Overview of Health Informatics. ITI BMI-Dept
|
|
- Martha Lawrence
- 6 years ago
- Views:
Transcription
1 Overview of Health Informatics ITI BMI-Dept
2 Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2
3 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational biology 4-Bioinformatics vs Clinical informatics 5-Bioinformatics Elements 6-For whom is Bioinformatics 7-Bioinformatics challenges 8-Bioinformatics today and future 9-Genomics, Proteomics and Pharmacogenomics 10-Gene Databases 11-Human Genome Project 12-Private sectors corporation
4 Bioinformatics Definitions the computational branch of molecular biology. 1 the study of how information is represented and analyzed in biological systems, starting at the molecular level 2 field of science in which biology, computer science and information technology merge to form a single discipline 3
5 Bioinformatics Definitions Cont. The systematic development and application of computing systems and computational solution techniques to the analysis of biological data obtained by experiments, modeling, database search, and instrumentation. 4 In Vivo In Vitro In Silico
6 System Biology 11 the study of an organism, viewed as an integrated and interacting network of genes, proteins and biochemical reactions which give rise to life. tries to understand how proteins and genes interact at a cellular level 2 Build upon results of HGP Moving from understanding single component understanding All components and interactions among them, as a System, which is true!! Please visit: Source:
7 Bioinformatics vs Computational biology Computational biology focuses on applying the Computer science techniques to develop models and simulations of biological systems. Bioinformatics focuses of analysis and generation of new knowledge from available data using the information and communication technologies. Bioinformatics Biology Computer Science Information Technology
8 Bioinformatics Vs Clinical informatics 2 Whereas clinical informatics deals with the management of information related to the delivery of health care, bioinformatics focuses on the management of information related to the underlying basic biological sciences Both are complex and related to living systems. Clinical Informatics deals with: Social systems of medicine Cognitive processes of medicine Technologies required to understand human physiology
9 Bioinformatics Elements I. Biological data II. Algorithm III. Software IV. Hardware V. Bioinformatician
10 Bioinformatics Elements cont. I. Biological data: DNA è Genome RNA è Transcriptome Protein è Proteome Biological Pathways Mutations..etc.
11 Bioinformatics Elements cont. II. Algorithm: An algorithm is an effective method for solving a problem using a finite sequence of instructions. Algorithms are used for calculation, data processing, and many other fields. 5 E.g. Gotoh's algorithm and Myers-Miller's algorithm, for Glopal Alignment, based on Dynamic Programming
12 Bioinformatics Elements cont. III. Software: A program or computational tool used to solve a problem depending on a specific Algorithm. E.g. Binding Affinity Prediction of Protein- Ligand (BAPPL). Please visit: ppl.jsp
13 Bioinformatics Elements cont. IV. Hardware: PCs, Servers, Super computers, Networks, etc. E.g. NCBI and EBI Networks
14 Bioinformatics Elements cont. V. Bioinformatician: Skills Required: A basic knowledge of molecular biology Experience with one more of Molecular Biology software packages Operating system's Computer Programming Language Database Management Systems or
15 For whom is Bioinformatics People from 1 : Biology Medical field Computer science Pharmaceutical fields Legalization authorities Investing companies etc.
