Original article High-resolution melting and real-time PCR for quantification and detection of drug-resistant HBV mutants in a single amplicon
|
|
- Osborn Gaines
- 6 years ago
- Views:
Transcription
1 Antivirl Therpy 01; 17: (doi: /IMP0) Originl rticle High-resolution melting nd rel-time PCR for quntifiction nd detection of drug-resistnt HBV mutnts in single mplicon Chi-Chieh Hsio 1, Julin Chng 1, Jeng-You Wu 1, Wn-Hsin Liu 1,, Shih-Yun Hn 1, Pei-Jer Chen 1,3,, Shiou-Hwei Yeh 1,,5 * 1 NTU Center for Genomic Medicine, Ntionl Tiwn University College of Medicine, Tipei, Tiwn Deprtment of Microbiology, Ntionl Tiwn University College of Medicine, Tipei, Tiwn 3 Grdute Institute of Clinicl Medicine, Ntionl Tiwn University College of Medicine, Tipei, Tiwn Deprtment of Internl Medicine, Ntionl Tiwn University College of Medicine, Tipei, Tiwn 5 Deprtment of Lbortory Medicine, Ntionl Tiwn University Hospitl, Tipei, Tiwn *Corresponding uthor e-mil: shyeh@ntu.edu.tw These uthors mde n equl contribution to this work Bckground: Antivirl therpy by nucleoside/nucleotide nlogues (NAs) effectively reduces HBV repliction in chronic heptitis B (CHB) ptients. Becuse long-term NA tretments will eventully select for drug- resistnt mutnts, erly detection of mutnts nd frequent monitoring of virl lods is crucil for successful NA therpy. Becuse no efficient test for one-tube quntifiction nd qulifiction of vrious HBV-resistnt mutnts exists, we propose to use high-resolution melting (HRM) nlysis in combintion with rel-time PCR to chieve this unmet need. Methods: We developed single mplicon for detecting HBV mutnts resistnt to lmivudine (LMV), defovir (ADV) nd entecvir (ETV), which re commonly used for CHB tretment. Our design consists of two steps: rel-time PCR for virl quntifiction, nd hybridiztion probe HRM nlysis for detection of specific drugresistnt mutnts. Results: Assy quntifiction ws ccurte (R=0.98) for virl lods from 10 3 to 10 9 copies/ml. HRM nlysis produced distinct melting tempertures tht clerly distinguished the mutnts, rtm0v/i (LMV), rta181v nd rtn36t (ADV), nd rtt18g nd rtm50v (ETV), from their respective wild types. The ssy detected mutnts t only 10 5% of the HBV popultion. The clinicl pplicbility of this ssy ws tested in pilot study with seril smples from ptients receiving LMV tretment. Conclusions: Flexibility, speed nd cost-efficiency re dditionl benefits unique to our ssy. The clinicl smple results further support the fesibility of pplying our design to frequent nd long-term monitoring of CHB ptients receiving NA tretments in the clinicl setting. Introduction Of the estimted 350 million people who suffer from persistent HBV infection, 15 0% re expected to develop liver cirrhosis, liver filure or heptocellulr crcinom [1 3]. Orlly dministered nucleoside/nucleotide nlogues (NAs) hve been shown to control nd prevent progression of liver disese in ptients with chronic heptitis B (CHB) infections []. By blocking the ctive site of the HBV reverse trnscriptse (RT), NAs terminte DNA synthesis nd thus inhibit virl repliction. Although effective in preventing disese dvncement, NAs cnnot ffect covlently closed circulr DNA to erdicte existing viruses. As result, long-term usge of NAs will eventully select for drug-resistnt mutnts with specific muttions in the virl RT domin [5]. At present, the most commonly used NAs for HBV re lmivudine (LMV), defovir (ADV) nd entecvir (ETV), ech with unique muttion ptterns for drug resistnce. LMV, type of L-nucleoside, displys resistnt muttions t rtm0i nd rtm0v; the ltter muttion is usully ccompnied by compenstory muttion t rtl180m. ADV, n cyclic phosphontes gunosine nlogue, displys resistnt muttions t rta181v/t in the B 01 Interntionl Medicl Press (print) (online) 91
2 C-C Hsio et l. domin nd rtn36t in the D domin. ETV, potent cyclopentne, displys two complex muttion ptterns: rtm50v ±rti169t+rtm0v+rtl180m, nd rtt18g+rts0i+rtm0v+rtl180m [5]. The bsence of proofreding functions in HBV RT contributes to the formtion of diverse virl qusispecies nd the subsequent emergence of drug-resistnt mutnts [6]. Erly detection of these mutnts during the course of therpy is vitl for two resons. First, NA therpies hve limited therpeutic effect fter the emergence of drug resistnce [7]. Becuse genotypic resistnce leds to virl brekthrough, virl rebound, lnine minotrnsferse elevtion nd liver disese progression, erly mutnt detection llows for tretment modifictions to void the development of drug resistnce [8]. Secondly, erly mutnt detection prevents high virl lods, which require more time to suppress to undetectble levels. The longer the time required to rech complete virl suppression, the higher the risk of developing drug resistnce [9]. Therefore, regulr monitoring of virl lods nd erly detection of drug resistnce mutnts is essentil to successful NA-bsed HBV therpy. Current ssys for detecting nd monitoring drug resistnce include virl lod ssys, DNA sequencing, DNA hybridiztion, INNO-LiPA nd so forth [8,10]. However, these methods shre mjor shortcoming: the inbility to determine virl lod nd detect NAresistnt mutnts in single-tube ssy, which mkes these methods lbour-intensive nd expensive. A new high-throughput screening nd monitoring method tht elimintes this shortcoming is n unmet clinicl need. We proposed to use high-resolution melting (HRM) nlysis in combintion with rel-time PCR to chieve this gol. The technique uses the DNA property of het seprtion. When this property is used in rel-time PCR instruments with sturtion dyes tht fluoresce in the presence of double-strnded DNA, HRM becomes powerful tool for muttion scnning [11 15]. When hybridiztion probes especilly designed to nnel to specific trget sites re dded, hybridiztion probebsed HRM is cpble of type-specific qulittive differentition of mutnts in virology [16 0]. Becuse sturtion dyes used for HRM cn lso be used for rel-time quntifiction nlysis, we imed to integrte rel-time PCR nd probe HRM to develop one-tube ssy for determining HBV virl lod nd identifying drug-resistnt mutnts. Our results supported the ppliction of our one-tube ssy for virl lod determintion nd LMV, ADV nd ETV resistnt muttion detection in single mplicon. Our pltform demonstrtes gret potentil for clinicl ppliction owing to its flexibility, specificity, speed nd cost-efficiency in screening nd quntifying LMV, ADV nd ETV drugresistnt mutnts in genotype B nd C HBV. Methods Sturtion dye nd ssy design The design principles of our ssy re outlined in Figure 1. Our ssy consists of two successive steps completed in the sme rection tube: step 1 for virl quntifiction nd step for the mutnt detection. The dye used in this study for both rel-time PCR nd probe HRM ws High Resolution Melting Dye (Roche Dignostics Applied Science, Mnnheim, Germny), which is fluorescence dye tht binds to double-strnded DNA in sturted mnner. This sturtion binding qulity enbles the detection of single bse pir chnges in DNA frgments up to 00 bp by melting curve nlysis. Therefore, the use of this sturtion dye is crucil for our ssy design, which ims to identify drug resistnce mutnts by their nucleotide chnges. The fluorescence ws detected for rel-time DNA quntifiction in step 1 nd for probe HRM nlysis in step. Primer nd probe set design In this study, we focused on genotype B nd C HBV for their prevlence in Asi nd Tiwn [1]. For ccurte quntifiction of genotype B nd C HBV, primers were crefully designed on the bsis of genetic dt compiled from 175 genotype B nd 75 genotype C HBV (from the NCBI dtbse). To ensure dequte mplifiction, primers (ConsF nd ConsR) were designed to nnel to consensus regions with >90% sequence conservtion in genotype B nd C HBV. Sequence vritions between genotype B nd C were overcome by incorporting degenerte nucleotides into the primers. The resulting mplicon ws 53 bp nd included ll the primry muttion sites for LMV, ADV nd ETV (Tble 1 nd Figure A). The melting profile of PCR product depends on intrinsic qulities such s GC content, length nd sequence. Therefore, the melting temperture (T m ), the temperture t which fluorescence is 50% of the mximum, is lso chrcteristic of the sequence. For most humn genes, subtle genetic chnges within PCR product with less thn 00 bp cn be esily detected by nlysing melting peks generted by HRM nlysis with sturtion dyes. However, in the cse of our lrge (53 bp) HBV genome mplicon tht contins complex genome vritions, dditionl hints re required to discern specific mutnts from their respective wild types. The use of hybridiztion probes, 30 0 bp oligonucleotides with 3 -phosphoryltion, ws the solution []. In hybridiztion probe HRM, melting profiles re dictted by probes, which cn be designed to specificlly cover primry muttion sites corresponding to NA-resistnt HBV mutnts. This is dvntgeous becuse only vritions within the nneling region contribute to the T m chnge; this bypsses 9 01 Interntionl Medicl Press
