Application of next generation sequencing of a begomovirusresistant. KASPar assay for SNP detection of the Ty1-Ty3 region
|
|
|
- Rosa Holmes
- 6 years ago
- Views:
Transcription
1 Application of next generation sequencing of a begomovirusresistant inbred to design a KASPar assay for SNP detection of the Ty1-Ty3 region Menda, N. 1, S. Strickler 1, D.M. Dunham 1, D.P. Maxwell 2, L. Mejia 2, G.B. Martin 1, and L.A. Mueller 1 1) Boyce Thompson Institute for Plant Research, Cornell University, Ithaca, NY, USA 2) Semillas Tropicales, S.A., Guatemala
2 Luis Mejia San Carlos University (Retired) Semillas Tropicales Guatemala
3 Guatemala, Central America TYLCV and several bipartite begomoviruses
4 FAVI 9 - (I902 x S) Hebrew University of Jerusalem Resistant Hybrid 150 g fruit Determinant V, F1, F2 Favi Vidavski
5 Gh13 inbred selected from Favi 9 (h902 x S inbred) Gh13 early Oct Commercial Hybrid Nov.2012 Opportunity to use WGS to search for introgressions (TBRT meeting, Ithaca, NY 2011)
6 SGN Staff: Re-sequencing assembly of Gh13 WGS using Heinz 1706 as the reference sequence 20X coverage, Illumina sequencing Assembly: reference sequence and de novo GBrowse available (SGN site) SNP density plots (10-kb window)
7 Gh13 compared with Heinz1706 Mi Ty3 Ty1 TG97
8 SNP plot # SNPs/10 kb # nt s in gaps/10 kb
9 How does the SNP plot data from whole genome sequencing of Gh13 compare with data from the SolCap Illumina SNP chip for Chromosome 6?
10 Solcap Illumina Chip UC-Davis Allen van Dynze SolCap code Mbp Gh13-R HUJ-S Poly SGN solcap_snp_sl_ BB BB M solcap_snp_sl_ BB BB M solcap_snp_sl_ BB BB M solcap_snp_sl_ AA BB P solcap_snp_sl_ BB AA P solcap_snp_sl_ BB AA P solcap_snp_sl_ BB BB M solcap_snp_sl_ AA BB P solcap_snp_sl_ BB AA P solcap_snp_sl_ BB AA P solcap_snp_sl_ AA BB P solcap_snp_sl_ NC BB M solcap_snp_sl_ AA BB P solcap_snp_sl_ BB AA P solcap_snp_sl_ AA AA M solcap_snp_sl_ AA AA M solcap_snp_sl_ BB BB M
11 Verlaan, M.G., D. Szinay, S.F. Hutton, H. de Jong, R. Kormelink, R.G.F. Visser, J.W. Scott, Y. Bai. Chromososomal rearrangements between tomato and Solanum chilense hamper mapping and breeding of the TYLCV resistance gene Ty-1. Plant J. (2011) 68: Source of Ty1: two commercial hybrids; Ty1 from S. chilense LA1969 Source of Ty3: Scott-Hutton program, S. chilense LA2779
12 Disease tests on progenies of informative recombinants with TYLCV mapped Ty-1 to the long arm between markers MSC and MSc , an interval overlapping with the reported Ty-3 region, which led to the indication that Ty-1 and Ty-3 may be allelic. Verlaan et al., 2011
13 Ty1-Ty to 30.9 Mbp Verlaan et al., 2011
14 WGS SNP density plot ch06: 30.6 to Mbp Gbrowse (SGN) Verlaan et al. Ty3, SCAR Marker (31.5, P6-25) 34.2
15 Marker: P6-25F2/P6-25R5 (Chromosome 6, Mbp) ty3 Ty3 Ty3a Ty3b Ty3b Ty3b, 660 bp = S. chilense LA1969 (100%) (Ji, Jensen, Melgar, Maxwell, Sept. 07)
16 AS-PCR, detection of a SNP (G/A) KASP, from LGC Genomics ( Forward sense, with FAM or VIC Q Q G A Common primer reverse sense Fluorescent reading of 96, 384, 1536 well plates A = Resistant genotype G = Susceptible genotype
17 Assured Excellence in Plant Genetic Analysis Ag Biotech uses KASP technology for SNP detection of tomato traits
18 SL2.40ch06:30,600, ,900,000 Ty1-Ty3 region, Verlaan et al. Example of Strategy Pick target gene or region Design PCR primers Sequence fragments Align sequences, pick SNP Design KASP primers
19 An Example of KASPar Primer design PCR fragment sequence alignment inbred locus forward primer sequence SNP 1-30 nt reverse primer nt, 40-50% Heinz ty nt, 40-50% GC's T GC's Purple Russian ty same sequence T same sequence Gh13-WGS Ty3 same sequence G same sequence Gh13-PCR Ty3 same sequence G same sequence Gc9 (LA2779) Ty1-Ty3 same sequence G same sequence Inbred-ST1 (LA2779) Ty1-Ty3 same sequence G same sequence Gc171 (LA1932) Ty3a same sequence G same sequence LA1969 Ty3b same sequence G same sequence
