De novo genome assembly with next generation sequencing data!! "

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "De novo genome assembly with next generation sequencing data!! ""

Transcription

1 De novo genome assembly with next generation sequencing data!! " Jianbin Wang" HMGP 7620 (CPBS 7620, and BMGN 7620)" Genomics lectures" 2/7/12" Outline" The need for de novo genome assembly! The nature of next generation sequencing data! The concepts and methods" The take home lessons" 1

2 The need for de novo genome assembly! The nature of next generation sequencing data! The concepts and methods" The takes" Why/When do we need de novo genome assembly? Lots of interesting organisms don t have their genome sequences available! They have to be done using NGS de novo assembly! Within species, each individual has its own genome! For one individual, different cells may have genome alterations! 2

3 5/29/12 New genomes" Within species" 3

4 Within an individual" The need for de novo genome assembly! The nature of next generation sequencing data! The concepts and methods" The takes" 4

5 The Nature of NGS Data" Higher parallel operation/yield! Much lower cost per base! Shorter (unfortunately)! 454: bp! Illumina: bp! Sanger sequencing: bp! ABI SOLiD: bp! Platform-based characteristic errors! Illumina paired-end vs. mate pair sequencing" Paired-end! Mate pair! 5

6 The need for de novo genome assembly! The nature of next generation sequencing data! The concepts and methods" The takes" De novo genome assembly concepts" Whole genome shortgun" sequencing" Genomic DNA! Genomic reads! Mate pair De novo assembly" Paired-end! Contig1! Contig2! Contig3! Contig4! Scaffold! Gaps! 6

7 Some vocabulary" Coverage (C)! C = 4" C k = 2" (k = 10)" C k = 3" (k = 5)" Kmer coverage (C k )! N50, N90!! Contig" N50 = 18,063 bp" N50 number = 4,175" N90 = 3,548 bp" N90 number = 16,950" Contig number Methods: Overlap-layout-consensus" Pair-wise sequence alignments (computationally expensive)! Construction an overlap graph to produce the reads layout! Multiple sequence alignments and generate consensus! Illumina! Examples: Phrap, Celera, Arachne, CAP, PCAP, Newbler,! 7

8 Methods: Eulerian path/de Bruijn graph" Kmer hash table! de Bruijn graph/ Eulerian path search! Examples: Euler, Velvet, Allpath, Abyss, SOAPdenovo,...! AGATGATTCG!! AGA! GAT! ATG! TGA! GAT! ATT! TTC! TCG! Illumina! Differences between an overlap graph and a de Bruijn graph" Schatz et. al 2010! 8

9 Methods - challenge" Repetitive sequence! DNA polymorphisms/sequencing errors! Non-uniform coverage (worse in Sanger sequencing)! Computational complexity of processing large volume of data! Reduced the complexity of the data" Sub-assembly (grouped assembly)! Repeat-masking! Reference based! 9

10 Additional Scaffolding" Related-genome as reference! cdnas/transcriptomes! Conserved proteins! Paired-end information! Reference genome - - cdna conserved protein! Contig1! Contig2! Contig3! Contig4! - - Scaffold! Genome assessment - coverage" Reads coverage/reads used! Physical coverage! Functional coverage! cdnas! Small RNAs!! 10

11 Genome assessment - continuity" Consistency to available genetic maps! Paired-end discrepancy! mrna/cdna intactness! The need for de novo genome assembly! The nature of next generation sequencing data! The concepts and methods" The takes! 11

12 12

13 De novo genome assembly on NGS data" is feasible! is still a very hard problem! algorithm matters, but more important is the source of DNA and quality of the library! reference genome or other higher-order genetic map is of great value! put it into the biological context! References/Additional reading" Schatz, M. C., A. L. Delcher, et al. (2010). "Assembly of large genomes using second-generation sequencing." Genome research 20(9): ! Earl, D., K. Bradnam, et al. (2011). "Assemblathon 1: a competitive assessment of de novo short read assembly methods." Genome research 21 (12): ! Salzberg, S. L., A. M. Phillippy, et al. (2012). "GAGE: A critical evaluation of genome assemblies and assembly algorithms." Genome research.! Treangen, T. J. and S. L. Salzberg (2012). "Repetitive DNA and nextgeneration sequencing: computational challenges and solutions." Nature reviews. Genetics 13(1): ! 13