3 One-tube HBV quntifiction nd drug-resistnt mutnt detection the complex melting profiles owing to genome vrition in different HBV genotypes. Therefore, probes used for HRM cn be tilored to show distinctive T m profiles for mutnt detection (Figure 1, step ). The principles used in primer design were lso pplied to probe design. To simplify melting profiles, inosines were incorported to msk sequence polymorphisms between genotypes B nd C in the hybridizing region Figure 1. Overview of the principles nd methods used in the design of the ssy Step 1. Rel-time PCR for quntifiction Step. HRM nlysis for mutnt detection OH Adding probes 3 Probe T m (Perfect mtch) 5 Temperture Sturted dye for high resolution nd ccurte DNA quntifiction Probe T m (Mismtch) OH 3 5 Fluorescence (65 510) Std, 1x10 9 copies/ml Smples Std, 1x10 3 copies/ml -(df/dt) Fluoresence Probe Whole mplicon Cycles Temperture, C Stndrd curve Crossing point Std curve Stds Smples -(df/dt) Fluorescence Mismtch Perfect mtch Whole mplicon Log concentrtion Temperture, C Detils described in Methods. The design comprises two successive steps. (Step 1) Asymmetric rel-time PCR for mplifiction nd DNA quntifiction by comprison with stndrds (Stds) rnging from 10 3 to 10 9 copies/ml. (Step ) Hybridiztion probe-bsed high-resolution melting (HRM) nlysis to generte melting profiles with chrcteristic melting temperture (T m ) vlues, the temperture t which fluorescence is 50% of the mximum, for type-specific mutnt identifiction. Sturtion dyes tht fluoresce in the presence of double-strnded DNA were essentil for both steps. -(df/dt), the negtive derivtive of fluorescence with respect to temperture. Antivirl Therpy
4 C-C Hsio et l. Tble 1. DNA sequence of primers nd probes used in this study for detecting lmivudine-, defovir- nd entecvir-resistnt HBV mutnts Position, Amplicon Sequence (5 3 ) nucleotides b Length, bp T m, C c Forwrd primer (ConsF) 5 -CAAAACCTWCGGACGGAAACTG (mplicon: 53 bp) Reverse primer (ConsR) 5 -TGGCGAGAAAGTRAAAGCCTG LM0 (probe) 5 -GCTTTCCCCCACTGTITGGCTTTCAGTTATATGGATGATGTGGT Wild type: 7.8 (rtm0v: ATG GTG; rtm0i: ATG ATT) rtm0v: rtm0i: 70.1 AD181 (probe) 5 -GGAGTGGGCCTCAGTCCGTTTCTCITGGCTCAGTTTACTAGTGCC Wild type: 78.8 (rta181v: GCT GTT) Mutnt type: 75. AD36 (probe) 5 -ACCAATTTTCTTTGCTCTTTGGGTATACATGTIACCCCT Wild type: 67.0 (rtn36t: AAC ACC c ) Mutnt type: 68.9 ET18 (probe) 5 -GGAGTGGGCCTCAGTCCGTTTCTCITGGCTCAGTTTACTAGTGCC Wild type: 78.9 (rtt18g: ACT GGT) Mutnt type: 76.1 ET50 (probe) 5 -CTTAACTTCATGGGATATGTAATTGGIAGTTGGGGIAC Wild type: 69.0 (rtm50v: ATG GTG) Mutnt type: 66.1 The underlines represent the muttion sites for specific drug resistnce. The 3 -ends of the probes were phosphorylted to prevent probe elongtion by Tq polymerse during PCR. Polymorphic nucleotides for muttion detection re lbelled in bold. b Nucleotide positions re derived from the sequence of HBV subtype yr (GenBnk ccession number NC_003977). Degenerte nucleotides (W=A/T trnsversion; R=A/G trnsition) nd inosines (I) were used in primers nd probes, respectively, to msk genotypic vritions. c Note tht AD36 ws designed to mtch the mutnt. bp, bse pir; T m, melting temperture, the temperture t which fluorescence is 50% of the mximum. [3]. The LMV probe, nmed LM0, ws designed to detect the rtm0v/i muttion. The ADV probes, nmed AD181 nd AD36, were designed to detect rta181v/t nd rtn36t muttions. To simplify the process of detecting ETV-resistnt HBV, which shows complex muttion ptterns, we focused on detecting only the primry, unique nd prerequisite ETV resistnce muttions: rt18g nd rtm50v. ET18 nd ET50 were designed to detect these muttions, respectively. With the exception of probe AD36, ll probes in this study were designed to perfectly complement the wild-type sequence. Considering tht the melting pek T m will be lowered by the introduction of dditionl nucleotide mismtches within the nneling sequence, mino cid chnges becuse of different or multiple nucleotide substitutions could ll be detected by their respective probes. Also, probes could be used to detect other drug-resistnt muttion ptterns in its nneling region; for exmple, probe LM0 could be used to detect the minor ETV muttion t rts0i. The probes were designed with the flexibility to be used individully or collectively with other probes; for exmple, ET18 nd ET50 could be used to simultneously detect one of the two complex muttion ptterns of ETV drug resistnce. Although multiple probes cn be pplied t once, the simultneous ppliction of no more thn three probes is recommended to void complicted melting profiles. In the cse in which more thn three probes re required for screening, the PCR product cn be divided into liquots exceeding the 6 ml minimum for detection of specific drug-resistnt mutnts by dding different probes. The reltive primer nd probe nneling positions on the HBV genome re shown in Figure A nd the DNA sequences re summrized in Tble 1. Primers were synthesized by Mission Biotech (Tipei, Tiwn) nd the probes were synthesized by Prism Biotech (Tipei, Tiwn). DNA templte As pilot study to test the concept of our ssy, we constructed representtive drug resistnce mutnt tht included the following LMV, ADV nd ETV muttions: rtm0v/i, rta181v, rtn36t, rtt18g nd rtm50v. Plsmid pb10-5 ws chosen s the DNA templte to optimize experimentl conditions, ssess quntifiction ccurcy nd test probe nd primer design. pb10-5 ws constructed by cloning monomer of the genotype B HBV genome (nucleotides 1 318) into vector pgem3z []. The drug-resistnt muttions were introduced into pb10-5 using the Quick- Chnge Site-Directed Mutgenesis Kit (Strtgene, L Joll, CA, USA) ccording to the mnul instructions. For rtm0v/i, nucleotides GTG (Vl) nd ATT (Ile) were respectively substituted for ATG (Met). For rta181v, nucleotides GTT (Vl) were substituted for GCT (Al). For rtn36t, nucleotides ACC (Thr) were substituted for AAC (Asn). For rtt18g, nucleotides GGT (Gly) were substituted for ACT (Thr). For rtm50v, nucleotides GTG (Vl) were substituted for ATG (Met). The results of site-directed mutgenesis were confirmed by sequencing. Drug-resistnt mutnt quntifiction nd differentition Our design contined two successive steps. The first step ws rel-time PCR for virl quntifiction nd the second step ws probe HRM nlysis for type-specific 9 01 Interntionl Medicl Press
5 One-tube HBV quntifiction nd drug-resistnt mutnt detection Figure. Detection of HBV mutnts resistnt for lmivudine, defovir nd entecvir by HRM A nt 571~59 AD181 ConsF AD LM0 ConsR ET18 ET50 nt 108~110 Primry muttion site of drug resistnce LMV: rtm0v/i ADV: rta181t/v, rtn36t ETV: rts18g, rtm50v B C D LMV ADV ETV -(df/dt) Wild type rtm0i rtm0v Wild type rta181v rtn36t Wild type rtt18g rtm50v Temperture, C Temperture, C Temperture, C LM0 AD36 AD181 ET50 ET18 Wild type rtm0i rtm0v Wild type rta181v rtn36t Wild type rtt18g rtm50v (A) Reltive primer nd probe nneling positions in the pb10-5 mplicon. Representtive results from high-resolution melting (HRM) probe nlysis to identify (B) lmivudine (LMV)-, (C) defovir (ADV)- nd (D) entecvir (ETV)-resistnt HBV mutnts in single mplicon. The presented melting peks hd sufficiently different melting temperture vlues, the temperture t which fluorescence is 50% of the mximum, to clerly differentite drug-resistnt mutnts from wildtype HBV. nt, nucleotide; -(df/dt), the negtive derivtive of fluorescence with respect to temperture. mutnt identifiction (Figure 1). Both steps were completed with LightCycler 80 (Roche Dignostics Applied Science). To fcilitte mutnt identifiction in HRM nlysis, unequl primer concentrtions were used to generte the probe nneling strnd in excess during symmetric PCR in step 1. The 0 ml PCR regent in DNA quntifiction included: ml DNA templte, 10 ml LightCycler 80 Mster Mix, which contined FstStrt Tq DNA Polymerse, dntp mix nd High Resolution Melting Dye (Roche Dignostics Applied Science), 3. ml of 5 mm MgCl, ml H O, 0. ml of mm forwrd primer nd 0. ml of 10 mm reverse primer. Empiricl trils were conducted to determine the optimum primer rtio (forwrd:reverse =0.0:0. mm) tht yielded good PCR efficiency in step 1 without jeoprdizing melting pek resolution in step. The following PCR protocol ws used for DNA quntifiction: preincubtion t 95 C for 10 min; nd mplifiction t 95 C for 10 s, 60 C for 15 s nd 7 C for 5 s for 0 cycles. Fluorescence ws detected t the end of ech cycle for DNA quntifiction. After DNA quntifiction in step 1, the regent concentrtions were djusted to mm MgCl nd 0.5 M probe for HRM nlysis in step. The following Antivirl Therpy
