GenScale Scalable, Optimized and Parallel Algorithms for Genomics. Dominique LAVENIER
|
|
- Alvin Hall
- 5 years ago
- Views:
Transcription
1 GenScale Scalable, Optimized and Parallel Algorithms for Genomics Dominique LAVENIER
2 Context New Sequencing Technologies - NGS Exponential growth of genomic data Drastic decreasing of costs Emergence of new applications Personalized medicine Metagenomic Bioinformatics Methods / Algorithms for processing NGS data
3 GenScale objectives 1. Design of algorithms/methodologies for NGS Scaling issue : genes ( ) genomes ( ) Time optimization (algorithm, parallelism) Space optimization (data structures) 2. Design of tools matching with real needs Maintain strong links with life science teams Housing bio competences inside GenScale Long term common projects Validation and test of our software by end-users Immediate feedback
4 Implementation Selection of NGS domains Parallelism Data Structure Optimization Project α Life Science Community Project β Sequence comparison Comparative metagenomic Genome assembly Variant detection Protein structure comparison Design/acceleration of workflows Algorithms & Methodologies GenOuest Platform Computin g Resources ---- Banks ---- Software Bioinformatics competences Computer Science Competences SOFTWARE
5 Sequence Comparison Bank to bank comparison Increasing need from the metagenomic field Challenges How Taxonomic assignation, discovering metabolic pathway, reads vs. protein banks One order of magnitude faster than BLAST: same sensitivity Two orders faster with minimal lost of sensitivity Optimally exploit the parallel nature of today and tomorrow processors (SIMD instruction, multi & many cores) New indexing strategies (minimize memory access)
6 Sequence Comparison Current activity Development of PLAST: Parallel Local Alignment Search Tool X5 vs BLASTN - X8 vs TBLASTX Transfer to Korilog company KLAST Partnership with CLCbio and Knime companies Scalability test Kalray & Cray companies Next: adaptation to NGS Process much higher volume of data Release sensitivity (speed/sensitivity tradeoff) Exploit redundancy of NGS data set Explore new index structures
7 Comparative metagenomic de novo approach Evaluate similarity between two samples Sample A Sample B 10 8 reads Challenge Process NGS metagenomic data in a reasonable amount of time Size of intersection similarity How Time (seconds) 100M 10M 1M 100K New similarity metric 10K Fast and low memory footprint 1K indexing structures New algorithms 1 BLAST-like approach 10 days 270 years 1K 10K 100K 1M 10 M 100M 1G Data Base size (# reads)
8 Comparative metagenomic Current activity Approximate similarity Two reads are considered to be similar if they share N non overlapped k-mers Probabilistic indexing structures Bloom filter + fast hash DNA specific functions Tara Ocean project Next Heat map based on Compareads Scaling methodology for processing thousands of samples Include statistical strategies Compareads software 2 samples of 10 8 reads Time: 10 hours Memory: 4 Go
9 de novo Genome Assembly Reconstruct genome text of unknown species Current bottleneck: Challenge Memory ~512 Go RAM for complex genomes Time days of computation Fast assembler with low memory footprint How Efficient and low foot print memory structures Parallel algorithms Assembly Process
10 de novo Genome Assembly Current activity Efficient representation of de-bruijn graph Probabilistic data structure (Cascading Bloom Filter) Assembly Genomic Tool Box Aim: Customize assembly Minia pipeline Human genome : < 8 Gbytes / 48 hours Target assembly INRA Collaboration : pest genome analysis Next Scaffolding Combinatorial optimization approach Parallel assembly algorithms Correction Contiger Scaffolding Gap filling Assembly process
11 Variant detection Types of variants Single Nucleotide Polymorphism (SNP) Insertion / deletion Structural variants (Inversion, transposition,...) Challenge How Detect variants without assembly No mapping step no reference genome Process directly de-bruijn graphs Detection of representative patterns ACGACTCG GACTCGAT Set of reads ACG CGA GAC ACT CTC TCG GAT
12 Variant detection Current activity Reference free detection of SNPs 1 to N read sets Better than classical approaches Detection of inversions Detection of long insertions INRA Collab: ape & tick genome analysis Next Enhance de-bruijn graph Mate-pair information Detection of other types of variants Transposition, translocation Merge assembly + de novo variant detection Disc Snp
13 Protein Structure Comparison Comparison of 3D structures Global : Classification / Clustering Local : Docking Challenges Automatic hierarchical classification Reference database: SCOP, CATH Flexible comparison How : alignment graph Cliques represent local alignments of 3D structures Alignment graph Advance combinatorial optimization technics for solving NP-hard problems Search of maximal clique
