Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature

Size: px
Start display at page:

Download "Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature"

Transcription

1 Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry: An Introduction, John Wiley & Sons, Chichester,

2 A sample case; Treatment of hypertension by losartan High blood pressure can be caused by narrowing of the blood vessels. It can lead to heart disease, strokes and kidney failure Angiotensin II is a natural substance in your body that affects your cardiovascular system in many ways, such as by narrowing your blood vessels. This narrowing can increase your blood pressure and force your heart to work harder. Angiotensin II also stimulates the release of aldosterone, a hormone that increases your body's retention of sodium and water, which can lead to increased blood pressure. It can also thicken and stiffen the walls of your blood vessels and heart Angiotensin II receptor blockers block the action of angiotensin II. That allows blood vessels to widen (dilate) Losartan (COZAAR or HYZAAR) is a selective angiotensin II AT-I receptor antagonist (HYZAAR is Losartan+HCT) Also see Wong, Pancras C.; Timmermans, Pieter B. M. W. M Historical development of Losartan (DuP 753) and angiotensin II receptor subtypes. Blood Pressure 5 (SUPPL. 3): Find targets relating to angiotensin II In Thomson Pharma; the easiest search The more powerful search 4 2

3 Find sequences relating to angiotensin II Results; 3 target reports. Angiotensin II AT-1 receptor TG Angiotensin II AT-2 receptor TG Angiotensin II receptor Let s look at the first one 5 The target report 6 3

4 The target report (contd) 7 The target report (contd) 8 4

5 The target report (contd) 9 The target report (contd) 10 5

6 Sequence report

7

8 15 Two new bioinformatics resources BINDplus and BONDplus BINDplus - human-curated, biomolecular interaction data BINDplus represents the global standard for biomolecular interaction data BIND IDs published in Nature, Science and Cell BINDplus contains interaction information extracted from text and figures, and compiled in a standardized and computable form The BINDplus editorial team aims to capture all interaction data from over 120 peerreviewed publications BONDplus Sequence, interaction, taxonomy, publication, annotation, domain, cross-reference data on a Web platform Public Data - Over 80 million public domain sequences, originating GenBank, RefSeq, Entrez Gene, and UniProt/SWISSPROT GENESEQ Integrated on BONDplus BINDplus Largest, most comprehensive interaction database available Growing database of 200,000 interactions All databases fully searchable via free text, 16identifier, or BLAST searchcopyright 2007 Thomson Corporation 8

9 BINDplus BINDplus - human-curated, biomolecular interaction data BINDplus represents the global standard for biomolecular interaction data BIND IDs published in Nature, Science and Cell BINDplus contains interaction information extracted from text and figures, and compiled in a standardized and computable form Aims to capture all interaction data from over 120 peer-reviewed publications The Biomolecular Interaction Network Database (BIND) is a collection of over 200,000 records documenting molecular interactions: 60,000+ Gene Identifiers (GIs) 1,545+ organisms 23,800+ papers 7,500+ Gene Ontology (GO) terms New records are added to BINDplus daily With over 2,000 data fields, BINDplus includes clearly-labelled high-throughput (HTP) data submissions and low throughput (LTP) hand-curated information. To keep users at the cutting edge of global research, BINDplus is updated in real time every hour. 17 BINDplus: Contents (cont d) Physical interactions involving protein, DNA, RNA, small molecule, complex, photon from any/all organisms. Information about the interaction Experimental evidence Binding sites Chemical action/state between A and B Cellular localization Kinetic data Publication information Reflects the peer-reviewed opinion of the publication author. Interacting molecules are identified by referencing object databases. (e.g., NCBI s GenBank, OMIM, SGD, MGI, RGD, FlyBase) Focus is on details of interaction, not the interacting molecules. 18 9