De Novo Assembly of High-throughput Short Read Sequences

De Novo Assembly of High-throughput Short Read Sequences De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,

More information

Sequence Assembly and Alignment. Jim Noonan Department of Genetics

Sequence Assembly and Alignment. Jim Noonan Department of Genetics Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome

More information

Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements

More information

Genome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015

Genome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015 Genome Assembly J Fass UCD Genome Center Bioinformatics Core Friday September, 2015 From reads to molecules What s the Problem? How to get the best assemblies for the smallest expense (sequencing) and

More information

Next Generation Sequencing Technologies

Next Generation Sequencing Technologies Next Generation Sequencing Technologies Julian Pierre, Jordan Taylor, Amit Upadhyay, Bhanu Rekepalli Abstract: The process of generating genome sequence data is constantly getting faster, cheaper, and

More information

NOW GENERATION SEQUENCING. Monday, December 5, 11

NOW GENERATION SEQUENCING. Monday, December 5, 11 NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000

More information

Genome Assembly, part II. Tandy Warnow

Genome Assembly, part II. Tandy Warnow Genome Assembly, part II Tandy Warnow How to apply de Bruijn graphs to genome assembly Phillip E C Compeau, Pavel A Pevzner & Glenn Tesler A mathematical concept known as a de Bruijn graph turns the formidable

More information

Outline. DNA Sequencing. Whole Genome Shotgun Sequencing. Sequencing Coverage. Whole Genome Shotgun Sequencing 3/28/15

Outline. DNA Sequencing. Whole Genome Shotgun Sequencing. Sequencing Coverage. Whole Genome Shotgun Sequencing 3/28/15 Outline Introduction Lectures 22, 23: Sequence Assembly Spring 2015 March 27, 30, 2015 Sequence Assembly Problem Different Solutions: Overlap-Layout-Consensus Assembly Algorithms De Bruijn Graph Based

More information

A Roadmap to the De-novo Assembly of the Banana Slug Genome

A Roadmap to the De-novo Assembly of the Banana Slug Genome A Roadmap to the De-novo Assembly of the Banana Slug Genome Stefan Prost 1 1 Department of Integrative Biology, University of California, Berkeley, United States of America April 6th-10th, 2015 Outline

More information

Lectures 18, 19: Sequence Assembly. Spring 2017 April 13, 18, 2017

Lectures 18, 19: Sequence Assembly. Spring 2017 April 13, 18, 2017 Lectures 18, 19: Sequence Assembly Spring 2017 April 13, 18, 2017 1 Outline Introduction Sequence Assembly Problem Different Solutions: Overlap-Layout-Consensus Assembly Algorithms De Bruijn Graph Based

More information

Mate-pair library data improves genome assembly

Mate-pair library data improves genome assembly De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate

More information

Assembly of Ariolimax dolichophallus using SOAPdenovo2

Assembly of Ariolimax dolichophallus using SOAPdenovo2 Assembly of Ariolimax dolichophallus using SOAPdenovo2 Charles Markello, Thomas Matthew, and Nedda Saremi Image taken from Banana Slug Genome Project, S. Weber SOAPdenovo Assembly Tool Short Oligonucleotide

More information

ABSTRACT COMPUTATIONAL METHODS TO IMPROVE GENOME ASSEMBLY AND GENE PREDICTION. David Kelley, Doctor of Philosophy, 2011

ABSTRACT COMPUTATIONAL METHODS TO IMPROVE GENOME ASSEMBLY AND GENE PREDICTION. David Kelley, Doctor of Philosophy, 2011 ABSTRACT Title of dissertation: COMPUTATIONAL METHODS TO IMPROVE GENOME ASSEMBLY AND GENE PREDICTION David Kelley, Doctor of Philosophy, 2011 Dissertation directed by: Professor Steven Salzberg Department

More information

De novo genome assembly. Dr Torsten Seemann

De novo genome assembly. Dr Torsten Seemann De novo genome assembly Dr Torsten Seemann IMB Winter School - Brisbane Mon 1 July 2013 Introduction Ideal world I would not need to give this talk! Human DNA Non-existent USB3 device AGTCTAGGATTCGCTA

More information

Genome Sequencing-- Strategies

Genome Sequencing-- Strategies Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