20 KASPar Assay on known genotypes Q Q Forward sense, with FAM or VIC T G Common primer reverse sense G = Resistant genotype (RED) T = Susceptible genotype (BLUE) Het = (Green) SNP170 Ag Biotech
21 SNP170 Ag BioTech Genotype CALL Germplasm Mi TG97 (Ty1) P6-25 (Ty3) SNP170 Purple Russian S S S S HUJ-VF S S S S Heinz 1706 S S S S M82 S S S S Motelle R S S S Anahu R S S S Rodeo R S S S Celebrity R S S S Amelia R S S S Plum Crimson R S S S Gh13 S S Ty3/Ty3 R Gc9 S Ty1/Ty1 Ty3/Ty3 R Gc171 S S Ty3a/Ty3a R Inbred-Ty1 (LA1969) S Ty1/Ty1 Ty3b/Ty3b R Llanero** R S Ty3a/ty3 Het Marwa**? Ty1/ty1 Ty3b/ty3 Het Tritiet** R Ty1/ty1 Ty3b/ty3 Het
22 384 well plate, with data from one 96 well plate Each well contained leaves from a different plant from F3 families for Sem. Trop.
23 Advantages of SNP170 Does not require agarose gels (P6-25), so is much faster Closer to the true resistance determinant than SCAR marker P6-25; should give fewer false positives No false positives with Mi resistant germplasm Positive calls for Ty1, Ty3, Ty3a, Ty3b Adapted to large scale screening using 384 or 1536 well plates or other platforms
24 Disadvantages of SNP170 Does not distinguish between Ty1, Ty3, Ty3a, or Ty3b Cost of equipment for reading fluorescent dyes, much more than agarose gels
25 Special Thanks East-West Seeds for hosting TBRT Citizens of the USA NSF grant to SGN for sequencing, staff at SGN SolCap grant for SNP genotyping SolCAP SNP platform USDA funds for preparation of DNA CDR/MERC grants for P6-25 and TG97 analysis Ag Biotech Testing KASPar primers and verification of SNP170 Semillas Tropicales Supplying Gh13 and some other lines for testing
26
27
Begomovirus resistance z Resistance TYLCV ToMoV Yield Fruit size Designation Source Spring Fall Spring Fall (kg/plant) (g)
Introduction. Five breeding lines are released that have begomovirus resistance gene Ty-3 which provides resistance to tomato yellow leaf curl virus (TYLCV), the new world virus tomato mottle virus (ToMoV),
Katie S. Jensen, Christopher T. Martin, and Douglas P. Maxwell University of Wisconsin-Madison 7 April 2007
A CAPS marker, FER-G8, for detection of Ty3 and Ty3a alleles associated with S. chilense introgressions for begomovirus resistance in tomato breeding lines Katie S. Jensen, Christopher T. Martin, and Douglas
SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
CAPS marker for detection of Ty3a-locus associated with tomato inbred line, Gc171, which is resistant to whitefly-transmitted begomoviruses
CAPS marker for detection of Ty3a-locus associated with tomato inbred line, Gc171, which is resistant to whitefly-transmitted begomoviruses Introduction Katie S. Jensen Undergraduate, Senior Thesis Department
Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
J. W. Scott & Sam F. Hutton Gulf Coast Research & Education Center CR 672, Wimauma, FL 33598
Our Experience in Developing and Using Molecular Markers in the University of Florida Tomato Breeding Program. ASTA Educational Workshop, Tampa, FL Jan. 25, 2015 J. W. Scott & Sam F. Hutton Gulf Coast
WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR. Twelfth Session Ottawa, Canada, May 11 to 13, 2010
E BMT/12/9 ORIGINAL: English DATE: April 9, 2010 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR
TBRT Meeting April 2018 Scott Weigel Sales Director
TBRT Meeting April 2018 Scott Weigel Sales Director About Us AgriPlex Genomics was formed in 2014 with the goal of creating a platform for targeted sequencing and genotyping in large numbers of samples.
GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International
Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray
Tomato Breeding at University of Florida: Present Status and Future Directions
Tomato Breeding at University of Florida: Present Status and Future Directions Sam Hutton Gulf Coast Research & Education Center 14625 CR 672 Wimauma, FL 33598 sfhutton@ufl.edu Office: 813-633-4137 Cell:
Identification of markers tightly linked to tomato yellow leaf curl disease and root-knot nematode resistance by multiplex PCR
Identification of markers tightly linked to tomato yellow leaf curl disease and root-knot nematode resistance by multiplex PCR S.X. Chen*, J.N. Du*, L.N. Hao, C.Y. Wang, Q. Chen and Y.X. Chang College
Comparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing
Comparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing Hamid Ashrafi Amanda M. Hulse, Kevin Hoegenauer, Fei Wang,
Report of the. Tomato Genetics Cooperative
Report of the Tomato Genetics Cooperative Volume 58 September 2008 THIS PAGE IS INTENTIONALLY BLANK Report of the Tomato Genetics Cooperative Foreword Number 58- September 2008 University of Florida Gulf
GBS Usage Cases: Examples from Maize
GBS Usage Cases: Examples from Maize Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell IGD/CBSU Workshop June 17 18, 2013 Some
Erhard et al. (2013). Plant Cell /tpc
Supplemental Figure 1. c1-hbr allele structure. Diagram of the c1-hbr allele found in stocks segregating 1:1 for rpd1-1 and rpd1-2 homozygous mutants showing the presence of a 363 base pair (bp) Heartbreaker
The tomato genome re-seq project
The tomato genome re-seq project http://www.tomatogenome.net 5 February 2013, Richard Finkers & Sjaak van Heusden Rationale Genetic diversity in commercial tomato germplasm relatively narrow Unexploited
Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping
Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,
Spotty results in our Sw-7 tomato spotted wilt virus research. J.W. Scott, S.F. Hutton, S.M. Olson, and M.R. Stevens
Spotty results in our Sw-7 tomato spotted wilt virus research J.W. Scott, S.F. Hutton, S.M. Olson, and M.R. Stevens Florida Principle Tomato Producing Areas Gadsden Oxford Palmetto- Ruskin Wimauma Ft Pierce
Genomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company
A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine
Name Class Date. a. identify similarities and
Chapter 13 enetic Engineering Chapter Test A Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. Selective breeding produces a. more offspring.
Development of Kompetitive Allele Specific PCR Markers for Submergence Tolerant Gene Sub1 in Rice
Plant Breed. Biotech. 2019 (March) 7(1):62~66 https://doi.org/10.9787/pbb.2019.7.1.62 RAPID COMMUNICATION Online ISSN: 2287-9366 Print ISSN: 2287-9358 Development of Kompetitive Allele Specific PCR Markers
Using molecular marker technology in studies on plant genetic diversity Final considerations
Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!