6 C-C Hsio et l. protocol ws used to generte the melting peks for type-specific mutnt identifiction: DNA denturtion t 95 C for 1 min; probe nneling t 0 C for 1 min; nd probe nd DNA denturtion from 65 to 95 C t 0.0 C/s rmp rte. Fluorescence ws detected continuously from 65 to 95 C to generte melting pek dt, which were plotted s the negtive derivtive of fluorescence with respect to temperture (-df/dt) s shown in melting profiles in the figures. The risks of contmintion while djusting the MgCl nd dding probes for the qulifiction in step were minimized by: centrifuging the multi-tube rection plte for min t 1,500 g before removing the LightCycler 80 seling foil to ensure tht the 0 ml rection mixture ws t the bottom of ech of the 00 ml v-shped rection tube; including negtive controls throughout the ssy; nd renewing the seling foil before probe HRM. Another intrinsic gurd ginst DNA contmintion ws the lck of DNA mplifiction in the probe HRM qulifiction step of our protocol. Without mplifiction, it is unlikely tht reltively minute foreign DNA could significntly lter qulifiction results. Sensitivity of drug-resistnt muttion detection Assy sensitivity in detecting the presence of minor mutnt popultions mong wild types is importnt becuse drug resistnce begins with the ppernce of the first drug-resistnt mutnt. To determine the sensitivity of our ssy, mutnt nd wild-type pb10-5 were mixed in the following proportions: 50% (1:1), 5% (1:3) nd 10% (1:9). Probe HRM ws used to determine the lowest proportion of mutnts required to disply cler melting pek for mutnt identifiction. Clinicl smples To determine the clinicl pplicbility of this study, we first ssessed the ccurcy of DNA quntifiction. Using well-estblished protocol previously developed in this lbortory [5], we obtined 1 smples of genotype B nd C HBV ser DNA extrcts. Quntifiction of these extrcts ws completed using the forementioned primers nd protocol. The quntifiction dt were then correlted to virl lod dt determined by the estblished quntittive rel-time PCR ssy [5]. Next, we tested the clinicl pplicbility of our ssy concept nd the efficcy of our probes nd primers by monitoring virl lods nd screening drug-resistnt mutnts in clinicl smples. Four LMV-treted ptients (Ptients A D) were enrolled for our pilot study. Ptients A, B nd C were heptitis B e-ntigen-negtive wheres ptient D ws heptitis B e-ntigen-positive. Ptients A nd B were dignosed with liver cirrhosis wheres Ptients C nd D were dignosed with CHB. We collected ser smples from these ptients t different time points throughout their LMV monotherpy. To determine the potentil of our ssy to be used for frequent nd long-term monitoring of the development drugresistnt HBV in ptients, we processed these smples using our ssy, which included rel-time PCR DNA quntifiction nd LM0 probe HRM for LMV-resistnt mutnt detection. To further test the pplicbility of our proposed ssy on clinicl smples, we included dditionl ptient serum smples for probe HRM testing. Twelve smples were obtined from ptients tht hd not received ny NA tretment, nd thus displyed wildtype sequences for ll residues relted to drug resistnce. The remining 10 mutnt smples contined five rtm0v nd five rtm0i mutnts; they were included to test the pplicbility of our HRM in drugresistnt mutnt detection. Results Drug-resistnt mutnt detection by HRM nlysis with hybridiztion probes To determine the efficcy of the designed probes for type-specific muttion differentition, we pplied the probes ssocited with ech drug simultneously to wild-type nd mutnt HBV constructs derived by sitedirected mutgenesis of pb10-5 (rtm0v/i, rta181v nd rtn36t, rtt18g nd rtm50v). For LMV in Figure B, probe LM0 showed distinct T m vlues for rtm0i (70.1 C), rtm0v (70.7 C) nd wild type (7.8 C). For ADV in Figure C, probes AD181 nd AD36 clerly distinguish mutnts rta181v (75. C) nd rtn36t (68.9 C) from their respective wild types (T m =78.8 C nd 67.0 C). For ETV in Figure D, probes ET18 nd ET50 lso clerly distinguished mutnts rtt18g (76.1 C) nd rtm50v (66.1 C) from their respective wild types (T m =78.9 C nd 69.0 C). Overll, mutnts were clerly distinguishble from their respective wild types becuse of sufficient differences between their T m vlues, which rnged from 1.9 to 3. C s summrized in Tble 1. Assy sensitivity in detecting mutnt mong wild type Assy sensitivity is determined by the lowest proportion of mutnts mong wild type to produce cler mutnt melting pek. This sensitivity is relted to the efficcy of HRM s method of muttion screening. To test the sensitivity of our probes, we pplied them to pb10-5 constructs contining different proportions of mutnts nd wild type. Probes LM0 (Figure 3A nd 3B), AD181 (Figure 3C), ET18 (Figure 3E) nd ET50 (Figure 3F) confirmed the presence of mutnts t concentrtions s low s 10% of the HBV popultion; probe AD36 (Figure 3D) detected the presence of mutnts t 5% of the popultion. Overll, this ssy cn clerly Interntionl Medicl Press
7 One-tube HBV quntifiction nd drug-resistnt mutnt detection identify the presence of mutnts t only 10 5% of the virl popultion. Accurcy of DNA quntifiction One of the benefits of our ssy is speed becuse of its bility to qulify nd quntify mutnt HBV in onetube ssy. To determine the ccurcy of DNA quntifiction of this ssy, stndrd curve ws first generted by seril dilution of pb10-5 from to copies/ml s shown in Figure A nd B. The mplifiction efficiency ws found to be 1.70 with the slope -.3 nd the liner rnge is from 10 3 to copies/ml. For further verifiction of ssy quntifiction ccurcy, we correlted virl lod dt obtined using our ssy to the dt obtined by the well-estblished nd widely used rel-time PCR quntifiction ssy [5]. The correltion of quntifiction dt for these 1 genotype B nd C clinicl smples is displyed in Figure C. The virl titres determined by these two methods showed high correltion of R=0.98, which confirmed the quntifiction ccurcy of our ssy. Clinicl pplictions To test the clinicl pplicbility of our ssy, we conducted pilot test with ser smples collected from liver cirrhosis nd CHB ptients receiving LMV monotherpy. Following rel-time PCR mplifiction for quntifiction, we used probe HRM to complete LMVresistnt mutnt screening. The virl lods nd melting pek results of the three ser smples from ech of the four prticipting ptients re displyed in Figure 5. The ser smples were collected t seril time points during their tretment: smples in Figure 5A were collected before tretment; smples in Figure 5B were collected during tretment before the development of drug resistnce; nd smples in Figure 5C were collected fter LMV-resistnt mutnts were detected. The virl lods were lso ssessed by the forementioned Figure 3. Assy sensitivity for detecting lmivudine, defovir nd entecvir mutnts mong wild-type HBV A rtm0v wt C E -(df/dt) 3 3 rta181v wt 3 rtt18g wt B rtm0i wt D F rtm50v wt -(df/dt) 3 3 wt rtn36t Temperture, C Temperture, C Temperture, C Mutnt proportion 0% 10% 5% 50% 100% (A&B) Probe LM0, (C) probe AD181, (D) probe AD36, (E) probe ET18 nd (F) probe ET50 re shown. Overll, ssy sensitivity ws high s mutnts comprising only 10 5% of the popultion produced clerly distinguishble melting peks. wt, wild type; -(df/dt), the negtive derivtive of fluorescence with respect to temperture. Antivirl Therpy
8 C-C Hsio et l. Figure. Accurcy of HBV DNA quntifiction of the ssy A B Fluorescence (65 510) copies/ml 10 3 copies/ml Crossing point copies/ml Liner regression Crossing point Slope =-.3 PCR efficiency = copies/ml Cycle number Log concentrtion C HBV DNA by this ssy, log copies/ml R= HBV DNA by the stndrd ssy, log copies/ml (A) Amplifiction curves of seril dilutions. (B) Stndrd curve derived from smples in (A). (C) Correltion of 1 DNA quntifictions dt by our ssy nd the stndrd rel-time PCR quntifiction ssy. A good correltion (R=0.98) verified the quntifiction ccurcy of our proposed ssy. well-estblished quntifiction ssy; these results re included in prentheses in Figure 5. Overll, virl lods in Figure 5A were higher thn their respective smples in Figure 5B. Following this initil decrese, virl lods from smples in Figure 5B were observed to rebound to their respective Figure 5C vlues. Furthermore, the virl rebound observed in Figure 5C corresponds to the first-time detection of drugresistnt mutnts since the strt of LMV monotherpy s indicted by the presence of mutnt melting peks with lower T m vlues. The presence of drug-resistnt mutnts ws ech confirmed by DNA sequencing. Sequencing results indicted the presence of mutnt rtm0i (ATG ATT) in Ptients A, B nd D, nd mutnt rtm0v (ATG GTG) in Ptient C. In ddition to the rtm0i muttion, the mutnts in Ptient B were lso discovered to hve two non-specific nucleotide chnges (ntg707a nd nta731t) in the probe nneling region. This explined the T m drop observed in Figure 5C for Ptient B. Overll, the corresponding DNA quntifiction nd DNA sequencing results strongly supported the possibility of pplying our ssy to the clinicl setting s method of frequent nd longterm HBV monitoring nd mutnt screening. Furthermore, we included dditionl clinicl specimens to test the pplicbility of our proposed ssy for clinicl use. The probe LM0 results showed tht the T m vlues for the 1 wild-type smples closely mtched tht of the wild-type plsmid control (Additionl file 1). Although ech of the five smples contining rtm0v or rtm0i showed minor T m shifts from their respective plsmid controls, their T m vlues were still clerly distinguishble from tht of the wild-type plsmid control (Additionl file 1). Therefore, probe LM0 clerly nd ccurtely identified these clinicl smples s wild type or mutnts. Moreover, the results from testing the ADV nd ETV probes on the 1 wild-type specimens lso showed T m vlues tht mostly overlpped with T m vlues of the plsmid controls (Additionl file ). Although minor T m shifts were detected in few smples, most of the clinicl wild-type T m vlues remined clerly differentible from the T m of the mutnt plsmid being scnned for by the probe Interntionl Medicl Press