10 BINDplus: Types of Records Interaction: Detailed description of an interaction between two molecules that is believed to occur in vivo. Complex: Describes a molecular complex by listing the series of interaction records present in the complex. (Eg. multi-subunit enzymes, ribosomes) 19 BINDplus: Record Creation BINDplus records are created using two methods: 1. Low Throughput Entry Hand-curated by specially-trained postgraduate-level scientists High-value data generated by standard wet-lab research 2. High Throughput Imports Automated experiments generating large scale datasets which are imported to BINDplus using individual scripting methods by developer curators Date generated from high throughput experiments such as large scale Yeast Two Hybrid 20 10

11 BINDplus: Detailed Record Detailed BINDplus records can be viewed in an expanded or collapsible format, enabling you to access as much or as little information as you need. BIND Accession ID Publication information supporting the interaction Interacting molecules with descriptions External links to NCBI and other databases Domain information & Gene Ontology (GO) annotation 21 BINDplus: Detailed Record (cont d) BINDplus records contain comprehensive details on published experimental data supporting the interaction. Experimental details: E.g. experimental system, relevant mutations and experimental forms Associated binding sites Experimental evidence can be visually linked to relevant binding sites Detailed binding site information 22 11

12 BONDplus BOND (Biomolecular Object Network Databank) integrates a range of component databases including Genbank and BIND Contains 80+ million biological sequences, 33,000 protein structures, 38,000 GO terms, and over 200,000 human curated interactions contained in BIND. 23 BONDplus Model High Value Foundational Information 24 12

13 BONDplus Content: Sequence Data 25 BONDplus: Search Results Complex Query Builder Exclude untrusted results Retrieve both Sequence and Interaction results Multiple View/Export Formats Summary Sequence Information 26 13

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Retrieval of gene information at NCBI

Retrieval of gene information at NCBI Retrieval of gene information at NCBI Some notes 1. http://www.cs.ucf.edu/~xiaoman/fall/ 2. Slides are for presenting the main paper, should minimize the copy and paste from the paper, should write in

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita

Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing

More information

BIMM 143: Introduction to Bioinformatics (Winter 2018)

BIMM 143: Introduction to Bioinformatics (Winter 2018) BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST

More information

Access to Information from Molecular Biology and Genome Research

Access to Information from Molecular Biology and Genome Research Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 8

More information

Deakin Research Online

Deakin Research Online Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM

More information

Textbook Reading Guidelines

Textbook Reading Guidelines Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 7

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo

DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo South African National Bioinformatics Institute University of the Western Cape RELEVEANCE OF DATA SHARING! Fragmented data

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

Data analysis: YeastMine, GO tools, and use cases

Data analysis: YeastMine, GO tools, and use cases Data analysis: YeastMine, GO tools, and use cases SGD: YeastMine: Email: sgd-helpdesk@lists.stanford.edu Rob Nash Senior Biocuration Scientist rnash@stanford.edu About SGD Started by David Botstein in

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org kcoombes@mdanderson.org

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

PIN (Proteins Interacting in the Nucleus) DB: A database of nuclear protein complexes from human and yeast

PIN (Proteins Interacting in the Nucleus) DB: A database of nuclear protein complexes from human and yeast Bioinformatics Advance Access published April 15, 2004 Bioinfor matics Oxford University Press 2004; all rights reserved. PIN (Proteins Interacting in the Nucleus) DB: A database of nuclear protein complexes

More information

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11 Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

Understanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University

Understanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University Understanding protein lists from proteomics studies Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu A typical comparative shotgun proteomics study IPI00375843

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

The Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro

The Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro Comparative and Functional Genomics Comp Funct Genom 2003; 4: 71 74. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.235 Conference Review The Gene Ontology Annotation

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Information Extraction from Biomedical Text

Information Extraction from Biomedical Text Information Extraction from Biomedical Text BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2009 The Information Extraction Task: Named Entity Recognition Analysis of

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the database of nucleotide sequences at the National Center for Biotechnology

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.