14 Protein Structure Comparison Current activity Superfamily prediction/recognition Detection of structural repeats Parallelization of algorithms Collaboration : INRA MIG Next New structural metric distance New algorithms to detect community in the protein structure space
15 Design of Workflows NGS workflows Large datasets Time consuming Challenge Simplify capture Automate parallelization How Abstract level execution level Data flow parallelism
16 GenScale team Research Scientists D. Lavenier (DR CNRS) P. Peterlongo (CR Inria) C. Lemaitre (CR Inria) Faculty Member R. Andonov (Prof. Univ. Rennes 1) A. Mucherino (Ass. Prof. Univ. Rennes 1) External Collaborator G. Rizk (AlgoRizk Company) Post-Doctoral Fellows D. Concalves (CNRS) Engineers C. Deltel (Inria) F. Legeai (Inra) E. Drezen (Inria, ANR GATB) A. Andrieux (Inria, ADT Mapsembler) S. Alves-Carvalho (Inra, Peapol project) A. Gouin (Inra, ANR SpeciAphid) PhD Students F. Moreews (Inra) N. Maillet (Inria / ANR Mappi) G. Chapuis (MESR) M. Leboudic-Jamin (MESR) Administrative Assistant M.N. Georgeault (Inria)
17 GenScale Scalable, Optimized and Parallel Algorithms for Genomics Thank You!
de novo paired-end short reads assembly
1/54 de novo paired-end short reads assembly Rayan Chikhi ENS Cachan Brittany Symbiose, Irisa, France 2/54 THESIS FOCUS Graph theory for assembly models Indexing large sequencing datasets Practical implementation
More informationKorilog. high-performance sequence similarity search tool & integration with KNIME platform. Patrick Durand, PhD, CEO. BIOINFORMATICS Solutions
KLAST high-performance sequence similarity search tool & integration with KNIME platform Patrick Durand, PhD, CEO Sequence analysis big challenge DNA sequence... Context 1. Modern sequencers produce huge
More informationIntroduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014
Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454
More informationDNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs
DNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs Nadia Pisanti University of Pisa & Leiden University Outline New Generation Sequencing (NGS), and the importance of detecting
More informationThe Basics of Understanding Whole Genome Next Generation Sequence Data
The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next
More informationDe novo genome assembly with next generation sequencing data!! "
De novo genome assembly with next generation sequencing data!! " Jianbin Wang" HMGP 7620 (CPBS 7620, and BMGN 7620)" Genomics lectures" 2/7/12" Outline" The need for de novo genome assembly! The nature
More informationDe Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight Case Study Pseudomonas aeruginosa
More informationWGGBS in pea, Workshop. INRA, UMR 1349 IGEPP, BP35327, Le Rheu Cedex 35653, France 2
WGGBS in pea, a successful discosnp use without genome reduction and at low sequence coverage Gilles Boutet 1,6, Alves Carvalho S. 1, Peterlongo P. 2, Falque M. 3, Lhuillier E. 4, Bouchez O. 4, Lavaud
More informationDeveloping Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis
Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens Mitchell Holland, Noblis Agenda Introduction Whole Genome Sequencing Analysis Pipeline Sequence Alignment SNPs and
More informationTruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR)
tru TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR) Anton Bankevich Center for Algorithmic Biotechnology, SPbSU Sequencing costs 1. Sequencing costs do not follow Moore s law
More informationDe novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
More informationA shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationOutline. The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing
Illumina Assembly 1 Outline The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing 2 Illumina Sequencing Paired end Illumina
More informationDe novo assembly of human genomes with massively parallel short read sequencing. Mikk Eelmets Journal Club
De novo assembly of human genomes with massively parallel short read sequencing Mikk Eelmets Journal Club 06.04.2010 Problem DNA sequencing technologies: Sanger sequencing (500-1000 bp) Next-generation
More informationSupplementary Figure 1. Design of the control microarray. a, Genomic DNA from the
Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4
More informationAssembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster
Assembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster Aobakwe Matshidiso Supervisor: Prof Chrissie Rey Co-Supervisor: Prof Scott Hazelhurst Next Generation Sequencing
More informationABSTRACT COMPUTER EVOLUTION OF GENE CIRCUITS FOR CELL- EMBEDDED COMPUTATION, BIOTECHNOLOGY AND AS A MODEL FOR EVOLUTIONARY COMPUTATION
ABSTRACT COMPUTER EVOLUTION OF GENE CIRCUITS FOR CELL- EMBEDDED COMPUTATION, BIOTECHNOLOGY AND AS A MODEL FOR EVOLUTIONARY COMPUTATION by Tommaso F. Bersano-Begey Chair: John H. Holland This dissertation