9 One-tube HBV quntifiction nd drug-resistnt mutnt detection Figure 5. Assy DNA quntifiction nd qulifiction results for clinicl smples obtined from four lmivudine monotherpy ptients with the proposed ssy A Ptient A Ptient B Ptient C Ptient D -(df/dt) ( ) ( ) ( ) ( ) B -(df/dt) ( ) (ND) (ND) ( ) C -(df/dt) ( ) ( ) ( ) b ( ) b c d Temperture, C Temperture, C Temperture, C Temperture, C Quntifiction dt obtined using the proposed ssy mirrored the dt obtined by the well-estblished quntifiction ssy (shown in prentheses). The ser smples were collected t different points during drug therpy: (A) pre-tretment, (B) during tretment before virl rebound nd (C) fter virl rebound. In (B) nd (C), the blck lines indicte the wild type HBV nd the grey lines indicte the drug resistnt HBV mutnts. Wild type melting pek. b rtm0i mutnt melting pek. c Melting pek of rtm0i nd two dditionl non-specific muttions in probe nneling region. d rtm0v mutnt melting pek. ND, not detected; -(df/dt), the negtive derivtive of fluorescence with respect to temperture. Discussion The primers designed in this study produced 53 bp mplicon contining the common muttion sites for LMV, ADV nd ETV resistnce. These primers were eqully effective when pplied to clinicl smples for virl DNA quntifiction. With the exception of probe AD36, the hybridiztion probes designed for this study produced mutnt melting peks with T m vlues tht were between 1.9 nd 3. C lower thn their respective wild types. Becuse probe AD36 ws designed to mtch the mutnt, the mutnt T m ws 1.9 C higher thn the wild type T m (Figure B, C nd D, nd Tble 1). These T m differences were sufficient to llow cler differentition of mutnts from their respective wild type, which not only supported the concept of using probe HRM for type-specific mutnt detection, but lso the effectiveness of our designed probes. In ddition to ccurte mutnt screening, the sensitivity of muttion screening of our ssy ws high becuse it is ble to qulify mutnts comprising only 10 5% of the HBV popultion (Figure 3). Furthermore, the ccurcy of DNA quntifiction for this ssy ws lso high s evidenced by the R=0.98 correltion of quntifiction dtsets from our ssy to the stndrd quntifiction ssy in Figure C. These results indicte our ssy to be n effective, sensitive nd ccurte method for single-tube quntifiction of virl lods nd qulifiction of LMV, ADV nd ETV resistnt HBV mutnts. Similrly promising results were lso observed when our ssy ws pplied to clinicl smples. For ll four ptients in this study, mutnt screening results by our ssy corresponded to sequencing results, which verified the ccurcy of probe HRM for mutnt HBV screening. Additionlly, virl lod quntifiction results obtined using our ssy not only corresponded to quntifiction dt obtined from well-estblished quntifiction essy (vlue in prentheses), but lso mirrored chnges in the ptients NA monotherpy nd disese progression: in response to initil LMV monotherpy, the virl lod decresed (Figure 5A nd 5B); following continuous LMV Antivirl Therpy
10 C-C Hsio et l. Tble. DNA sequence vrition in the primer nneling regions of type A D HBV Position, Primer nucleotides b Sequence (5 3 ) c ConsF C A A A A C C T W C G G A C G G A A A C T G Type A (10 sequences) A 137 T 1 T 139 Type B (175 sequences) A 17 Type C (75 sequences) T 7 Type D (153 sequences) C 137 T 19 T 17 ConsR T G G C G A G A A A G T R A A A G C C T G Type A (10 sequences) A 71 Type B (175 sequences) A 170 Type C (75 sequences) G 55 Type D (153 sequences) G 1 Compiled from 10 type A, 175 type B, 75 type C nd 153 type D sequences b Nucleotide positions re derived from the sequence of HBV subtype yr (GenBnk ccession number NC_003977). c Nucleotides with mismtch rte >0% for ech HBV genotype re mrked in bold. Subscripts indicte the number of smples with tht mismtch. R, A/G degenerte nucleotides; W, A/T degenerte nucleotides. tretment, virl rebound occurred nd LMV-resistnt mutnts were detected (Figure 5C). Despite the presence of dditionl nucleotide chnges in clinicl smples, ll probes designed for this study were ble to clerly nd ccurtely distinguish wild type from LMV-resistnt clinicl smples by scnning for the rtm0v/i muttion (Additionl files 1 nd ). Therefore, our proposed ssy demonstrtes gret potentil for clinicl ppliction despite the more frequent presence of dditionl nucleotide chnges in clinicl smples. In summry, our pilot study indicted tht rel-time PCR nd probe HRM combine to form single-tube ssy tht produces relible nd ccurte results for monitoring NA therpy. The clinicl pplicbility of our proposed ssy on other types of NA therpies is opened for further testing upon the vilbility of seril non-lmv clinicl smples. In ddition to its ccurcy nd sensitivity, mny other qulities mke our ssy promising method for frequent nd long-term monitoring of NA therpy in CHB ptients. Flexibility: multiple unlbelled probes cn interrogte different regions of PCR product simultneously [6]. Specificity: probe sets cn be designed to identify specific drug-resistnt mutnts s opposed to merely detecting the presence of muttions in the PCR product. Speed: qulifiction nd quntifiction cn be completed subsequently in the sme rection tube. The entire process, strting from loding regents to producing results, requires only 3 h. Cost-effectiveness: the simple nd fst protocol for HRM reduces fixed nd vrible cost. These qulities mke HRM prticulrly useful in Asi, where CHB infection is endemic nd economic constrints often limit tretment strtegy nd success [7]. The dvntges of HRM re even more evident when it is compred with other vilble methods for mutnt detection nd quntifiction. DNA sequencing is the gold stndrd for mutnt detection becuse of its bility to detect ll muttions in the HBV genome. However, this comprehensiveness is chieved t the expense of speed nd sensitivity becuse DNA sequencing is lengthy process tht cnnot detect minor species comprising less thn 0 30% of the popultion. Other detection methods include the line probe ssy, DNA chip technology, peptide nucleic cid crmping, fluorescent biprobe hybridiztion nd mtrix-ssisted lser desorption/ioniztion time-of-flight mss spectrometry-bsed genotyping [10]. Although these methods re more sensitive thn DNA sequencing nd possibly more sensitive thn our ssy, they re too expensive nd time consuming to be routinely pplied for stndrd clinicl monitoring. Therefore, the potentil clinicl vlue of our ssy is even more evident becuse it bypsses the shortcomings tht prevent other methods from being regulrly used in the clinicl setting. A potentil limittion of our ssy in mutnt detection needs to be tken into considertion: non-trget nucleotide vrition of the HBV genome within the probe nneling region my result in unpredictble T m (such s tht shown for ptient B in Figure 5). In this cse, sequence nlysis needs to be conducted to determine the exct sequence of the detected muttion. In this study, the probes were dded fter the quntifiction step to chieve good melting profiles. Our reson for seprtely dding the probes ws to void berrnt melting profiles obtined in optimiztion trils in which ll regents were loded together. A possible explntion for these irregulr melting profiles is incomplete or unstble 3 -phosphoryltion on the probes. Therefore, improved probe blocking, with mino-modified C6, inverted dt, or C3 spcer blockers, could llow the seprte quntifiction nd qulifiction steps in this study to be merged into one [8]. This combintion would further stremline our ssy to one Interntionl Medicl Press
11 One-tube HBV quntifiction nd drug-resistnt mutnt detection Tble 3. DNA sequence vrition in the probe nneling regions of type A D HBV Position, Probe nucleotidesb Sequence (5 3 ) c AD181 G T G C C T G G T ET G G A G T G G G C C T C A G T C C G T T T C T C I T G G C T C A G T T T A C T A Type A T 13 Type B T 171 Type C C 7 Type D C 16 C 139 LM G C T T T C C C C C A C T G T I T G G C T T T C A G T T A T A T G G A T G A T G Type A T 10 C 116 Type B C 169 Type C T 6 Type D T 151 AD A C C A A T T T T C T T T T G T C T T T G G G T A T A C A T T T I A C C C C T Type A A 138 A 10 Type B A 156 A 175 Type C G 173 A 75 Type D A 15 A 153 ET C T T A A C T T C A T G G G A T A T G T A A T T G G I A G T T G G G G I A C Type A A 93 T 79 A A Type B G 136 C 15 Type C A 66 T 63 Type D T 11 A 137 T 17 C 107 C 18 A 17 T 11 A 1 T 13 G 19 T 17 Compiled from 10 type A, 175 type B, 75 type C nd 153 type D sequences. b Nucleotide positions re derived from the sequence of HBV subtype yr (GenBnk ccession number NC_003977). c Nucleotides with mismtch rte >0% for ech HBV genotype re mrked in bold. Subscripts indicte the number of smples with tht mismtch. R, A/G degenerte nucleotides; W, A/T degenerte nucleotides. Antivirl Therpy