More information

CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS

CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS (Computational Structural Biology) OUTLINE Review: Molecular biology Proteins: structure, conformation and function(5 lectures) Generalized coordinates,

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Annotation. (Chapter 8)

Annotation. (Chapter 8) Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data

Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data Vol 1 no 1 2005 Pages 1 5 Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data Ozgun Babur 1 1 Center for Bioinformatics, Computer Engineering Department, Bilkent University,

More information

A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING

A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING D. Martucci a, F. Pinciroli a,b, M. Masseroli a a Dipartimento di Bioingegneria, Politecnico di Milano, Milano,

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1

BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1 BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1 Bioinformatics Databases http://bioboot.github.io/bioinf525_w17/module1/#1.1 Dr. Barry Grant Jan 2017 Overview: The purpose of this lab session is

More information

How Targets Are Chosen. Chris Wayman 12 th April 2012

How Targets Are Chosen. Chris Wayman 12 th April 2012 How Targets Are Chosen Chris Wayman 12 th April 2012 A few questions How many ideas does it take to make a medicine? 10 20 20-50 50-100 A few questions How long does it take to bring a product from bench

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

BGGN 213: Foundations of Bioinformatics (Fall 2017)

BGGN 213: Foundations of Bioinformatics (Fall 2017) BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Biological networks Ulf Leser: Introduction

More information

Lecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know?

Lecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know? Lecture 1 Bioinformatics 2 Introduction Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology

More information

Bioinformatics 2. Lecture 1

Bioinformatics 2. Lecture 1 Bioinformatics 2 Introduction Lecture 1 Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology

More information

Worksheet for Bioinformatics

Worksheet for Bioinformatics Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

Computational Biology and Bioinformatics

Computational Biology and Bioinformatics Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management

More information

Big picture and history

Big picture and history Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the

More information

Lesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome

Lesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

CSE/Beng/BIMM 182: Biological Data Analysis. Instructor: Vineet Bafna TA: Nitin Udpa

CSE/Beng/BIMM 182: Biological Data Analysis. Instructor: Vineet Bafna TA: Nitin Udpa CSE/Beng/BIMM 182: Biological Data Analysis Instructor: Vineet Bafna TA: Nitin Udpa Today We will explore the syllabus through a series of questions? Please ASK All logistical information will be given

More information

Targeting of the disease related proteome by small molecules

Targeting of the disease related proteome by small molecules Targeting of the disease related proteome by small molecules Workshop on chemical information 2018 EPFL Modest v. Korff utline Introduction Data sources Diseases Proteins Compounds Data relations Diseases

More information

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Data mining in Ensembl with BioMart Worked Example The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Which other genes related to human

More information

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.

More information

The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis

The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis For example, protein synthesis in human mitochondria relies on a genetic code that Leder and Nirenberg were able

More information

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned

More information

Lecture 2 Introduction to Data Formats

Lecture 2 Introduction to Data Formats Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 2 Introduction to Data Formats Introduction to Data Formats Real world, data and formats Sequences and

More information

Global Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource

Global Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource Global Biomolecular Information Infrastructure and Australia Graham Cameron Director The EMBL Australia Bioinformatics Resource What is bioinformatics? Methods, data, IT to exploit biomolecular information

More information

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

A History of Bioinformatics: Development of in silico Approaches to Evaluate Food Proteins

A History of Bioinformatics: Development of in silico Approaches to Evaluate Food Proteins A History of Bioinformatics: Development of in silico Approaches to Evaluate Food Proteins /////////// Andre Silvanovich Ph. D. Bayer Crop Sciences Chesterfield, MO October 2018 Bioinformatic Evaluation

More information

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood

More information

Bioinformatics for proteomics

Bioinformatics for proteomics Purdue-UAB Botanicals Center for Age-Related Disease Bioinformatics for proteomics Stephen Barnes, PhD Purdue-UAB Botanical Center Workshop 2002 Mass Spectrometry Methods in Botanicals Research Objectives

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control

More information

Introduc)on to Databases and Resources Biological Databases and Resources

Introduc)on to Databases and Resources Biological Databases and Resources Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

TREC 2004 Genomics Track. Acknowledgements. Overview of talk. Basic biology primer but it s really not quite this simple.