More informationHuman Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction
More informationCompute- and Data-Intensive Analyses in Bioinformatics"
Compute- and Data-Intensive Analyses in Bioinformatics" Wayne Pfeiffer SDSC/UCSD August 8, 2012 Questions for today" How big is the flood of data from high-throughput DNA sequencers? What bioinformatics
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationAbout Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More informationLecture 18: Single-cell Sequencing and Assembly. Spring 2018 May 1, 2018
Lecture 18: Single-cell Sequencing and Assembly Spring 2018 May 1, 2018 1 SINGLE-CELL SEQUENCING AND ASSEMBLY 2 Single-cell Sequencing Motivation: Vast majority of environmental bacteria are unculturable
More informationde novo metagenome assembly
1 de novo metagenome assembly Rayan Chikhi CNRS Univ. Lille 1 Formation metagenomique de novo metagenomics 2 de novo metagenomics Goal: biological sense out of sequencing data Techniques: 1. de novo assembly
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationHPC in Bioinformatics and Genomics. Daniel Kahn, Clément Rezvoy and Frédéric Vivien Lyon 1 University & INRIA HELIX team LIP-ENS & INRIA GRAAL team
HPC in Bioinformatics and Genomics Daniel Kahn, Clément Rezvoy and Frédéric Vivien Lyon 1 University & INRIA HELIX team LIP-ENS & INRIA GRAAL team Moore s law in genomics Exponential increase Doubling
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationChallenging algorithms in bioinformatics
Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationFunctional annotation of metagenomes
Functional annotation of metagenomes Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction Functional analysis Objectives:
More informationHigh-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler
High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences
More informationNext Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park
Next Generation Sequences & Chloroplast Assembly 8 June, 2012 Jongsun Park Table of Contents 1 History of Sequencing Technologies 2 Genome Assembly Processes With NGS Sequences 3 How to Assembly Chloroplast
More informationRead Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
More informationNEXT GENERATION SEQUENCING. Farhat Habib
NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp
More informationAssembly of Ariolimax dolichophallus using SOAPdenovo2
Assembly of Ariolimax dolichophallus using SOAPdenovo2 Charles Markello, Thomas Matthew, and Nedda Saremi Image taken from Banana Slug Genome Project, S. Weber SOAPdenovo Assembly Tool Short Oligonucleotide
More informationAssembly and Validation of Large Genomes from Short Reads Michael Schatz. March 16, 2011 Genome Assembly Workshop / Genome 10k
Assembly and Validation of Large Genomes from Short Reads Michael Schatz March 16, 2011 Genome Assembly Workshop / Genome 10k A Brief Aside 4.7GB / disc ~20 discs / 1G Genome X 10,000 Genomes = 1PB Data
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationPéter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS
Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS The Bioinformatics book covers new topics in the rapidly
More informationMassive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput
Next Generation (Sequencing) Tools for Nucleotide-Based Information Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput Björn Rotter, PhD GenXPro GmbH,
More informationDe novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
More informationFast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing:
Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Patented, Anti-Correlation Technology Provides 99.5% Accuracy & Sensitivity to 5% Variant Knowledge Base and External Annotation
More informationsolid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome
solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome See the Difference With a commitment to your peace of mind, Life Technologies provides a portfolio of robust and scalable
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationBioinformatics for Microbial Biology
Bioinformatics for Microbial Biology Chaochun Wei ( 韦朝春 ) ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Fall 2013 1 Outline Part I: Visualization tools for microbial genomes Tools: Gbrowser Part II:
More informationThe New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency
More informationRNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell University Data generation Sequencing Platforms Short reads: Illumina Long reads: PacBio; Oxford Nanopore Contiging/Scaffolding
More informationThe Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
More informationBionano Solve v3.0.1 Release Notes
Bionano Solve v3.0.1 Release Notes Document Number: 30157 Document Revision: B For Research Use Only. Not for use in diagnostic procedures. Copyright 2017 Bionano Genomics, Inc. All Rights Reserved. Table