16 Bioinformatics challenges 6 Lots of data what does it mean? Collecting data using data predicting data Genome annotation (functional genomics) What does this piece of DNA do? Protein structure is related to function (protein folding) Can we predict structure from sequence and basic physics? [Source:
17 Bioinformatics today and future cont. 1. Molecular medicine More drug targets Personalised medicine Preventative medicine Gene therapy 2. Microbial genome applications Waste cleanup Climate change Alternative energy sources Biotechnology Antibiotic resistance Forensic analysis of microbes The reality of bio-weapon creation Evolutionary studies - At this point Bioinformatics seems like - New a field Diagnostic remote from and medicine, Prognostic but that - Proteomics Build models will change with of: more Molecules, receptor Cells, Mutual Pharmacogenomics techniques Tissues, benefits Organisms, between Systems. bio For 2 pharmacogenomics and more and specific personal drug application genetic profiles and - Diagnosing Personalized clinical about 7 simulation informatics. Medicine s of 3000 drug hereditary targeting. 6 interactions. diseases -...bioinformatics to align with the 6 practice of medicine Agriculture Crops Insect resistance Improve nutritional quality Grow crops in poorer soils and that are drought resistant 4. Animals 5. Comparative studies Please visit: Source:
18 Important Opservations 6 Different people respond to drugs differently Many drugs Many genetic differences between people In addition, genetics influence Risk factors are you going to get the disease? (e.g. smoking emphysema, heart disease) Operative risk How to collect and use these data? Memory is not enough, need some tools [Source:
19 Genomics, Proteomics and Pharmacogenomics 7 Genomics: the field that analyzes genetic material from a species Proteomics: the study of gene expression at the level of proteins Pharmacogenomics: the study of genetic material to look for drug targets Patient genetic Profile Patient genetic Profile EHR
20 Pharmacogenomics Knowledge base Mission: collect, encode, and disseminate knowledge about the impact of human genetic variations on drug response Process: Curate primary genotype and phenotype data Annotate gene variants and gene-drug-disease relationships via literature review Summarize important PGx genes and drug pathways Provide Tutorials, for searching and using PharmGKB Please visit:
21 Gene Databases 8 Sequence Databases There are three major co-operating DBs (EMBL-EU, GenBank-USA, DNA Data Bank-Japan) containing millions of sequences with billions of nucleotides from several organisms with exponential growth. Secondary Sequence Databases Suitable for Microarray experiments. Contain better annotation and meta-information. Example: UniGene, TIGR, RefSeq Genomic Databases Examine sequences for microarrays from a genomic perspective Contain gene names and annotations (rather than gene sequences) organized per organism. Example: Ensembl, CMR (Microbial Genomes). Gene Expression Databases For more databases that are related to Bioinformatics, please visit: [Source:
22 Data Growth Growth of Protein Structures in Protein Data Bank ( ) Yearly Total Year Base Pairs Sequences , ,116,431,942 98,868,465 Year Yearly Totally Source:
23 EMBL, GenBank, DDBJ SWISS-PROT, TrEMBL, PIR- PSD PDB, EBI- MSD, NDB dbest, TGI, Mendel ESTs, Bodymap 3DInSight MolMovDB Source:
24 National center for Biotechnology Information (NCBI) 7 Created 1988 Part of NIH NLM Host 10 different genetic databases The Largest Biomedical Research Center Provide access to about 1, 000 organisms genome Please visit:
25 Human Genome Project (HGP) International Collaborative research Project. Goal was the complete mapping and understanding of all the genes of human beings 9 Sequencing, Identifying location and Mapping of about 25, 000 genes , 000 SNPs have been identified by mid Please check: map_search.cgi?taxid=9606 (courtesy National Library of Medicine)
26 What is after HGP?!! 10 National Institute of Health initiated the Human Microbiome Project (HMP). Sequencing 600 Health related microbes. 5 year project. Aims to: Developing a reference set of microbial genome sequences and preliminary characterization of the human microbiome Relationship between disease and changes in the human microbiome Development of new technologies Development of new tools for computational analysis Establishing a Data Analysis and Coordinating Center (DACC) Establishing a resource repository Ethical, legal and social implications (ELSI) of HMP research Please visit :
27 Private sectors corporation 10 Celera Genomics Genetic Mapping and Pharmacogenomics. DNA Direct Genetic Testing and Counseling Decode Genetics Corporation, Iceland initiative, decodeme Genome Analysis for diagnosing about 29 common diseases. Oracle Corporation and Thailand Initiative. Others!!!
28 Thanks By: ITI-BMI Dept. 7/5/
29 References 1. Jean-Michel Claverie. Cedric Notredame. Bioinformatics for Dummies 2 nd Edition. Wiley Edward H. Shortliffe. James J. Cimino. Biomedical Informatics: Computer Applications in Health Care and Biomedicine 3 rd Edition. Springer NCBI. A Science Primer. (Accessed December ). 4. Helge Weissig. Introduction to Bioinformatics Wikipedia. Algorithm. (Accessed December ). 6. Elmer V. Bernstam, School of Health Information Sciences and Internal Medicine, UT Houston. Health Informatics Presentation: (Accessed December ). 7. Robert E. Hoyt. Melanie Sutton. Ann Yoshihashi. Medical Informatics: Practical Guide for the Healthcare Professional 2 nd Edition. Lulu.com Alexandros Kanterakis. Heraklion, Crete. MineGene Presentation: (Accessed December ) 9. National Human Genome Research institute, National Institute of Health. Human Genome Project: (Accessed December ) 10. National Institute of Health. Human Microbiome Project: (Accessed December ). 11. Institute for System Biology. _the_21st_century_science (Accessed Decemeber )
Introduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationInterpreting Genome Data for Personalised Medicine. Professor Dame Janet Thornton EMBL-EBI
Interpreting Genome Data for Personalised Medicine Professor Dame Janet Thornton EMBL-EBI Deciphering a genome 3 billion bases 4 million variants 21,000 coding variants 10,000 non-synonymous variants 50-100
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationI nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationHuman Genomics. Higher Human Biology
Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary
More informationB I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationSince 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL
Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
More informationLARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES
1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,
More informationAccess to Information from Molecular Biology and Genome Research
Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationRESEARCH METHODOLOGY, BIOSTATISTICS AND IPR
MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy
More informationMARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305
MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What
More informationIntroduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools
Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationIntroduc)on to Databases and Resources Biological Databases and Resources
Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs
More informationVisit our Career Flowchart to get more information on some of these career paths.