Fresh Market Tomato Breeding at the University of Florida
Fresh Market Tomato Breeding at the University of Florida J. W. Scott Gulf Coast Research and Education Center IFAS, University of Florida 14625 CR 672, Wimauma, FL 33598, USA 813-633-4135 jwsc@ufl.edu
Identifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
Development of SNP markers linked to the Downy Mildew Resistance Gene Pl 8 in Sunflower
Development of SNP markers linked to the Downy Mildew Resistance Gene Pl 8 in Sunflower Lili Qi 1, Zahirul Talukder 2 Brent Hulke 1, Michael Foley 1 1 USDA-ARS, Northern Crop Science Laboratory 2 NDSU,
Genetics and Biotechnology. Section 1. Applied Genetics
Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section
Introgression Browser tutorial
Introgression Browser tutorial EU-TransPLANT Training course: exploring plant variation data Jan-Peter Nap, Sven Warris, Saulo Alves Aflitos Access at EBI: Family name A-I, please use: http://10.7.243.39:10000
Usage Cases of GBS. Jeff Glaubitz Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager
Usage Cases of GBS Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell CBSU Workshop Sept 15 16, 2011 Some potential applications
Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were
Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were processed following GBS experimental design 1 and bioinformatics
Applying Genotyping by Sequencing (GBS) to Corn Genetics and Breeding. Peter Bradbury USDA/Cornell University
Applying Genotyping by Sequencing (GBS) to Corn Genetics and Breeding Peter Bradbury USDA/Cornell University Genotyping by sequencing (GBS) makes use of high through-put, short-read sequencing to provide
Gene-Based Markers for the Tomato Yellow Leaf Curl Virus Resistance Gene Ty-3
Plant Breed. Biotech. 2016 (February) 4(1):79~86 http://dx.doi.org/10.9787/pbb.2016.4.1.79 RESEARCH ARTICLE Online ISSN: 2287-9366 Print ISSN: 2287-9358 Gene-Based Markers for the Tomato Yellow Leaf Curl
Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato
Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Sanjeev K Sharma Cell and Molecular Sciences The 3 rd Plant Genomics Congress, London 12 th May 2015 Potato
Funded by the Overseas Development Administration (ODA)
Centre for Arid Zones Studies, University of Wales, UK Cambridge Laboratory, Norwich, UK ICRISAT, India Funded by the Overseas Development Administration (ODA) Early papers on QTL mapping Staple food crop
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
Map-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
Single cell genomic sequencing in plants: current possibilities and limitations
Single cell genomic sequencing in plants: current possibilities and limitations Sateesh Kagale December 2015 Canola Innovation Day Genomic sequencing one cell as a time Genome Information by organism The
Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
Usp14 EPD0582_2_G09. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
Microsatellite markers
Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.
B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).
Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are
Existing potato markers and marker conversions. Walter De Jong PAA Workshop August 2009
Existing potato markers and marker conversions Walter De Jong PAA Workshop August 2009 1 What makes for a good marker? diagnostic for trait of interest robust works even with DNA of poor quality or low
Supplemental Figure Legends
Supplemental Figure Legends Fig. S1 Genetic linkage maps of T. gondii chromosomes using F1 progeny from the ME49 and VAND genetic cross. All the recombination points were identified by whole genome sequencing
Crash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
Plant Breeding and Agri Genomics. Team Genotypic 24 November 2012
Plant Breeding and Agri Genomics Team Genotypic 24 November 2012 Genotypic Family: The Best Genomics Experts Under One Roof 10 PhDs and 78 MSc MTech BTech ABOUT US! Genotypic is a Genomics company, which
Introduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
Genomic Technologies. Michael Schatz. Feb 1, 2018 Lecture 2: Applied Comparative Genomics
Genomic Technologies Michael Schatz Feb 1, 2018 Lecture 2: Applied Comparative Genomics Welcome! The primary goal of the course is for students to be grounded in theory and leave the course empowered to
KASP troubleshooting guide
extraction sequencing genotyping extraction sequencing genotyping extraction sequencing genotyping extraction sequencing KASP troubleshooting guide Contents of this guide 1 Introduction 2 Common causes
Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection
Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection Presented by: Ruth Wagner August 5, 2014 SOY2014 Rico Caldo,Vergel Concibido,
HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers
HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers Lecture 7. Populations The foundation of any crop improvement program is built on populations. This session will explore population
Recombinant DNA Libraries and Forensics