12 C-C Hsio et l. of even higher throughput, nd thus mke it n even more prcticl option for use in the clinicl setting. Although the focus of this study ws on genotype B nd C HBV for their prevlence in Asi, we investigted the possibility of expnding our ssy design to include genotype A nd D HBV. After compring nucleotide vribility in the primer nd probe regions of 73 full-length HBV sequences, we discovered reltively high sequence conservtion in ll nneling regions. The following results re summrized in Tbles nd 3. The forwrd primer used in this study showed two mismtches to genotype A (nucleotides 58 nd 590) nd genotype D (nucleotides 57 nd 590); the reverse primer showed no mismtches. The probes used in this study showed the following mismtches: probe LM0 mismtched genotype A sequence t one nucleotide (nucleotide 733); probe ET18 nd AD181 mismtched genotype D t one nucleotide (nucleotide 655); probe ET50 mismtched genotype A t two nucleotides (nucleotides 868 nd 880), nd genotype D t nine nucleotides (nucleotides 866, 868, 871, 880, 886, 893, 897, 898 nd 90). Becuse probe AD36 ws designed to perfectly mtch the mutnt insted of the wild type, it mismtched ll genotypes t one nucleotide (nucleotide 83). Therefore, in theory, only minor modifictions re needed to pply our ssy in the form of primer nd probe design in order pply our proposed ssy to genotype A nd D HBV. Although the probes designed for our ssy cn only detect resistnce to LMV, ADV nd ETV, which represent ll three clsses of NAs nd only three of five pthwys of drug resistnce development, the concept of our ssy hs much broder pplictions. By pplying our principles of probe nd primer design, nd conducting more optimiztion trils, our proposed ssy cn theoreticlly be pplied to screen for both known nd new drugresistnt mutnts. Even though our proposed ssy my require DNA sequencing to decode unknown muttion ptterns, our ssy still hs much clinicl usefulness for the following resons: the emergence of mutnts cn be rpidly identified upon the detection of ny previously bsent melting peks; nd s tool for long-term monitoring, ptient history will probbly limit the number of possible mutnts for screening, which would limit the occsions requiring DNA sequencing. In conclusion, our study supports the fesibility of using rel-time PCR nd probe HRM for quntifying nd qulifying multiple HBV virl mutnts in single mplicon. The flexible, specific, rpid nd inexpensive qulities of our ssy further underscore its importnce s prcticl method for frequent nd long-term monitoring of NA-bsed CHB therpy. Acknowledgements The study ws supported by Ntionl Reserch Progrm of Genomic Medicine, Ntionl Science Council, Tiwn (NSC B ); Ntionl Reserch Progrm for Biophrmceuticls, Ntionl Science Council, Tiwn (NSC B ); nd by the Ntionl Helth Reserch Institutes, Tiwn (NHRI-EX BI). The uthors lso thnk the Microbil Genomics Core lbortory t the NTU Center for Genomic Medicine of Ntionl Tiwn University College of Medicine for quntifiction of HBV titres of ptient serum smples. Disclosure sttement The uthors declre no competing interests. Additionl files Additionl file 1: Probe LM0 high-resolution melting (HRM) results for wild-type nd lmivudinemutnt clinicl smples cn be found online t OA-07_Hsio_Add_file1.pdf Additionl file : Results from screening 1 wild-type clinicl smples with defovir nd entecvir probes cn be found online t uplods/documents/avt-11-oa-07_hsio_add_ file.pdf References 1. Lee WM. Heptitis B virus infection. N Engl J Med 1997; 337: Lvnchy D. Heptitis B virus epidemiology, disese burden, tretment, nd current nd emerging prevention nd control mesures. J Virl Hept 00; 11: Dienstg JL. Heptitis B virus infection. N Engl J Med 008; 359: Hoofngle JH, Doo E, Ling TJ, Fleischer R, Lok AS. Mngement of heptitis B: summry of clinicl reserch workshop. Heptology 007; 5: Brtholomeusz A, Locrnini SA. Antivirl drug resistnce: clinicl consequences nd moleculr spects. Semin Liver Dis 006; 6: Ghny M, Ling TJ. Drug trgets nd moleculr mechnisms of drug resistnce in chronic heptitis B. Gstroenterology 007; 13: Liw YF, Chien RN, Yeh CT. No benefit to continue lmivudine therpy fter emergence of YMDD muttions. Antivir Ther 00; 9: Zoulim F, Locrnini S. Heptitis B virus resistnce to nucleos(t)ide nlogues. Gstroenterology 009; 137: e. 9. Europen Assocition for the Study of the Liver. EASL clinicl prctice guidelines: mngement of chronic heptitis B. J Heptol 009; 50: Yeon JE. Technique for the erly detection of drug-resistnt HBV DNA during ntivirl therpy. Intervirology 008; 51 Suppl 1: Interntionl Medicl Press
13 One-tube HBV quntifiction nd drug-resistnt mutnt detection 11. Montgomery JL, Snford LN, Wittwer CT. High-resolution DNA melting nlysis in clinicl reserch nd dignostics. Expert Rev Mol Dign 010; 10: Wittwer CT. High-resolution DNA melting nlysis: dvncements nd limittions. Hum Mutt 009; 30: Vossen RH, Aten E, Roos A, den Dunnen JT. Highresolution melting nlysis (HRMA): more thn just sequence vrint screening. Hum Mutt 009; 30: Erli M, Voelkerding KV, Wittwer CT. High resolution melting pplictions for clinicl lbortory medicine. Exp Mol Pthol 008; 85: Reed GH, Kent JO, Wittwer CT. High-resolution DNA melting nlysis for simple nd efficient moleculr dignostics. Phrmcogenomics 007; 8: Steer PA, Kirkptrick NC, O Rourke D, Noormohmmdi AH. Clssifiction of fowl denovirus serotypes by use of high-resolution melting-curve nlysis of the hexon gene region. J Clin Microbiol 009; 7: Tjiri-Utgw E, Hr M, Tkhshi K, Wtnbe M, Wkit T. Development of rpid high-throughput method for high-resolution melting nlysis for routine detection nd genotyping of noroviruses. J Clin Microbiol 009; 7: Lin JH, Tseng CP, Chen YJ, et l. Rpid differentition of influenz A virus subtypes nd genetic screening for virus vrints by high-resolution melting nlysis. J Clin Microbiol 008; 6: Toi CS, Dwyer DE. Differentition between vccine nd wild-type vricell-zoster virus genotypes by high-resolution melt nlysis of single nucleotide polymorphisms. J Clin Virol 008; 3: Dmes S, Pttison DC, Bromley LK, Wittwer CT, Voelkerding KV. Unlbeled probes for the detection nd typing of herpes simplex virus. Clin Chem 007; 53: Crmn W, Thoms H, Domingo E. Virl genetic vrition: heptitis B virus s clinicl exmple. Lncet 1993; 31: Zhou L, Myers AN, Vndersteen JG, Wng L, Wittwer CT. Closed-tube genotyping with unlbeled oligonucleotide probes nd sturting DNA dye. Clin Chem 00; 50: Mrgrf RL, Mo R, Wittwer CT. Msking selected sequence vrition by incorporting mismtches into melting nlysis probes. Hum Mutt 006; 7: Shih YH, Yeh SH, Chen PJ, et l. Heptitis B virus quntifiction nd detection of YMDD mutnts in single rection by rel-time PCR nd nneling curve nlysis. Antivir Ther 008; 13: Yeh SH, Tsi CY, Ko JH, et l. Quntifiction nd genotyping of heptitis B virus in single rection by reltime PCR nd melting curve nlysis. J Heptol 00; 1: Zhou L, Wng L, Plis R, Pryor R, Wittwer CT. Highresolution DNA melting nlysis for simultneous muttion scnning nd genotyping in solution. Clin Chem 005; 51: Liw YF. Antivirl therpy of chronic heptitis B: opportunities nd chllenges in Asi. J Heptol 009; 51: Dmes S, Mrgrf RL, Pttison DC, Wittwer CT, Voelkerding KV. Chrcteriztion of berrnt melting peks in unlbeled probe ssys. J Mol Dign 007; 9: Accepted My 011; published online 16 December 011 Antivirl Therpy
Best Practices for PCR Assays in Seed Health Tests Version 3.0; June 2018
Best Prctices for PCR Assys in Seed Helth Tests Version 3.0; June 2018 Polymerse Chin Rection (PCR) is currently the most commonly utilized moleculr technique in seed helth testing. This document provides
More informationNonlinear Mixed Effects Model for Swine Growth
Nonliner Mixed Effects Model for Swine Growth A. P. Schinckel nd B. A. Crig Deprtment of Animl Sciences nd Deprtment of Sttistics, Purdue University Introduction Severl nonliner growth functions model
More informationThree-Phase Wound-Rotor Induction Machine with Rotor Resistance
Exercise 2 Three-Phse Wound-Rotor Induction Mchine with Rotor Resistnce EXERCISE OBJECTIVE When you hve completed this exercise, you will know the effects of vrying the rotor resistnce of three-phse wound-rotor
More informationSUPPLEMENTARY INFORMATION
SI Fig. PrpS is single copy gene k 3. 9... EcoRV EcoRV k 5 BmH Pst c well k HindIII HindIII HindIII.3.5 3.. Southern lots of Ppver genomic DNA from plnts with SS8 hplotypes, hyridized with PrpS proe..
More informationEFFECT OF FOLIAR CHAPERONE TM APPLICATIONS UNDER ELEVATED TEMPERATURES ON THE PROTEIN CONCENTRATIONS AND PHYSIOLOGICAL RESPONSES OF COTTON
AAES Reserch Series 521 EFFECT OF FOLIAR CHAPERONE TM APPLICATIONS UNDER ELEVATED TEMPERATURES ON THE PROTEIN CONCENTRATIONS AND PHYSIOLOGICAL RESPONSES OF COTTON R.S. Brown nd D.M. Oosterhuis 1 RESEARCH
More informationBiofilm Formation by Escherichia coli csga and fima mutants
Journl of Undergrdute Reserch t Minnesot Stte University, Mnkto Volume 14 Article 9 2014 Biofilm Formtion by Escherichi coli csga nd fima mutnts Nicole Snyder Minnesot Stte University, Mnkto Sen Willert
More informationAn insight into itraq: where do we stand now?