Visit our Career Flowchart to get more information on some of these career paths. Academic Research Faculty: This career path consists of university or college professors who conduct research. They select
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More informationInformation Driven Biomedicine. Prof. Santosh K. Mishra Executive Director, BII CIAPR IV Shanghai, May
Information Driven Biomedicine Prof. Santosh K. Mishra Executive Director, BII CIAPR IV Shanghai, May 21 2004 What/How RNA Complexity of Data Information The Genetic Code DNA RNA Proteins Pathways Complexity
More informationExome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.
Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all
More informationFrom Bench to Bedside: Role of Informatics. Nagasuma Chandra Indian Institute of Science Bangalore
From Bench to Bedside: Role of Informatics Nagasuma Chandra Indian Institute of Science Bangalore Electrocardiogram Apparent disconnect among DATA pieces STUDYING THE SAME SYSTEM Echocardiogram Chest sounds
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationChina National Grid --- BioNode. Jun Wang Beijing Genomics Institute
China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,
More informationPioneering Clinical Omics
Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationAlgorithms in Bioinformatics ONE Transcription Translation
Algorithms in Bioinformatics ONE Transcription Translation Sami Khuri Department of Computer Science San José State University sami.khuri@sjsu.edu Biology Review DNA RNA Proteins Central Dogma Transcription
More informationComputers in Biology and Bioinformatics
Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come
More informationOur website:
Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate
More informationTECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298
DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES March 2017. March 2017 ABA 298 1 Technologies, Products & Services
More informationState strategies for bioinformatics in BRICs and the UK. Professor Brian Salter
State strategies for bioinformatics in BRICs and the UK Professor Brian Salter This new facility is the embodiment of our investment in big data and bioinformatics. We are not only ensuring that people
More informationProtein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
More informationComplex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine
Complex Adaptive Systems Forum: Transformative CAS Initiatives in Biomedicine January 18, 2013 Anna D. Barker, Ph.D. Director, Transformative Healthcare Networks C-Director, Complex Adaptive Systems Initiative
More informationINTRODUCTION TO GENETIC EPIDEMIOLOGY (EPID0754) Prof. Dr. Dr. K. Van Steen
INTRODUCTION TO GENETIC EPIDEMIOLOGY (EPID0754) Prof. Dr. Dr. K. Van Steen CHAPTER 1: SETTING THE PACE 1 Course Responsible Contact details 2 Administrative Issues Course details and examination methods
More informationCMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS
CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS (Computational Structural Biology) OUTLINE Review: Molecular biology Proteins: structure, conformation and function(5 lectures) Generalized coordinates,
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases
More informationThe Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro
Comparative and Functional Genomics Comp Funct Genom 2003; 4: 71 74. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.235 Conference Review The Gene Ontology Annotation
More informationPharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001
Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationFrumkin, 2e Part 1: Methods and Paradigms. Chapter 6: Genetics and Environmental Health
Frumkin, 2e Part 1: Methods and Paradigms Chapter 6: Genetics and Environmental Health Genetics Genetics, the study of individual genes, has expanded to include genomics, which is the study of all the
More informationCourse Agenda. Day One
Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an
More informationClinical and Translational Bioinformatics
Clinical and Translational Bioinformatics An Overview Jussi Paananen Institute of Biomedicine September 4 th, 2015 Bioinformatics Bioinformatics combines statistics, computer science and information technology
More informationIntegrated M.Tech. in Biotechnology (B.Tech + M.Tech) programme. Semester 1
Annexure-VI Integrated M.Tech. in Biotechnology (B.Tech + M.Tech) programme Semester 1 CY101/PH102 Engineering Chemistry/ Engineering Physics 3 1 0 4 MA103 Basic Mathematics 3 1 0 4 CS101 Computer Programming-I
More informationIntroduction. CS482/682 Computational Techniques in Biological Sequence Analysis
Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationCSC 121 Computers and Scientific Thinking
CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors
More informationLesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationBioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
More informationINTRODUCTION TO GENETIC EPIDEMIOLOGY (EPID GBIO0015) Prof. Dr. Dr. K. Van Steen
INTRODUCTION TO GENETIC EPIDEMIOLOGY (EPID0754 + GBIO0015) Prof. Dr. Dr. K. Van Steen CHAPTER 1: SETTING THE PACE 1 Course Responsible Contact details 2 Administrative Issues Course details and examination
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing
More informationCan Semantic Web Technologies enable Translational Medicine? (Or Can Translational Medicine help enrich the Semantic Web?)