More informationWorkflow of de novo assembly
Workflow of de novo assembly Experimental Design Clean sequencing data (trim adapter and low quality sequences) Run assembly software for contiging and scaffolding Evaluation of assembly Several iterations:
More informationGenome Assembly: Background and Strategy
Genome Assembly: Background and Strategy Monday, February 8, 2016 BIOL 7210: Genome Assembly Group Aroon Chande, Cheng Chen, Alicia Francis, Alli Gombolay, Namrata Kalsi, Ellie Kim, Tyrone Lee, Wilson
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationde novo Transcriptome Assembly Nicole Cloonan 1 st July 2013, Winter School, UQ
de novo Transcriptome Assembly Nicole Cloonan 1 st July 2013, Winter School, UQ de novo transcriptome assembly de novo from the Latin expression meaning from the beginning In bioinformatics, we often use
More informationAnalysis of NGS data. resources. Grid computing workshop 2015 Jan Oppelt, NCBR & CEITEC MU 1 st December, 2015
Analysis of NGS data using MetaCentrum VO resources Grid computing workshop 2015 Jan Oppelt, NCBR & CEITEC MU 1 st December, 2015 Basic introduction 12/1/2015 Jan Oppelt, NCBR & CEITEC MU 2 Introduction
More informationGenome Assembly Software for Different Technology Platforms. PacBio Canu Falcon. Illumina Soap Denovo Discovar Platinus MaSuRCA.
Genome Assembly Software for Different Technology Platforms PacBio Canu Falcon 10x SuperNova Illumina Soap Denovo Discovar Platinus MaSuRCA Experimental design using Illumina Platform Estimate genome size:
More informationEra with Computational Biology/Toxicology
USM Seminar 1/22/2010 Embracing the Post-Omics Era with Computational Biology/Toxicology Ping Gong Environmental Genomics and Genetics (EGG) Team @ Environmental Laboratory Outline Introduction Bioinformatics
More informationData Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
More informationIntroduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
More informationA thesis submitted in partial fulfillment of the requirements for the degree in Master of Science
Western University Scholarship@Western Electronic Thesis and Dissertation Repository February 2015 Metagenome Assembly Wenjing Wan The University of Western Ontario Supervisor Lucian Ilie The University
More informationAnalysis of structural variation. Alistair Ward - Boston College
Analysis of structural variation Alistair Ward - Boston College What is structural variation? What differentiates SV from short variants? What are the major SV types? Summary of MEI detection What is an
More informationApplied bioinformatics in genomics
Applied bioinformatics in genomics Productive bioinformatics in a genome sequencing center Heiko Liesegang Warschau 2005 The omics pyramid: 1. 2. 3. 4. 5. Genome sequencing Genome annotation Transcriptomics
More informationDNA Matters Constructing Genes, Enzymes and Pathways by the Plate
DNA Matters Constructing Genes, Enzymes and Pathways by the Plate Leda Notchey May 19, 2015 Agenda 1. The Synthetic Biology Opportunity 2. The Gen9 Advantage 3. Working with Gen9: o o Custom Gene Synthesis
More informationLARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES
1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,
More informationSupplementary Materials for De-novo transcript sequence reconstruction from RNA-Seq: reference generation and analysis with Trinity
Supplementary Materials for De-novo transcript sequence reconstruction from RNA-Seq: reference generation and analysis with Trinity Sections: S1. Evaluation of transcriptome assembly completeness S2. Comparison
More informationBIOINFORMATICS ORIGINAL PAPER
BIOINFORMATICS ORIGINAL PAPER Vol. 27 no. 21 2011, pages 2957 2963 doi:10.1093/bioinformatics/btr507 Genome analysis Advance Access publication September 7, 2011 : fast length adjustment of short reads
More informationVALLIAMMAI ENGINEERING COLLEGE
VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year 2018-19 Prepared
More informationAlignment and Assembly
Alignment and Assembly Genome assembly refers to the process of taking a large number of short DNA sequences and putting them back together to create a representation of the original chromosomes from which
More informationThe Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow
The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,
More informationA New Algorithm for Protein-Protein Interaction Prediction
A New Algorithm for Protein-Protein Interaction Prediction Yiwei Li The University of Western Ontario Supervisor: Dr. Lucian Ilie Overview 1 Background 2 Previous approaches Experimental approaches Computational
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationIntroduction to CGE tools
Introduction to CGE tools Pimlapas Leekitcharoenphon (Shinny) Research Group of Genomic Epidemiology, DTU-Food. WHO Collaborating Centre for Antimicrobial Resistance in Foodborne Pathogens and Genomics.