More information

Workflow of de novo assembly

Workflow of de novo assembly Workflow of de novo assembly Experimental Design Clean sequencing data (trim adapter and low quality sequences) Run assembly software for contiging and scaffolding Evaluation of assembly Several iterations:

More information

De novo sequence assembly

De novo sequence assembly 2015.11.17 De novo sequence assembly 徐唯哲 Paul Wei-Che HSU 中央研究院分子生物研究所研究助技師 Assistant Research Specialist Bioinformatics Service Core, Institute of Molecular Biology, Academia Sinica, Taiwan, R.O.C. Bioinformatics

More information

COPE: An accurate k-mer based pair-end reads connection tool to facilitate genome assembly

COPE: An accurate k-mer based pair-end reads connection tool to facilitate genome assembly Bioinformatics Advance Access published October 8, 2012 COPE: An accurate k-mer based pair-end reads connection tool to facilitate genome assembly Binghang Liu 1,2,, Jianying Yuan 2,, Siu-Ming Yiu 1,3,

More information

Genomics and Transcriptomics of Spirodela polyrhiza

Genomics and Transcriptomics of Spirodela polyrhiza Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence

More information

Genome Assembly Workshop Titles and Abstracts

Genome Assembly Workshop Titles and Abstracts Genome Assembly Workshop Titles and Abstracts TUESDAY, MARCH 15, 2011 08:15 AM Richard Durbin, Wellcome Trust Sanger Institute A generic sequence graph exchange format for assembly and population variation

More information

De novo assembly of human genomes with massively parallel short read sequencing

De novo assembly of human genomes with massively parallel short read sequencing Resource De novo assembly of human genomes with massively parallel short read sequencing Ruiqiang Li, 1,2,3 Hongmei Zhu, 1,3 Jue Ruan, 1,3 Wubin Qian, 1 Xiaodong Fang, 1 Zhongbin Shi, 1 Yingrui Li, 1 Shengting

More information

Each cell of a living organism contains chromosomes

Each cell of a living organism contains chromosomes COVER FEATURE Genome Sequence Assembly: Algorithms and Issues Algorithms that can assemble millions of small DNA fragments into gene sequences underlie the current revolution in biotechnology, helping

More information

PRE- AND POST-PROCESSING TOOLS FOR NEXT-GENERATION SEQUENCING DE NOVO ASSEMBLIES. Sari S. Khaleel

PRE- AND POST-PROCESSING TOOLS FOR NEXT-GENERATION SEQUENCING DE NOVO ASSEMBLIES. Sari S. Khaleel PRE- AND POST-PROCESSING TOOLS FOR NEXT-GENERATION SEQUENCING DE NOVO ASSEMBLIES by Sari S. Khaleel A thesis submitted to the Faculty of the University of Delaware in partial fulfillment of the requirements

More information

Illumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme

Illumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme Illumina (Solexa) Current market leader Based on sequencing by synthesis Current read length 100-150bp Paired-end easy, longer matepairs harder Error ~0.1% Mismatch errors dominate Throughput: 4 Tbp in

More information

BIOINFORMATICS 1 SEQUENCING TECHNOLOGY. DNA story. DNA story. Sequencing: infancy. Sequencing: beginnings 26/10/16. bioinformatic challenges

BIOINFORMATICS 1 SEQUENCING TECHNOLOGY. DNA story. DNA story. Sequencing: infancy. Sequencing: beginnings 26/10/16. bioinformatic challenges BIOINFORMATICS 1 or why biologists need computers SEQUENCING TECHNOLOGY bioinformatic challenges http://www.bioinformatics.uni-muenster.de/teaching/courses-2012/bioinf1/index.hbi Prof. Dr. Wojciech Makałowski"

More information

Efficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads

Efficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads Efficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads Authors Rei Kajitani 1, Kouta Toshimoto 1,2, Hideki Noguchi 3, Atsushi Toyoda 3,4, Yoshitoshi Ogura 5, Miki

More information

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018 Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT

More information

Title: High-quality genome assembly of channel catfish, Ictalurus punctatus

Title: High-quality genome assembly of channel catfish, Ictalurus punctatus Author s response to reviews Title: High-quality genome assembly of channel catfish, Ictalurus punctatus Authors: Qiong Shi (shiqiong@genomics.cn) Xiaohui Chen (xhchenffri@hotmail.com) Liqiang Zhong (lqzhongffri@hotmail.com)