Can Semantic Web Technologies enable Translational Medicine? (Or Can Translational Medicine help enrich the Semantic Web?) Vipul Kashyap 1, Tonya Hongsermeier 1, Samuel Aronson 2 1 Clinical Informatics
More informationTranslating Biological Data Sets Into Linked Data
Translating Biological Data Sets Into Linked Data Mark Tomko Simmons College, Boston MA The Broad Institute of MIT and Harvard, Cambridge MA September 28, 2011 Overview Why study biological data? UniProt
More informationGlobal Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource
Global Biomolecular Information Infrastructure and Australia Graham Cameron Director The EMBL Australia Bioinformatics Resource What is bioinformatics? Methods, data, IT to exploit biomolecular information
More informationExamination Assignments
Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN
More informationCompiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology
Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four
More informationADAMAS UNIVERSITY FACULTY OF SCIENCE - DEPARTMENT OF BIOTECHNOLOGY BACHELOR OF SCIENCE (Honours) SEMESTER - I
NEW CHOICE BASED CREDIT SYSTEM (TOTAL CREDIT = 22+22+28+28+26+26 = 152) Type of the Paper Paper Code ADAMAS UNIVERSITY FACULTY OF SCIENCE - DEPARTMENT OF BIOTECHNOLOGY SEMESTER - I / Brief Contents I BT1201
More informationStudying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control
More informationBIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics
More informationAdvancing Life Sciences
Advancing Life Sciences Sweden s largest center for life sciences A national resource SciLifeLab, Science for Life Laboratory, is a Swedish national center for molecular biosciences, with the mission to
More informationBiotechnology Chapter 20
Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationNGS Approaches to Epigenomics
I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic
More informationBiomedical Sciences Graduate Program
1 of 6 Graduate School 250 University Hall 230 North Oval Mall Columbus, OH 43210-1366 January 11, 2013 Phone (614) 292-6031 Fax (614) 292-3656 Jeff Parvin, Joanna Groden Co-Graduate Studies Chairs Biomedical
More informationINTRODUCTION TO GENETIC EPIDEMIOLOGY (EPID0754)
INTRODUCTION TO GENETIC EPIDEMIOLOGY (EPID0754) Prof. Dr. Dr. K. Van Steen (February 2011) CHAPTER 1: SETTING THE PACE 1 Course Responsible Contact details 2 Administrative Issues Course details and examination
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com
More informationCapabilities & Services
Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro
More informationAdvanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018
Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Anthony Gitter gitter@biostat.wisc.edu www.biostat.wisc.edu/bmi776/ These slides, excluding third-party
More informationAdvances in Biomedical Research at Comenius University Bratislava
Advances in Biomedical Research at Comenius University Bratislava Bratislava, Slovakia What is biomedicine? Biomedicine is a branch of medical science that applies biological and other natural-science
More informationBioinformatics and computational tools
Bioinformatics and computational tools Etienne P. de Villiers (PhD) International Livestock Research Institute Nairobi, Kenya International Livestock Research Institute Nairobi, Kenya ILRI works at the
More informationWHAT IS BIOCHEMISTRY
WHAT IS BIOCHEMISTRY Each part of every living being is biochemically connected. Biochemistry is at the heart of life science. It is a fascinating, diverse and sprawling discipline; which makes it near
More informationBioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview
Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 1, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Teaching assistants Hugh Cahill (hugh@jhu.edu) Jennifer Turney (jturney@jhsph.edu) Meg Zupancic
More informationBioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases
Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence
More informationMICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
More information