Anlyticl nd Bionlyticl Chemistry Electronic Supplementry Mteril An insight into itraq: where do we stnd now? Croline Evns, Josselin Noirel, Sw Yen Ow, Mlind Slim, An G. Pereir-Medrno, Nrciso Couto, Jgroop
More informationInvasive Pneumococcal Disease Quarterly Report. January March 2017
Invsive Pneumococcl Disese Qurterly Report Jnury Mrch 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Ali Bormn Helen Heffernn My 2017 Acknowledgements This report could not
More informationDetection of amplified Y chromosome-specific sequence by capillary electrophoresis with laser-induced fluorescence*
FERTILITY AND STERILITY Copyright @ 1995 Americn Society for Reproductive Medicine Vol. 64, No., August 1995 Printed on cid free pper in U. S. A. Detection of mplified Y chromosome-specific sequence by
More informationHigh strength fine grained structural steel, thermo-mechanically rolled, for high temperature application
P420M HT High strength fine grined structurl steel, thermo-mechniclly rolled, for high temperture ppliction Specifiction DH-E52-D, edition April 2016 1 P420M HT is high strength thermomechniclly rolled
More informationPrimer in Population Genetics
Primer in Popultion Genetics Hierrchicl Orgniztion of Genetics Diversity Primer in Popultion Genetics Defining Genetic Diversity within Popultions Polymorphism number of loci with > 1 llele Number of lleles
More information6.1 Damage Tolerance Analysis Procedure
6. Dmge Tolernce Anlysis Procedure For intct structure the nlysis procedures for Slow Crck Growth nd Fil Sfe structure re essentilly the sme. An initil flw is ssumed nd its growth is nlyzed until filure
More informationFluorescence Intensities of. GFP-PAC-1 Strains
DOI: 10.1038/ncb3168 Arbitrry Fluorescence Units 2500 2000 1500 1000 500 0 full length (1-4) Fluorescence Intensities of GFP-PAC-1 Strins ΔPH 392-838 575-4 GFP-PAC-1 Strins 2-610 1-574 b control c pc-1(3
More informationThe Effect of SFAS No. 131 on the Diversification Discount
The Effect of SFAS No. 131 on the Diversifiction Discount Seoungpil Ahn Sogng Business School, Sogng University PA706, 35 Bekbeom-ro, Mpo-gu, Seoul 121-742, Kore E-mil: sphn@sogng.c.kr Received: July 2,
More informationChickpeas Respond Well To Inoculation With TagTeam
Chickpes Respond Well To Inocultion With TgTem S.M. Phelps, nd E. Hgele Philom Bios Inc., 318-111 Reserch Drive, Ssktoon, SK S7N 3R2 Abstrct Rhizobi strins were tested in TgTem pet nd grnule formultions
More informationA Little More Advanced Biotechnology Tools. Engineered plasmids. Selection for plasmid uptake. Better Plasmids. Antibiotic becomes a selecting agent
A Little More Advnced Biotechnology Tools Better Plsmids Engineered plsmids Building custom plsmids restriction enzyme sites ntibiotic resistnce genes s selectble mrker EcoRI BmHI HindIII restriction sites
More informationWestern Illinois University- School of Agriculture Organic Research Program 2013 Dry Humate/Fertility Studies Dr. Joel Gruver and Andy Clayton
Western Illinois University- School of Agriculture Orgnic Reserch Progrm 0 Dry Humte/Fertility Studies Dr. Joel Gruver nd Andy Clyton Introduction Orgnic grin frmers generlly use less purchsed inputs thn
More informationNumerical Analysis of a Reinforced Concrete Slab-Column Connection Subjected to Lateral & Vertical Loading
, Mrch 15-17, 2017, Hong Kong Numericl Anlysis of Reinforced Concrete Slb-Column Connection Subjected to Lterl & Verticl Loding Mostfiz Emtiz, A.S.M. Aluddin Al Azd, H. M. Shhin b nd Sultn Al Shfin c Abstrct
More informationChapter 9. Quadratics
Chpter 9 Qudrtics Artificil Body Prts 9.1 Solving Qudrtic Equtions by Fctoring 9. Completing the Squre 9.3 The Qudrtic Formul 9.4 Eponentil Functions (Growth nd Decy) Chpter Review Chpter Test 147 Section
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture10177 MDYKDHDGDYKDHDIDYKDD DDKMAPKKKRKVGIHGVPAA MAERPFQCRICMRKFAQSGD LTRHTKIHTGEKPFQCRICM RNFSRSDVLSEHIRTHTGEK PFACDICGKKFADRSNRIKH TKIHTGSQKPFQCRICMRNF SRSDNLSEHIRTHTGEKPFA
More information2nd International Conference on Electronic & Mechanical Engineering and Information Technology (EMEIT-2012)
2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-2012) Comprehensive Evlution of Air Conditioning Cold/Het Source System Bsed on Fuzzy Mthemtics Theory Gng
More informationp Coaches j i m Recruitment Dimensions Report Name Ali Example Date of Report: 29/06/2016 Elements report 3
Report Nme Ali Exmple Dte of Report: 29/06/2016 Elements report 3 Also Recommended: Trit Profile, Competency Report Who could use components of this report: p Coches j i HR professionls Trined prctitioners
More informationWeb Crippling of Wide Deck Sections
Missouri University of Science nd Technology Scholrs' Mine Interntionl Specilty Conference on Cold- Formed Steel Structures (1990) - 10th Interntionl Specilty Conference on Cold-Formed Steel Structures
More informationEffect of Tantalum Additions to a Cobalt-Chromium-Nickel
Effect of Tntlum Additions to Coblt-Chromium-Nickel Bse Alloy A. P. ROWE, W. C. BIGELOW, nd K. ASGAR University of Michign, School of Dentistry, Ann Arbor, Michign 48104, USA An investigtion by electron
More informationInterplay between NS3 protease and human La protein---- by Ray and Das Supplementary fig 1. NS3 pro
Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 1 1 2 3 4 UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES RNA ws UV-crosslinked to incresing concentrtions (0.1, 0.2 nd 0.4µM) in
More informationIn situ evaluation of DGT techniques for measurement of trace. metals in estuarine waters: a comparison of four binding layers
Electronic Supplementry Mteril (ESI) for Environmentl Science: Processes & Impcts. This journl is The Royl Society of Chemistry 2015 Supplementry Informtion for: In situ evlution of DGT techniques for
More information2016 Prelim Essay Question 2
216 Prelim Essy Question 2 In recent yers, the price of nturl fertilisers for orgnic brown rice production hs risen nd helthy living cmpigns re seeing more consumers switching from nonorgnic white rice
More informationThree-Phase Wound-Rotor Induction Machine with a Short- Circuited Rotor
Exercise 1 Three-Phse Wound-Rotor Induction Mchine with Short- Circuited Rotor EXERCISE OBJECTIVE When you hve completed this exercise, you will know how three-phse woundrotor induction mchine cn operte
More informationPERFORMANCE ANALYSIS OF HYBRID COOLING TOWER BASED ON THE EFFECTIVENESS-NTU APPROACH
Proceedings of the Asin Conference on Therml Sciences 2017, 1st ACTS Mrch 26-30, 2017, Jeju Islnd, Kore ACTS-P00478 PERFORMANCE ANALYSIS OF HYBRID COOLING TOWER BASED ON THE EFFECTIVENESS-NTU APPROACH
More informationEconomic Profitability and Sustainability of Canola Production Systems in Western Canada
Economic Profitility nd Sustinility of Cnol Production Systems in Western Cnd Elwin Smith, R. Blckshw, Agriculture nd Agri-Food Cnd (AAFC), Lethridge, AB, N. Hrker, J. O'Donovn, AAFC Lcome AB, S. Brndt,
More informationChandoga M., Jaroševič A., Sedlák J., Sedlák E. 3rd fib International Congress
Chndog M., Jroševič A., Sedlák J., Sedlák E. 3rd fib Interntionl Congress - 2010 EXPERIMENTAL AND IN SITU STUDY OF BRIDGE BEAMS SUPPORTED BY BOTTOM EXTERNAL TENDONS Doc. Ing. Miln Chndog, PhD., Projstr
More informationComparison of Two Different WeedGuardPlus Paper Mulches and Black Plastic Mulch on the Production of Onions and Broccoli
Comprison of Two Different WeedGurdPlus Pper Mulches nd Blck Plstic Mulch on the Production of Onions nd Broccoli Dr. Frnk Stonker, Colordo Stte University Deprtment of Horticulture nd Lndscpe Architecture,
More informationManaging corn earworm using GMO varieties, conventional and OMRI listed insecticides in sweet corn
Mnging corn erworm using GMO vrieties, conventionl nd OMRI listed insecticides in sweet corn Brin A. Nult 1, Dn Olmsted 2 nd Abby Semn 2, Deprtment of Entomology 1, New York Stte IPM Progrm 2, Cornell
More information[ HOCl] Chapter 16. Problem. Equilibria in Solutions of Weak Acids. Equilibria in Solutions of Weak Acids
Equilibri in Solutions of Wek Acids Chpter 16 Acid-Bse Equilibri Dr. Peter Wrburton peterw@mun.c http://www.chem.mun.c/zcourses/1011.php The dissocition of wek cid is n equilibrium sitution with n equilibrium
More informationProgress Report of Lettuce Field Tests in 2010 of Select Insecticides
Progress Report of Lettuce Field Tests in 2010 of Select Insecticides Vonny Brlow University of Cliforni, Agriculturl nd Nturl Resources Blythe, CA Abstrct The projects completed this pst summer sought
More informationEuropean Treaty Series - No. 158 ADDITIONAL PROTOCOL TO THE EUROPEAN SOCIAL CHARTER PROVIDING FOR A SYSTEM OF COLLECTIVE COMPLAINTS
Europen Trety Series - No. 158 ADDITIONAL PROTOCOL TO THE EUROPEAN SOCIAL CHARTER PROVIDING FOR A SYSTEM OF COLLECTIVE COMPLAINTS Strsbourg, 9.XI.1995 2 ETS 158 - Europen Socil Chrter (Additionl Protocol),
More informationObserving Patterns in Inherited Traits. Chapter 10
Observing Ptterns in Inherited Trits Chpter 10 10.1 Mendel, Pe Plnts, nd Inheritnce Ptterns By experimenting with pe plnts, Mendel ws the first to gther evidence of ptterns by which prents trnsmit genes
More informationCopyright 1982 by ASME. Combined Cycles
THE AMERICAN OCIETY OF MECHANICAL ENGINEER 345 E. 47 t., New York, N.Y. 117 82-GT-38 ^,+ w The ociety shll not be responsible for sttements or opinions dvnced in ppers or in C discussion t meetings of
More informationGuided Design of Heating and Cooling Mains for Lower Water and Energy Consumption and Increased Efficiency
Guided Design of Heting nd Cooling Mins for Loer Wter nd Energy Consumption nd Incresed Efficiency Vincent Gololo 1, Thoko Mjozi 1*, Toshko Zhelev 2, Krum Semkov 2 1 University of Pretori, Deprtment of