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationComparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs.
Page 1 REMINDER: BMI 214 Industry Night Comparative Genomics Russ B. Altman BMI 214 CS 274 Location: Here (Thornton 102), on TV too. Time: 7:30-9:00 PM (May 21, 2002) Speakers: Francisco De La Vega, Applied
More informationAgilent NGS Solutions : Addressing Today s Challenges
Agilent NGS Solutions : Addressing Today s Challenges Charmian Cher, Ph.D Director, Global Marketing Programs 1 10 years of Next-Gen Sequencing 2003 Completion of the Human Genome Project 2004 Pyrosequencing
More informationBioinformatic tools for metagenomic data analysis
Bioinformatic tools for metagenomic data analysis MEGAN - blast-based tool for exploring taxonomic content MG-RAST (SEED, FIG) - rapid annotation of metagenomic data, phylogenetic classification and metabolic
More informationTranscriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
More informationAssembly. Ian Misner, Ph.D. Bioinformatics Crash Course. Bioinformatics Core
Assembly Ian Misner, Ph.D. Bioinformatics Crash Course Multiple flavors to choose from De novo No prior sequence knowledge required Takes what you have and tries to build the best contigs/scaffolds possible
More informationAnalysis of structural variation. Alistair Ward USTAR Center for Genetic Discovery University of Utah
Analysis of structural variation Alistair Ward USTAR Center for Genetic Discovery University of Utah What is structural variation? What differentiates SV from short variants? What are the major SV types?
More informationLectures 20, 21: Single- cell Sequencing and Assembly. Spring 2017 April 20,25, 2017
Lectures 20, 21: Single- cell Sequencing and Assembly Spring 2017 April 20,25, 2017 1 SINGLE-CELL SEQUENCING AND ASSEMBLY 2 Single-cell Sequencing Motivation: Vast majority of environmental bacteria are
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Minghui Wang Bioinformatics Facility Cornell University DNA Sequencing Platforms Illumina sequencing (100 to 300 bp reads) Overlapping reads ~180bp fragment
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationLecture 8: Predicting and analyzing metagenomic composition from 16S survey data
Lecture 8: Predicting and analyzing metagenomic composition from 16S survey data What can we tell about the taxonomic and functional stability of microbiota? Why? Nature. 2012; 486(7402): 207 214. doi:10.1038/nature11234
More informationIntroduction to DNA-Sequencing
informatics.sydney.edu.au sih.info@sydney.edu.au The Sydney Informatics Hub provides support, training, and advice on research data, analyses and computing. Talk to us about your computing infrastructure,
More informationE2ES to Accelerate Next-Generation Genome Analysis in Clinical Research
www.hcltech.com E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research whitepaper April 2015 TABLE OF CONTENTS Introduction 3 Challenges associated with NGS data analysis 3 HCL s NGS Solution
More informationNGS in Pathology Webinar
NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationFunctional profiling of metagenomic short reads: How complex are complex microbial communities?
Functional profiling of metagenomic short reads: How complex are complex microbial communities? Rohita Sinha Senior Scientist (Bioinformatics), Viracor-Eurofins, Lee s summit, MO Understanding reality,
More informationData Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
More informationSUPPLEMENTARY INFORMATION
Contents De novo assembly... 2 Assembly statistics for all 150 individuals... 2 HHV6b integration... 2 Comparison of assemblers... 4 Variant calling and genotyping... 4 Protein truncating variants (PTV)...
More informationThe first and only fully-integrated microarray instrument for hands-free array processing
The first and only fully-integrated microarray instrument for hands-free array processing GeneTitan Instrument Transform your lab with a GeneTitan Instrument and experience the unparalleled power of streamlining
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationGenome Assembly With Next Generation Sequencers
Genome Assembly With Next Generation Sequencers Personal Genomics Institute 3 May, 2011 Jongsun Park Table of Contents 1 Central Dogma and Omics Studies 2 History of Sequencing Technologies 3 Genome Assembly
More information