TREC 2004 Genomics Track. Acknowledgements. Overview of talk. Basic biology primer but it s really not quite this simple. TREC 24 Genomics Track William Hersh Department of Medical Informatics & Clinical Epidemiology Oregon Health & Science University Portland, OR, USA Email: hersh@ohsu.edu These slides and track information

More information

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality

More information

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September

More information

Capabilities & Services

Capabilities & Services Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro

More information

This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.

This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries. PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University

Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,

More information

Bioinformatics, in general, deals with the following important biological data:

Bioinformatics, in general, deals with the following important biological data: Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

earray 5.0 Create your own Custom Microarray Design

earray 5.0 Create your own Custom Microarray Design earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene

More information

Computers in Biology and Bioinformatics

Computers in Biology and Bioinformatics Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come

More information

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical

More information

MicroSEQ Rapid Microbial Identification System

MicroSEQ Rapid Microbial Identification System MicroSEQ Rapid Microbial Identification System Giving you complete control over microbial identification using the gold-standard genotypic method The MicroSEQ ID microbial identification system, based

More information

Overview of Health Informatics. ITI BMI-Dept

Overview of Health Informatics. ITI BMI-Dept Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational

More information

The RNA tools registry

The RNA tools registry university of copenhagen f a c u lt y o f h e a lt h a n d m e d i c a l s c i e n c e s The RNA tools registry A community effort to catalog RNA bioinformatics resources and their relationships Anne Wenzel

More information

What You NEED to Know

What You NEED to Know What You NEED to Know Major DNA Databases NCBI RefSeq EBI DDBJ Protein Structural Databases PDB SCOP CCDC Major Protein Sequence Databases UniprotKB Swissprot PIR TrEMBL Genpept Other Major Databases MIM

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Protein-protein interaction networks Ulf

More information

Pathway Analysis. Min Kim Bioinformatics Core Facility 2/28/2018

Pathway Analysis. Min Kim Bioinformatics Core Facility 2/28/2018 Pathway Analysis Min Kim Bioinformatics Core Facility 2/28/2018 Outline 1. Background 2. Databases: KEGG, Reactome, Biocarta, Gene Ontology, MSigDB, MetaCyc, SMPDB, IPA. 3. Statistical Methods: Overlap

More information

Ingenuity Pathway Analysis (IPA )

Ingenuity Pathway Analysis (IPA ) Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics

More information

A White Paper on SCan- MarK Explorer The Sophic Cancer Biomarker Knowledge Environment

A White Paper on SCan- MarK Explorer The Sophic Cancer Biomarker Knowledge Environment A White Paper on SCan- MarK Explorer The Sophic Cancer Biomarker Knowledge Environment I. Abstract: The three- year SCan- MarK Explorer Phase I and II NCI Small Business Innovation Research (SBIR) Project

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

The Open Pharmacological Concepts Triple Store.

The Open Pharmacological Concepts Triple Store. The Open Pharmacological Concepts Triple Store www.openphacts.org Public Domain Drug Discovery Data: Pharma are accessing, processing, storing & re-processing Literature Patents PubChem Genbank Databases

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

The patent examination process: Different approaches to searching at the USPTO

The patent examination process: Different approaches to searching at the USPTO The patent examination process: Different approaches to searching at the USPTO Jackie Cheng Supervisory Patent Examiner Technology Center 3700 Sue Liu Supervisory Patent Examiner Technology Center 1600

More information

BIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM)

BIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM) BIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM) Note: This material is adapted from Web-based Bioinformatics Tutorials: Exploring Genomes by

More information

2. The dropdown box has a number of databases that are searchable. Select the gene option and search for dihydrofolate reductase.

2. The dropdown box has a number of databases that are searchable. Select the gene option and search for dihydrofolate reductase. Bioinformatics Introduction Worksheet The first part of this exercise is aimed at walking you through some of the key tools used by scientists to explore the relationship between genes and proteins throughout

More information