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 A. Library construction Recombinant DNA Libraries and Forensics Recitation Section 18 Answer Key April 13-14, 2005 Recall that earlier
BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture
BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency
Brassica carinata crop improvement & molecular tools for improving crop performance
Brassica carinata crop improvement & molecular tools for improving crop performance Germplasm screening Germplasm collection and diversity What has been done in the US to date, plans for future Genetic
Genotyping Dairy Cattle Samples with Infinium BovSNP50 BeadChips and VeraCode Universal Oligo Beads
Genotyping Dairy Cattle Samples with Infinium BovSNP50 BeadChips and VeraCode Universal Oligo Beads Dr. Michael Cowan General Manager Genetic Visions, Inc. Traditional Pedigree Selection Sire of Sire Sire
Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
Gene Mapping in Natural Plant Populations Guilt by Association
Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato
Agricultural Applications for Genome Sequencing
Agricultural Applications for Genome Sequencing AEIC April 2012 Presented by Joe Clarke, NGS Platform Lead, Syngenta RTP NC 2 Syngenta at Home and Abroad Who we are and what we do Syngenta is one of the
Current Applications and Future Potential of High Resolution Melting at the National Clonal Germplasm Repository in Corvallis, Oregon
Current Applications and Future Potential of High Resolution Melting at the National Clonal Germplasm Repository in Corvallis, Oregon Nahla Bassil 1, Michael Dossett 2, Vidyasagar Sathuvalli 2, Chad Finn
Multiplex SNP Genotyping of Field Corn Crude Samples with Probe-Based Assays using the IntelliQube from Douglas Scientific INTRODUCTION
PARTNERING WITH YOU TO MAKE THE WORLD A BETTER PLACE with Probe-Based Assays using the IntelliQube from ABSTRACT Single Nucleotide Polymorphism (SNP) genotyping must be accurate, reliable, cost-effective,
Genome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression
Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing
GDMS Templates Documentation GDMS Templates Release 1.0
GDMS Templates Documentation GDMS Templates Release 1.0 1 Table of Contents 1. SSR Genotyping Template 03 2. DArT Genotyping Template... 05 3. SNP Genotyping Template.. 08 4. QTL Template.. 09 5. Map Template..
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
Guide to running KASP genotyping on the ABI 7500 instrument
extraction sequencing genotyping extraction sequencing genotyping extraction sequencing genotyping extraction sequencing genotypin Guide to running KASP genotyping on the ABI 7500 instrument Contents of
Introduction to Animal Breeding & Genomics
Introduction to Animal Breeding & Genomics Sinead McParland Teagasc, Moorepark, Ireland Sinead.McParland@teagasc.ie Overview Changes to traditional animal breeding Using DNA in animal breeding What is
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for
Authors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
AmpFlSTR Identifiler PCR Amplification Kit
Product Bulletin Human Identification AmpFlSTR Identifiler PCR Amplification Kit Fifteen STR (short tandem repeat) loci and Amelogenin co-amplified in a single tube Incorporation of the same proven, reliable
High-Density SNP Genotyping of Tomato (Solanum lycopersicum L.) Reveals Patterns of Genetic Variation Due to Breeding
High-Density SNP Genotyping of Tomato (Solanum lycopersicum L.) Reveals Patterns of Genetic Variation Due to Breeding Sung-Chur Sim 1, Allen Van Deynze 2, Kevin Stoffel 2, David S. Douches 3, Daniel Zarka
The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow
The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,
I.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
Mapping and Mapping Populations
Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)
Illumina Genome Analyzer. Progenika Experience. - Susana Catarino -
Illumina Genome Analyzer Progenika Experience - Susana Catarino - Who are we? 2000 PROGENIKA BIOPHARMA Development, production and commercialization of new genomic tools for diagnosis, prognosis and drug-response
Your name: BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07
BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07 KEY 1. What are each of the following molecular markers? (Indicate (a) what they stand for; (b) the nature of the molecular polymorphism and (c)
latestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe
Overviewof Illumina s latestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe Seminar der Studienrichtung Tierwissenschaften, TÜM, July 1, 2009 Overviewof Illumina
Bioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
The SolCAP Tomato Phenotypic Data: Estimating Heritability and Trait BLUPs. Dr. Heather L. Merk The Ohio State University, OARDC
The SolCAP Tomato Phenotypic Data: Estimating Heritability and Trait BLUPs Dr. Heather L. Merk The Ohio State University, OARDC Before Moving Forward, You May Wish to Download, install, and open R R is
Pathway approach for candidate gene identification and introduction to metabolic pathway databases.