More information

Next Gen Sequencing. Expansion of sequencing technology. Contents

Next Gen Sequencing. Expansion of sequencing technology. Contents Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND

More information

Genome assembly reborn: recent computational challenges Mihai Pop

Genome assembly reborn: recent computational challenges Mihai Pop BRIEFINGS IN BIOINFORMATICS. VOL 10. NO 4. 354^366 doi:10.1093/bib/bbp026 Genome assembly reborn: recent computational challenges Mihai Pop Submitted: 2nd March 2009; Received (in revised form): 18th April

More information

arxiv: v1 [q-bio.gn] 20 Apr 2013

arxiv: v1 [q-bio.gn] 20 Apr 2013 BIOINFORMATICS Vol. 00 no. 00 2013 Pages 1 7 Informed and Automated k-mer Size Selection for Genome Assembly Rayan Chikhi 1 and Paul Medvedev 1,2 1 Department of Computer Science and Engineering, The Pennsylvania

More information

Introduction: Methods:

Introduction: Methods: Eason 1 Introduction: Next Generation Sequencing (NGS) is a term that applies to many new sequencing technologies. The drastic increase in speed and cost of these novel methods are changing the world of

More information

Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory

Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Title: Genome Sequence Databases (Overview): Sequencing and Assembly Author: Lapidus, Alla L. Publication Date: 08-25-2009 Publication

More information

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms

More information

Identification of Optimum Sequencing Depth Especially for De Novo Genome Assembly of Small Genomes Using Next Generation Sequencing Data

Identification of Optimum Sequencing Depth Especially for De Novo Genome Assembly of Small Genomes Using Next Generation Sequencing Data Identification of Optimum Sequencing Depth Especially for De Novo Genome Assembly of Small Genomes Using Next Generation Sequencing Data Aarti Desai, Veer Singh Marwah, Akshay Yadav, Vineet Jha, Kishor

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Mapping strategies for sequence reads

Mapping strategies for sequence reads Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements

More information

Genomics AGRY Michael Gribskov Hock 331

Genomics AGRY Michael Gribskov Hock 331 Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will

More information

Connect-A-Contig Paper version

Connect-A-Contig Paper version Teacher Guide Connect-A-Contig Paper version Abstract Students align pieces of paper DNA strips based on the distance between markers to generate a DNA consensus sequence. The activity helps students see

More information

Lecture 11: Gene Prediction

Lecture 11: Gene Prediction Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are

More information

SMRT-assembly Error correction and de novo assembly of complex genomes using single molecule, real-time sequencing

SMRT-assembly Error correction and de novo assembly of complex genomes using single molecule, real-time sequencing SMRT-assembly Error correction and de novo assembly of complex genomes using single molecule, real-time sequencing Michael Schatz May 10, 2012 Biology of Genomes @mike_schatz / #bog12 Ingredients for a

More information

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

De novo Genome Assembly

De novo Genome Assembly De novo Genome Assembly A/Prof Torsten Seemann Winter School in Mathematical & Computational Biology - Brisbane, AU - 3 July 2017 Introduction The human genome has 47 pieces MT (or XY) The shortest piece

More information

Myzus persicae Clone G006 Assembly

Myzus persicae Clone G006 Assembly Myzus persicae Clone G006 Assembly R. Chikhi, T. Derrien, F. Legeai October 8, 2013 1 Reads correction Although sequence qualities from Illumina technologies are known to be accurate, typical errors are

More information

Single Nucleotide Polymorphisms Caused by Assembly Errors

Single Nucleotide Polymorphisms Caused by Assembly Errors Genomics Insights O r i g i n a l R e s e a r c h Open Access Full open access to this and thousands of other papers at http://www.la-press.com. Single Nucleotide Polymorphisms Caused by Assembly Errors

More information

Supplementary Figures and Tables

Supplementary Figures and Tables Genome assembly using Nanopore-guided Long and Error-free DNA Reads Mohammed-Amin Madoui 1 *, Stefan Engelen 1 *, Corinne Cruaud 1, Caroline Belser 1, Laurie Bertrand 1, Adriana Alberti 1, Arnaud Lemainque

More information

Meraculous-2D: Haplotype-sensitive Assembly of Highly Heterozygous genomes.