More informationChapter 2. Genotyping DNA Variants with High-Resolution Melting Analysis. Rolf H.A.M. Vossen. Abstract. 1 Introduction
Chapter 2 Genotyping DNA Variants with High-Resolution Melting Analysis Abstract High-resolution melting analysis (HRMA) is a simple, quick, and effective method to scan and screen PCR amplicons for sequence
More informationImpacts of Fe-Based Amorphous HB1 Core Transformers on Energy Efficiency and Environment Protection
Impcts of Fe-Bsed Amorphous HB1 Core Trnsformers on Energy Efficiency nd Environment Protection Chng-Hung Hsu, b, Yeong-Hw Chng Electricl Engineering, Chng Gung University, To-Yun, Tiwn, R.O.C. b Electric
More informationWesternBright TM MCF and MCF-IR
WesternBright TM MCF nd MCF-IR Quntittive, multi-color fluorescent Western lotting kits WesternBright MCF visile nd ner infrred (IR) fluorescent Western lotting kits llow the ssy of two proteins t once,
More informationPAPER CHEMISTRY, APPLETON, WISCONSIN IPC TECHNICAL PAPER SERIES NUMBER 163 W. J. WHITSITT OCTOBER, 1985
163 THE INSTITUTE OF PAPER CHEMISTRY, APPLETON, WISCONSIN O E G? o IPC TECHNICAL PAPER SERIES NUMBER 163 O4 o= o COMPRESSIVE STRENGTH RELATIONSHIPS AND FACTORS, C) t C= c. Md Qy W. J. WHITSITT OCTOBER,
More informationSpatiotemporal Variability of Productivity and Nutrient Availability in Flooded Rice Soils across Field Scales
2006-2011 Mission Kerney Foundtion of Soil Science: Understnding nd Mnging Soil-Ecosystem Functions Across Sptil nd Temporl Scles Finl Report: 2007017, 1/1/2009-12/31/2009 Sptiotemporl Vribility of Productivity
More informationENVIRONMENTAL AUDIT OF THE SITES IMPACTED BY THE PROBO KOALA TOXIC WASTE DUMPING IN ABIDJAN, CÔTE D IVOIRE
ENVIRONMENTAL AUDIT OF THE SITES IMPACTED BY THE PROBO KOALA TOXIC WASTE DUMPING IN ABIDJAN, CÔTE D IVOIRE This series of fct sheets ws prepred s prt of UN Environment s environmentl udit of the sites
More informationCommutability of Reference Materials for a-fetoprotein in Human Serum
Commutbility of Reference Mterils for -Fetoprotein in Humn Serum Yuhong Yue, MM; Shunli Zhng, MD; Zhenzhen Xu, MM; Xi Chen, BSc; Qingto Wng, MM Context. Relible quntifiction of -fetoprotein (AFP) is criticl
More informationFibre-reinforced plastic composites Declaration of raw material characteristics Part 4: Additional requirements for fabrics
CEN/TC 249 N493 Dte: 2010-02 pren xxxx-4:2010 CEN/TC 249 Secretrit: NBN Fibre-reinforced plstic composites Declrtion of rw mteril chrcteristics Prt 4: Additionl requirements for fbrics Einführendes Element
More informationPre-Plant Broadcast Urea in Direct Seeding, A Logistical Return to the Past? Tom Jensen
Pre-Plnt Brodcst Ure in Direct Seeding, A Logisticl Return to the Pst? Tom Jensen Interntionl Plnt Nutrition Institute (IPNI), Northern Gret Plins Director 102-411 Downey Rd., Ssktoon, SK S7N 4L8 Ph: 306-652-3467
More informationLos Alamos NITRIC ACID VAPOR REMOVAL BY ACTIVATED, IMPREGNATED CARBONS. Gerry 0. Wood
Title: NITRIC ACID VAPOR REMOVAL BY ACTIVATED, IMPREGNATED CARBONS Author(s): Gerry. Wood Submitted to U.S. Army Edgewood Reserch, Development nd Engineering (ERDEC) Scientific Conference Los Almos NATIONAL
More informationEVALUATION OF STRIP-TILLAGE AND FERTILIZER PLACEMENT IN SOUTHERN IDAHO CORN PRODUCTION. D.Tarkalson and D. Bjorneberg USDA-ARS, Kimberly, ID
EVALUATION OF STRIP-TILLAGE AND FERTILIZER PLACEMENT IN SOUTHERN IDAHO CORN PRODUCTION D.Trklson nd D. Bjorneberg USDA-ARS, Kimberly, ID ABSTRACT Strip tillge (ST) nd ssocited nutrient plcement cn potentilly
More informationHow Variability in OSB Mechanical Properties Affects Biological Durability Testing
8 S.F. Curling et l.: Biologicl Durbility of OSB Holzforschung 57 (2003) 8 12 How Vribility in OSB Mechnicl Properties Affects Biologicl Durbility Testing By Simon F. Curling, Jerrold E. Winndy, Chrles
More informationTanya Aycan Baser and Marcello Baricco
Glss Rev.Adv.Mter.Sci. forming bility 18(2008) of 1-76 50 (M=none, Al, Nb) bulk metllic glsses 71 GLASS FORMING ABILITY OF (M=NONE, Al, Nb) BULK METALLIC GLASSES Tny Aycn Bser nd Mrcello Bricco Diprtimento
More informationtheir response to inoculation with the bacterium which causes walnut blight. Tested germplasm was selectedj for its unusual
WALNUT BLIGHT: SUSCEPTIBILITY OF GERMPLASM AND THE RETENTION OF OVERWINTERING PATHOGN POPULATIONS Keith Woeste, Gle McGrnhn, Roy Yri nd M.N. Schroth ABSTRACT Aspects of the susceptibility of English wlnu~
More informationH. Randall Smith; Ph.D. Agronomy and Wayne Porter: Ph.D. Horticulture Mississippi State University Extension Service
Effect of SumGrow on growth, development nd yield of Irish pottoes (Solnum tuerosum) t the Beumont Reserch Sttion (Mississippi Stte University) during 217 H. Rndll Smith; Ph.D. Agronomy nd yne Porter:
More informationTable 8. Vacuum filter performance for processing municipal sludges conditioned by ferric chloride and lime. a
Tble 8. Vcuum filter performnce for processing municipl sludges conditioned by ferric chloride nd lime. Type of Sludge Solids Loding (lb/hr-ft 2 ) Percent Solids Cke Fresh primry 6-8 25-38 Fresh primry
More informationA Genetic Algorithm based Approach for Cost worthy Route Selection in Complex Supply Chain Architecture
A Genetic Algorithm bsed Approch for Cost worthy Route Selection in Complex Supply Chin Architecture Arft Hbib ~, Nfi Rhmn*, Jhid Alm *, Asif Jorder *, Mrji Hque * ~ Deprtment of Computer Science nd Engineering,
More informationPlanning & Performance Reporting Officer. Job Description
1. Min purpose of the job Plnning & Performnce Reporting Mnger Job Description To work collbortively with theme tems nd other senior collegues to develop nd operte performnce reporting systems (including
More informationnm nm nm nm nm nm. Seed surface. oi-ab. oi-ad. ii-ab. ii-ad/endothelium. endosperm.
B 360-370nm Seed surfce oi- 90-100nm A 630-640nm oi-d ii- ii-d/endothelium 230-240nm 220-230nm 240-280nm 1mm endosperm C oi-d D ii-d/endothelium ii- endosperm Supplementry Figure 1 Cell wll thickness mesurements
More informationSupplemental Data. Antosz et al. Plant Cell (2017) /tpc SPT6/SPT6L. genomic DNA ACT2 +RT -RT +RT -RT
A B C SPT6/SPT6L genomic DNA ACT2 +RT -RT Col- seedlings +RT -RT PSB-D cells Supplementl Figure 1. Expression of SPT6L nd SPT6. (Supports Figure 1.) Trnscript levels of of SPT6L (At1g6544) nd SPT6 (At1g6321)
More information(b) Is already deposited in a waste disposal site without methane recovery.
TYPE III - OTHER PROJECT ACTIVITIES Project prticipnts must tke into ccount the generl guidnce to the methodologies, informtion on dditionlity, bbrevitions nd generl guidnce on lekge provided t http://cdm.unfccc.int/methodologies/sscmethodologies/pproved.html.
More informationSmall Business Cloud Services
Smll Business Cloud Services Summry. We re thick in the midst of historic se-chnge in computing. Like the emergence of personl computers, grphicl user interfces, nd mobile devices, the cloud is lredy profoundly
More informationHarmony/ESW An Agile Real-time Development Process. Jeff Vodov
Hrmony/ESW An Agile Rel-time Development Process Jeff Vodov Objectives Provide high-level overview of Hrmony Chllenges of SE nd SW Development Hrmony Best Prctices Rtionl / Telelogic Process Rodmp Provide
More informationOrganic Cover Crop Research at WSU Puyallup
Orgnic Cover Crop Reserch t WSU Puyllup Ferury 8 Crig Cogger, Andy Bry, nd Liz Myhre Wshington Stte University Puyllup Reserch nd Extension Center Astrct: Cover crops re loclly grown source of orgnic mtter
More informationCORRELATION BETWEEN MELT POOL TEMPERATURE AND CLAD FORMATION IN PULSED AND CONTINUOUS WAVE ND:YAG LASER CLADDING OF STELLITE 6
Proceedings of the st Pcific Interntionl Conference on Appliction of sers nd Optics 4 CORREATION BETWEEN ET POO TEPERATURE AN CA FORATION IN PUSE AN CONTINUOUS WAVE N:YAG
More informationEFFECT OF TEMPERATURE ON ADHESION OF CLAY SOIL TO STEEL
Cercetări Agronomice în Moldov Vol. XLV, No. 2 (150) / 2012 EFFECT OF TEMPERATURE ON ADHESION OF CLAY SOIL TO STEEL B. AZADEGAN 1, J. MASSAH 2 * *E-mil: jmssh@ut.c.ir Received April 14, 2012 ABSTRACT.
More informationThe economical and high-throughput detection and quantitation
Articles DOI:.38/s41551-017-0126-5 Multiplexed enrichment of rre DNA vrints vi sequence-selective nd temperture-robust mplifiction Luci R. Wu 1, Sherry X. Chen 1, Ylei Wu 2, Abhijit A. Ptel 3 nd Dvid Yu
More informationHUMAN RESOURCES MANAGEMENT REFORM TIME FRAME
Distribution: Restricted REPL.VII/4/R.10 1 October 2005 Originl: English Agend Item 10 English IFAD Consulttion on the Seventh Replenishment of IFAD s Resources Fourth Session Doh (Qtr), 1-2 October 2005
More informationSLASH PINE FAMILIES IDENTIFIED WITH HIGH RESISTANCE TO FUSIFORM RUST. C. H. Walkinshaw '
SLASH PINE FAMILIES IDENTIFIED WITH HIGH RESISTANCE TO FUSIFORM RUST C. H. Wlkinshw ' Abstrct.--Fusiform rust redily kills slsh pine, Pinus elliottii Engelm. vr. elliottii. When the number of rust-infected
More informationThe advanced agronomic training system in Morocco
The dvnced gronomic trining system in Morocco Firdwcy L. in Hervieu B. (ed.). Agronomic trining in countries the Mediterrnen region Montpellier : CIHEAM Options Méditerrnéennes : Série Etudes; n. 1988II
More informationCrop Performance and Plant Microbe-Interactions are Affected by the Sequence and Frequency of Pulse Crops in the Canadian Prairie
Crop Performnce nd Plnt Microbe-Interctions re Affected by the Sequence nd Frequency of Pulse Crops in the Cndin Pririe Nvrro-Borrell A 1,2 ; Di M 2 ; Hmel C 1,2 ; Fernndez MR 2 ; Gn Y 2 ; Germid J 1.