Marker Assisted Selection in Tomato Pathway approach for candidate gene identification and introduction to metabolic pathway databases. Identification of polymorphisms in data-based sequences MAS forward
PCR thermo-cycling conditions N of cycles. Isolate Locus Amplification primers. Method. Final step
Table S4 PCR-based methods and thermo-cycling conditions for determining the HD1, HD2, STE3_Mr4, Mr_Ph4 and STE3_Mr1 alleles, transcription of A and B mating genes, TAIL-PCR and SSR analysis in the M.
International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México. ccmaize
International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México Choice of Marker Systems and Genotyping Platforms Yunbi Xu International Maize and Wheat Improvement
Analysis of genome-wide genotype data
Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version
Module 1 Principles of plant breeding
Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant
Chapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
Applications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
Human genome sequence February, 2001
Computational Molecular Biology Symposium March 12 th, 2003 Carnegie Mellon University Organizer: Dannie Durand Sponsored by the Department of Biological Sciences and the Howard Hughes Medical Institute
Major Genes Conditioning Resistance to Rust in Common Bean. and a Protocol for Monitoring Local races of the Bean Rust Pathogne
Major Genes Conditioning Resistance to Rust in Common Bean and a Protocol for Monitoring Local races of the Bean Rust Pathogne M.A. Pastor-Corrales Soybean Genomics and Improvement Laboratory, ARS-USDA,
The Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience
Building Excellence in Genomics and Computational Bioscience Wheat genome sequencing: an update from TGAC Sequencing Technology Development now Plant & Microbial Genomics Group Leader Matthew Clark matt.clark@tgac.ac.uk
Molecular markers in plant breeding
Molecular markers in plant breeding Jumbo MacDonald et al., MAIZE BREEDERS COURSE Palace Hotel Arusha, Tanzania 4 Sep to 16 Sep 2016 Molecular Markers QTL Mapping Association mapping GWAS Genomic Selection
The international effort to sequence the 17Gb wheat genome: Yes, Wheat can!
ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC
INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS
ORIGINAL: English DATE: October 21, 2010 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E GUIDELINES FOR DNA-PROFILING: MOLECULAR MARKER SELECTION AND DATABASE CONSTRUCTION (
GENOTYPING-BY-SEQUENCING USING CUSTOM ION AMPLISEQ TECHNOLOGY AS A TOOL FOR GENOMIC SELECTION IN ATLANTIC SALMON
GENOTYPING-BY-SEQUENCING USING CUSTOM ION AMPLISEQ TECHNOLOGY AS A TOOL FOR GENOMIC SELECTION IN ATLANTIC SALMON Matthew Baranski, Casey Jowdy, Hooman Moghadam, Ashie Norris, Håvard Bakke, Anna Sonesson,
WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR. Eleventh Session Madrid, September 16 to 18, 2008
ORIGINAL: English DATE: September 16, 2008 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR
Digital genotyping of sorghum a diverse plant species with a large repeat-rich genome
Morishige et al. BMC Genomics 2013, 14:448 METHODOLOGY ARTICLE Open Access Digital genotyping of sorghum a diverse plant species with a large repeat-rich genome Daryl T Morishige 1, Patricia E Klein 2,
Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
SNP Validation. Dr Sarah Parker and Mr John Robinson August 2014
SNP Validation Dr Sarah Parker and Mr John Robinson August 2014 H E A D O F F I C E : M E R T O N H O U S E, C R O E S C A D A R N C L O S E, C A R D I F F C F 2 3 8 H F U K A L S O O F F I C E S A T L
13-2 Manipulating DNA Slide 1 of 32
1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study
Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
MHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells
DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned
SSR Markers for DNA Fingerprinting and Diversity Analysis of Sugarcane Cultivars Resistant and Susceptible to Red Rot
Pak-US Science and Technology Co-operative Research Project SSR Markers for DNA Fingerprinting and Diversity Analysis of Sugarcane Cultivars Resistant and Susceptible to Red Rot *Dr. Shahid Afghan, **Dr.