Meraculous-2D: Haplotype-sensitive Assembly of Highly Heterozygous genomes. Meraculous-2D: Haplotype-sensitive Assembly of Highly Heterozygous genomes. Eugene Goltsman [1], Isaac Ho [1], Daniel Rokhsar [1,2,3] [1] DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek,

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum

More information

Metagenomics is the study of all micro-organisms coexistent in an environmental area, including

Metagenomics is the study of all micro-organisms coexistent in an environmental area, including JOURNAL OF COMPUTATIONAL BIOLOGY Volume 22, Number 2, 2015 # Mary Ann Liebert, Inc. Pp. 159 177 DOI: 10.1089/cmb.2014.0251 DIME: A Novel Framework for De Novo Metagenomic Sequence Assembly XUAN GUO, 1

More information

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand

More information

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Opera: Reconstructing Optimal Genomic Scaffolds with High-Throughput Paired-End Sequences

Opera: Reconstructing Optimal Genomic Scaffolds with High-Throughput Paired-End Sequences Opera: Reconstructing Optimal Genomic Scaffolds with High-Throughput Paired-End Sequences Song Gao 1, Niranjan Nagarajan 2, and Wing-Kin Sung 2,3 1 NUS Graduate School for Integrative Sciences and Engineering,

More information

RADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé

RADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RADSeq Data Analysis Through STACKS on Galaxy Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RAD sequencing: next-generation tools for an old problem INTRODUCTION source: Karim Gharbi

More information

A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II

A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II W. Richard McCombie Disclosures Introduction to the challenge

More information

Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline Workflows

Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline Workflows Genes 2012, 3, 545-575; doi:10.3390/genes3030545 Article OPEN ACCESS genes ISSN 2073-4425 www.mdpi.com/journal/genes Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline

More information

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome

More information

Assessing De-Novo Transcriptome Assemblies

Assessing De-Novo Transcriptome Assemblies Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,

More information

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,

More information

Evaluation of next-generation sequencing software in mapping and assembly

Evaluation of next-generation sequencing software in mapping and assembly (2011) 56, 406 414 & 2011 The Japan Society of Human Genetics All rights reserved 1434-5161/11 $32.00 www.nature.com/jhg REVIEW Evaluation of next-generation sequencing software in mapping and assembly

More information

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles

More information

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Comparative genome assembly Mihai Pop, Adam Phillippy, Arthur L. Delcher and Steven L. Salzberg Date received (in revised form): 21st June 2004

Comparative genome assembly Mihai Pop, Adam Phillippy, Arthur L. Delcher and Steven L. Salzberg Date received (in revised form): 21st June 2004 Mihai Pop is a ioinformatics Scientist at the Institute for Genomic Research. He earned his PhD in Computer Science from Johns Hopkins University in 2000. His research interests include genome assembly

More information

Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms

Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell

More information

Introduction to NGS Analysis Tools

Introduction to NGS Analysis Tools National Center for Emerging and Zoonotic Infectious Diseases Introduction to NGS Analysis Tools Heather Carleton, PhD, MPH Team Lead, Enteric Diseases Bioinformatics, Enteric Diseases Laboratory Branch,

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior

More information

Analysing genomes and transcriptomes using Illumina sequencing

Analysing genomes and transcriptomes using Illumina sequencing Analysing genomes and transcriptomes using Illumina uencing Dr. Heinz Himmelbauer Centre for Genomic Regulation (CRG) Ultrauencing Unit Barcelona The Sequencing Revolution High-Throughput Sequencing 2000

More information

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017 Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA

More information

ABySS 2.0: resource-efficient assembly of large genomes using a Bloom filter

ABySS 2.0: resource-efficient assembly of large genomes using a Bloom filter Method ABySS 2.0: resource-efficient assembly of large genomes using a Bloom filter Shaun D. Jackman, 1 Benjamin P. Vandervalk, 1 Hamid Mohamadi, Justin Chu, Sarah Yeo, S. Austin Hammond, Golnaz Jahesh,

More information

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality

More information

A window into third-generation sequencing

A window into third-generation sequencing Human Molecular Genetics, 2010, Vol. 19, Review Issue 2 doi:10.1093/hmg/ddq416 Advance Access published on September 21, 2010 A window into third-generation sequencing R227 R240 Eric E. Schadt, Steve Turner

More information

Next-Generation Genome Sequencing

Next-Generation Genome Sequencing Next-Generation Genome Sequencing Jarkko Salojärvi, D.Sc. (Tech) Department of Biosciences, Division of Plant Biology Department of Veterinary Biosciences, Veterinary Microbiology and Epidemiology University