More informationEvaluation of Corn Varieties for Certified Organic Production Crawfordsville Trial, 1998
Evlution of Corn Vrieties for Certified Orgnic Production Crwfordsville Tril, 1998 Dr. Kthleen Delte, ssistnt professor, Depts. of Horticulture & Agronomy Kevin Vn Dee, frm superintendent, Southest Reserch
More informationTopic 7. Acids, Bases, Buffers, Titrations, Polyprotic acids
Topic 7 cids, Bses, Buffers, Titrtions, Polyprotic cids Conjugte cids & bses Strengths of cids & bses strong cid or strong bse is completely dissocited in queous solution. Wek cids nd Wek Bses Crboxylic
More informationFAILURE OF PINUS RADIATA VENEER IN TENSION ACROSS THE GRAIN
120 NOTE FAILURE OF PINUS RADIATA VENEER IN TENSION ACROSS THE GRAIN A. MICHELLE CARRINGTON, ROGER B. KEEY, Deprtment of Chemicl nd Process Engineering, University of Cnterbury, Christchurch, New Zelnd
More informationa b c Nature Neuroscience: doi: /nn.3632
c Supplementry Figure 1. The reltion etween stndrd devition (STD) nd men of inter-press intervls (IPIs) under different schedules. -c, Disproportionlly fster decrese of the stndrd devition compred to the
More informationBuilding better lithium-sulfur batteries: from LiNO 3 to solid oxide catalyst
Supplementry Informtion Building etter lithium-sulfur tteries: from LiN to solid oxide ctlyst Ning Ding, Ln Zhou, Chngwei Zhou, Dongsheng Geng, Jin Yng, Sheu Wei Chien, Zholin Liu, Mn-Fi Ng, Aishui Yu,
More informationConservation Tillage Strategies For Corn, Sorghum And Cotton
(93%) cotton nd percent lint ws similr in oth pickers. The 15-inch row system with 27 plnts/a gve higher lint yield (1491 l/a) compred to 4-inch row cotton with 5 plnts/a (136 l/a). Plnt cnopy closed 3
More informationrecessive lozenge-shaped-fly-eye "alleles" in trans: recessive lozenge-shaped-fly-eye "alleles" in trans:
Wht do we men (wht hve we ment) y " gene": Reding for lectures 15-17 (We F27, Fr F29, We M5) Chp 8: from 258 (Nonoverlpping...) to 261 ( Crcking) & from 285 (8.6) to 293 (end of "essentil concepts) Chp
More informationGLYPHOSATE AND PYRITHIOBAC (STAPLE ) COMBINATIONS IN ROUNDUP READY COTTON
GLYPHOSATE AND PYRITHIOBAC (STAPLE ) COMBINATIONS IN ROUNDUP READY COTTON Mrilyn R. McClellnd, Jim L. Brrentine, nd Oscr C. Sprks 1 RESEARCH PROBLEM The Roundup Redy (glyphoste-tolernt) system hs provided
More informationSoybean Fungicide and Insecticide Seed Treatments (2006 Final Report)
Soyen Fungicide nd Iecticide Seed Tretments (2006 Finl Report) Purpose: The ojective of this study ws to investigte new iecticide seed tretments for soye. Cruiser ws registered recently nd Gucho hs yet
More informationESTIMATION AND UTILIZATION OF STRUCTURE ANISOTROPY IN FORMING PIECES
www.cermics-silikty.cz Cermics-Silikáty 61 (), 141-146 (17) doi: 1.13168/cs.17.9 ESTIMATION AND UTILIZATION OF STRUCTURE ANISOTROPY IN FORMING PIECES MAROS MARTINKOVIC Slovk University of Technology in
More informationPREPARATION OF NOVOLACS USING PHENOLIC RICH COMPONENTS AS PARTIAL SUBSTITUTE OF PHENOL FROM BIOMASS PYROLYSIS OILS
, 251-257. ISSN 1011-3924 Printed in Ethiopi 2010 Chemicl Society of Ethiopi PREPARATION OF NOVOLACS USING PHENOLIC RICH COMPONENTS AS PARTIAL SUBSTITUTE OF PHENOL FROM BIOMASS PYROLYSIS OILS Xu Junming
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2885 kd M ΔNZipA 66.4 55.6 ZipA 42.7 34.6 6x His NiNTA 27.0 c 1.,, 2. evnescent field supported memrne Supplementry Figure 1 Experimentl ssy. () Illustrtion of protein interctions (dpted
More informationReturn Temperature in DH as Key Parameter for Energy Management
Interntionl OPEN ACCESS Journl Of Modern Engineering Reserch (IJMER) Return Temperture in DH s Key Prmeter for Energy Mngement Normunds Tlcis 1, Egīls Dzelzītis 2, Agnese Līckrstiņ 2 *JSC Rīgs siltums
More informationTHERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING
Journl of Mining nd Metllurgy, 38 (1 2) B (2002) 93-102 THERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING N.Mitevsk* nd @.D.@ivkovi}** *RTB BOR, Copper Institute, 19210 Bor, Yugoslvi
More informationThe Effect of Nitrogen Fertilizers (Urea, Sulfur Coated Urea) with Manure on the Saffron Yield
The Effect of Nitrogen Fertilizers (Ure, Sulfur Coted Ure) with Mnure on the Sffron Yield Seed Rezin nd Mjid Forouhr Soil nd Wter Deprtment griculturl Reserch Center of Khorsn Mshhd, Torough Sttion, 91735
More informationSimplified Calculation of Short-Term Deflection in Prestressed Two-Way Flat Slabs
ACI STRUCTURAL JOURNAL Title no. 103-S86 TECHNICAL PAPER Simplified Clcultion of Short-Term Deflection in Prestressed Two-Wy Flt Slbs by Shih-Ho Cho nd Antoine E. Nmn While the deflection control of reinforced
More informationDevelopment of Anisotropic Hyperelastic Model Considering Stress Softening
Development of Anisotropic Hyperelstic Model Considering Stress Softening Akihiro Mtsud University of Tsukub ECCMR205, Prgue Contents Introduction Objective Anisotropic Hyperelstic model Mteril Tests FEM
More informationHigh-voltage electric pulse welding of magnetic cores made of rings of magnetic soft alloy 49K2FA
IOP Conference Series: Mterils Science nd Engineering PAPER OPEN ACCESS High-voltge electric pulse welding of mgnetic cores mde of rings of mgnetic soft lloy 49K2FA To cite this rticle: A V Yudin et l
More informationElectronic supplementary information: High specific detection and near-infrared photothermal. therapy of lung cancer cells with high SERS active
Electronic supplementry informtion: High specific detection nd ner-infrred phototherml therpy of lung cncer cells with high SERS ctive ptmer-silver-gold shell-core nnostructures Ping Wu, Yng Go, Yimei
More informationSAMPLING INTENSITY AND NORMALIZATIONS: EXPLORING COST-DRIVING FACTORS IN NATIONWIDE MAPPING OF TREE CANOPY COVER
21 Joint Meeting of the Forest Inventory nd Anlysis (FIA) Symposium nd the Southern Mensurtionists SAMPLIG ITESITY AD ORMALIZATIOS: EXPRIG COST-DRIVIG FACTORS I ATIOWIDE MAPPIG OF TREE CAOPY COVER John
More informationEffect of Transplant Size on Yields and Returns of Bell Peppers. Nathan Howard, Brent Rowell, and John C. Snyder Department of Horticulture
Effect of Trnsplnt Size on Yields nd Returns of Bell Peppers Nthn Howrd, Brent Rowell, nd John C. Snyder Deprtment of Horticulture Introduction Bell peppers hve een mjor vegetle crop for frmers in western
More informationCHO Host Cell Protein Detection
TECHNICAL NOTE 41 CHO Host Cell Protein Detection TABLE OF CONTENTS OVERVIEW... 1 PRINCIPLE... 2 ASSAY ACCURACY AND SPECIFICITY... 2 Mterils Required...2 STORAGE AND STABILITY... 3 ASSAY MATRIX... 3 OCTET
More informationhome water audit kit take a look Clackamas River Water Providers (CRWP) Saving Water Makes Cents! CRWP Public Education and Outreach Cooordinator
tke look Clckms River Wter Providers (CRWP) Encourges you to tke look t your home wter system to identify wys you cn conserve wter nd be more efficient with our precious wter resource. FOR MORE INFORMATION:
More informationPre- and post-emergence applications of herbicides for control of resistant fineleaf sheep fescue
Pre- nd post-emergence pplictions of herbicides for control of resistnt finelef sheep fescue in wild blueberry fields in Mine. Yrborough, D.E. nd Cote, J., School of Food nd griculture, The University
More informationWhat do genes code for? The Central Dogma. From gene to protein DNA. protein. trait RNA. Transcription 1/9/2015. From Gene to Protein.
Wht do genes code for? From ene to rotein How does code for cells & bodies? how re cells nd bodies mde from the instructions in How enes Work s cells bodies he entrl Dogm Flow of genetic informtion in
More informationDesign of a titering assay for lentiviral vectors utilizing direct extraction of DNA from transduced cells in microtiter plates
Cittion: Moleculr Therpy Methods & Clinicl Development (2016) 3, 16005; doi:10.1038/mtm.2016.5 All rights reserved 2329-0501/16 www.nture.com/mtm Article Design of titering ssy for lentivirl vectors utilizing
More informationPerformance of 2,4-dinitrophenol as a positive electrode in magnesium reserve batteries q
. Journl of Power Sources 89 2000 106 111 www.elsevier.comrlocterjpowsour Performnce of 2,4-dinitrophenol s positive electrode in mgnesium reserve btteries q S. Gopukumr ), S. Ntrjn, R. Thirunkrn, M. Skthivel
More informationCHAPTER 5 SEISMIC RESERVOIR CHARACTERIZATION.
CHAPTER 5 ISMIC RERVOIR CHARACTERIZATION. ISMIC RERVOIR CHARACTERIZATION Centrl Scotin Slope Study CANADA June 2016 Ojectives: Chrcterize the snd distriution, using the Mrthon nd Verits 3D post-stck seismic
More informationHow Can I Reduce Operating Cost and Maintain a Viable Operation?
How Cn I Reduce Operting Cost nd Mintin Vible Opertion? Bckground for Discussion In this discussion we re not going into the obvious cost-cutting items like buying tht new pickup or trctor, keeping new
More informationThe basic model for inventory analysis
The bsic model for inventory nlysis Lecture Notes for ME515 Prepred by Joyce Smith Cooper Professor of Mechnicl Engineering University of Wshington cooperjs@uw.edu See Chpter 2 of Heijungs nd Suh (22)
More information