAATTAGGTACAAAGGCGATTTCAGTA GCTATTCCTACAACTGCTGGTACCGGTTCAGAGGCAACACCTTTTGCAGTTAT AACTAATGATGAAACAGGAATGAAATACCCTTTAACTTCTTATGAATTGACC CCAAACATGGCAATAATAGATACTGAATTAATGTTAAATATGCCTAGAAAAT TAACAGCAGCAACTGGAATAGATGCATTAGTTCATGCTATAGAAGCATATGT TTCGGTTATGGCTACGGATTATACTGATGAATTAGCCTTAAGAGCAATAAAA ATGATATTTAAATATTTGCCTAGAGCCTATAAAAATGGGACTAACGACATTG AAGCAAGAGAAAAAATGGCACATGCCTCTAATATTGCGGGGATGGCATTTGC AAATGCTTTCTTAGGTGTATGCCATTCAATGGCTCATAAACTTGGGGCAATGC ATCACGTTCCACATGGAATTGCTTGTGCTGTATTAATAGAAGAAGTTATTAAA TATAACGCTACAGACTGTCCAACAAAGCAAACAGCATTCCCTCAATATAAAT CTCCTAATGCTAAGAGAAAATATGCTGAAATTGCAGAGTATTTGAATTTAAA GGGTACTAGCGATACCGAAAAGGTAACAGCCTTAATAGAAGCTATTTCAAAG TTAAAGATAGATTTGAGTATTCCACAAAATATAAGTGCCGCTGGAATAAATA AAAAAGATTTTTATAATACGCTAGATAAAATGTCAGAGCTTGCTTTTGATGAC CAATGTACAACAGCTAATCCTAGGTATCCACTTATAAGTGAACTTAAGGATA TCTATATAAAATCATTTTA 315

345 Appendix B: Gas chromatography (GC) and high performance liquid chromatography (HPLC) diagrams B.1 GC standard diagram Figure B.1 GC standard diagram for analysis of acetone, ethanol, butanol, acetic acid, and butyric acid using isobutanol and isobutyric acid as inner standard (10.0 g/l for each chemical, samples were diluted by 20-fold). 316

346 B.2 GC sample diagrams without and with methyl viologen A B Figure B.2 GC diagrams for analysis of samples without and with MV1000. Samples were taken at the same time and diluted by 20-fold. (A, without MV; B, with MV1000). 317

347 B.3 GC sample diagrams for free-cell and immobilized-cell fermentation in the presence of 25 μm benzyl viologen A B Figure B.3 GC diagrams for samples analysis in free-cell and immobilized-cell fermentation in the presence of 25 μm benzyl viologen. Samples were diluted by 20-fold (A, free-cell fermentation; B, Immobilized-cell fermentation). 318

348 B.4 GC sample diagrams for fed-batch fermentation integrated with gas tripping in clostridium growth medium (CGM) and corn steep liquor medium (CSL) A B Figure B.4 GC diagrams for samples analysis of butanol condensate recovered by gas stripping in an integrated fed-batch fermentation and gas stripping process in CGM or CSL medium. Samples were diluted by 200-fold (A, CGM medium; B, CSL medium). 319

349 B.5 GC sample diagrams for immobilized-cell fermentation in FBB using different biomass hydrolysates as substrates A B Continued Figure B.5 GC diagrams for samples analysis in immobilized-cell fermentations in FBB using biomass hydrolysates as substrates. Samples were diluted by 20-fold (A, Cassava bagasse; B, Jerusalem artichoke; C, Cotton stalk; D, Sugarcane bagasse; E, Soybean hull; F, Corn fiber). 320

350 Figure B.5 continued. C D Continued 321

351 Figure B.5 continued. E F 322

352 2.000 CAL Glucose CAL Xylose uriu Lactate CAL Butyrate CAL B.6 HPLC standard diagram Acetate CAL Ethanol CAL Butanol CAL Minutes Figure B.6 HPLC standard diagram for analysis of glucose, xylose, lactate, ethanol, butanol, acetic acid, and butyric acid (2.0 g/l for each chemical). 323

353 Fructose Butyrate uriu Glucose Butanol Fructose Butyrate Butanol uriu Glucose Glucose Fructose BDL BDL BDL uriu B.7 HPLC diagrams for free-cell and immobilized-cell fermentations on glucose A Lactate Acetate B Minutes Lactate Acetate Ethanol C Minutes Lactate Acetate Ethanol Minutes Figure B.7 HPLC diagrams for sample analysis of free-cell and immobilized-cell fermentations grown on glucose (A, initial sample; B, free-cell fermentation; C, immobilized-cell fermentation). 324

354 BDL Butyrate uriu Xylose Butanol BDL BDL BDL Butyrate uriu Xylose Xylose BDL BDL BDL uriu B.8 HPLC diagrams for free-cell and immobilized-cell fermentations on xylose A Glucose Lactate Acetate B Minutes Lactate Butanol C Minutes Lactate Acetate Ethanol Minutes Figure B.8 HPLC diagrams for sample analysis of free-cell and immobilized-cell fermentations grown on xylose (A, initial sample; B, free-cell fermentation; C, immobilized-cell fermentation). 325

355 BDL uriu Xylose Butyrate Butanol Glucose Xylose BDL BDL BDL Butyrate uriu B.9 HPLC diagrams for immobilized-cell fermentation using glucose and xylose mixture as a co-substrate A Lactate Minutes B Lactate Acetate Ethanol Minutes Figure B.9 HPLC diagrams for sample analysis of immobilized-cell fermentation in FBB using glucose and xylose mixture as a co-substrate (A, initial sample; B, end sample). 326

356 Appendix C: Diagrams for experimental setup C.1 Diagram for experimental setup of free-cell fermentation Figure C.1 Diagram for experimental setup of free-cell fermentation. 327

357 C.2 Diagrams for experimental setup of repeated-batch fermentation in FBB A B Figure C.2 Diagrams for experimental setup of repeated-batch fermentation in FBB (A, an overview of the whole process; B, a close look of the FBB). 328

358 C.3 Diagram for experimental setup of fed-batch fermentation integrated with gas stripping Figure C.3 Diagram for experimental setup of fed-batch fermentation integrated with gas stripping. 329