More information

arxiv: v2 [q-bio.gn] 21 May 2012

arxiv: v2 [q-bio.gn] 21 May 2012 1 arxiv:1203.4802v2 [q-bio.gn] 21 May 2012 A Reference-Free Algorithm for Computational Normalization of Shotgun Sequencing Data C. Titus Brown 1,2,, Adina Howe 2, Qingpeng Zhang 1, Alexis B. Pyrkosz 3,

More information

Corset: enabling differential gene expression analysis for de novo assembled transcriptomes

Corset: enabling differential gene expression analysis for de novo assembled transcriptomes Davidson and Oshlack Genome Biology 2014, 15:410 METHOD Open Access : enabling differential gene expression analysis for de novo assembled transcriptomes Nadia M Davidson 1 and Alicia Oshlack 1,2* Abstract

More information

Measuring transcriptomes with RNA-Seq. BMI/CS 776 Spring 2016 Anthony Gitter

Measuring transcriptomes with RNA-Seq. BMI/CS 776  Spring 2016 Anthony Gitter Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu Overview RNA-Seq technology The RNA-Seq quantification problem Generative

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Sequence File Formats

Sequence File Formats File Formats Sequence File Formats Different formats for different uses Competing formats developed in parallel Some easy to read, some easy to write programs Don t have to stick to these formats, but

More information

RNASEQ WITHOUT A REFERENCE

RNASEQ WITHOUT A REFERENCE RNASEQ WITHOUT A REFERENCE Experimental Design Assembly in Non-Model Organisms And other (hopefully useful) Stuff Meg Staton mstaton1@utk.edu University of Tennessee Knoxville, TN I. Project Design Things

More information

The tomato genome re-seq project

The tomato genome re-seq project The tomato genome re-seq project http://www.tomatogenome.net 5 February 2013, Richard Finkers & Sjaak van Heusden Rationale Genetic diversity in commercial tomato germplasm relatively narrow Unexploited

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de

More information

A Practical Comparison of De Novo Genome Assembly Software Tools for Next-Generation Sequencing Technologies

A Practical Comparison of De Novo Genome Assembly Software Tools for Next-Generation Sequencing Technologies A Practical Comparison of De Novo Genome Assembly Software Tools for Next-Generation Sequencing Technologies Wenyu Zhang, Jiajia Chen, Yang Yang, Yifei Tang, Jing Shang, Bairong Shen* Center for Systems

More information

Finishing Drosophila Ananassae Fosmid 2728G16

Finishing Drosophila Ananassae Fosmid 2728G16 Finishing Drosophila Ananassae Fosmid 2728G16 Kyle Jung March 8, 2013 Bio434W Professor Elgin Page 1 Abstract For my finishing project, I chose to finish fosmid 2728G16. This fosmid carries a segment of

More information

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG

More information

Targeted Sequencing in the NBS Laboratory

Targeted Sequencing in the NBS Laboratory Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February

More information

Gap Filling for a Human MHC Haplotype Sequence

Gap Filling for a Human MHC Haplotype Sequence American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human

More information

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves

More information

UC Davis UC Davis Previously Published Works

UC Davis UC Davis Previously Published Works UC Davis UC Davis Previously Published Works Title Annotation-based genome-wide SNP discovery in the large and complex Aegilops tauschii genome using next-generation sequencing without a reference genome

More information

Whole-Genome Sequencing and Assembly with High- Throughput, Short-Read Technologies

Whole-Genome Sequencing and Assembly with High- Throughput, Short-Read Technologies Whole-Genome Sequencing and Assembly with High- Throughput, Short-Read Technologies Andreas Sundquist 1 *, Mostafa Ronaghi 2, Haixu Tang 3, Pavel Pevzner 4, Serafim Batzoglou 1 1 Department of Computer

More information

Biochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008

Biochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008 Biochemistry 412 New Strategies, Technologies, & Applications For DNA Sequencing 12 February 2008 Note: Scale is wrong!! (at least for sequences) 10 6 In 1980, the sequencing cost per finished bp $1.00

More information

Alignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics

Alignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Sequence alignment Assembly vs alignment Alignment methods Common issues Platform

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

How much sequencing do I need? Emily Crisovan Genomics Core

How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?

More information