Synthetic Biology TOOLS TO SUPPORT DESIGN AND ASSEMBLY
|
|
- Alexina Shields
- 6 years ago
- Views:
Transcription
1 Synthetic iology TOOLS TO SUPPORT DESIGN ND SSEMLY
2 0 0 0 SYNTHETIC IOLOGY Synthetic iology Tools to support design and assembly The goal of synthetic biology, in which genes and proteins are viewed as parts or devices, is redesigning and/or assembling them in novel ways to create a new and useful functionality. Recent advances in the production of biochemicals and biofuels, and a new understanding of the minimal genome, benefit from synthetic biological approaches. These projects often rely on the ordered assembly of multiple DN sequences to create large, artificial DN structures, and methods have evolved to simplify this process. New England iolabs now offers several products that can be used for DN assembly and cloning. Use this chart to determine which product would work best to assemble your DN. NEuilder HiFi DN ssembly Gibson ssembly NE Golden Gate ssembly Mix USER Enzyme NE #E262 NE #E5520 NE #E550 NE #E26 NE #E600 NE #M5505 PROPERTIES Removes or End Mismatches *** * N/ N/ ssembles with High Fidelity at Junctions *** ** *** *** Tolerates Repetitive Sequences at Ends * * *** *** Generates Fully Ligated Product *** *** *** NR Joins dsdn with Single-stranded Oligo *** ** NR NR ssembles with High Efficiency with Low mounts of DN *** ** ** ** ccommodates Flexible Overlap Lengths *** *** * ** PPLICTIONS Simple Cloning (-2 Fragments) *** *** *** *** 4-6 Fragment ssembly *** *** *** *** >6 Fragment ssembly *** ** *** *** Template Construction for In vitro Transcription *** *** *** * Synthetic Whole Genome ssembly *** * * * Multiple Site-directed Mutagenesis *** ** ** ** Library Generation ** ** ** ** Pathway Engineering *** ** ** *** TLENs ** ** *** ** Short Hairpin RN Cloning (shrn) *** ** * * grn Library Generation *** ** * * Large Fragment (>0 kb) ssembly *** *** *** ** Small Fragment (<00 bp) ssembly *** * *** *** Use in Successive Rounds of Restriction Enzyme ssembly *** * NR * KEY *** Optimal, recommended product for selected application N/ Not applicable to this application ** Works well for selected application NR Not recommended Will perform selected application, but is not recommended * NE offers several online tools to aid in DN assembly. Look for the icons on the following pages. 2
3 SYNTHETIC IOLOGY NEuilder HiFi DN ssembly NEuilder HiFi DN ssembly enables virtually error-free joining of DN fragments, even those with - and -end mismatches. vailable with and without competent E. coli, this flexible kit enables simple and fast seamless cloning utilizing a new proprietary high-fidelity polymerase. Make NEuilder HiFi your first choice for DN assembly and cloning. Overview of the NEuilder HiFi DN ssembly cloning method NEuilder HiFi DN ssembly Cloning Kit (NE #E5520) NEuilder HiFi DN ssembly Master Mix (NE #E262) Simple and fast seamless cloning in as little as 5 minutes DN Preparation From: PCR Restriction enzyme digestion Synthetic DN (e.g., glocks) NEuilder HiFi DN ssembly Master Mix Single-tube reaction Exonuclease chews back ends to create single-stranded overhangs DN polymerase fills in gaps within each annealed fragment DN ligase seals nicks in the assembled DN Transformation Linear vector + Incubate at 50 C for 5-60 minutes DN inserts with 5-30 bp overlapping ends (PCR-amplified) ssembled DN C C Use one system for both "standard-size" cloning and larger gene assembly products (up to 2 fragments and 20 kb) DN can be used immediately for transformation or as template for PCR or RC dapts easily for multiple DN manipulations, including site-directed mutagenesis Enjoy less screening/re-sequencing of constructs, with virtually error-free, high-fidelity assembly Use NEuilder HiFi in successive rounds of assembly, as it removes - and -end mismatches ridge two ds-fragments with a synthetic ssdn oligo for simple and fast construction (e.g., linker insertion or grn library) No licensing fee requirements from NE for NEuilder products DN nalysis OR OR NEuilder HiFi DN ssembly Cloning Kit includes the NEuilder HiFi DN ssembly Master Mix and NE 5-alpha Competent E. coli RE Digest Colony PCR Sequencing TOOLS & RESOURCES Visit NEuilderHiFi.com to find: NEuilder HiFi DN ssembly offers improved efficiency and accuracy with lower amounts of DN by increasing overlap length NEuilder HiFi DN ssembly Master Mix Gibson ssembly Master Mix Online tutorials to help with assembly and primer design pplication notes utilizing NEuilder HiFi ccess to NEuilder ssembly Tool, our online primer design tool Number of Colonies Length in overlap (bp) mount used (fmol) Reactions were set up in a 4-fragment assembly reaction according to recommended reaction conditions. mount of DN and size of overlap is shown INTRODUCTION TO NEUILDER HIFI DN SSEMLY For help with designing primers, try NEuilder ssembly Tool at NEuilder.neb.com 3
4 0 0 0 SYNTHETIC IOLOGY Gibson ssembly Gibson ssembly enables multiple, overlapping DN fragments to be joined in a single-tube isothermal reaction, with no additional sequence added (scar-less). The Gibson ssembly Master Mix includes three different enzymatic activities that perform in a single buffer (described below). The assembled, fully-sealed construct is then transformed into NE 5-alpha competent E. coli. The entire protocol, from assembly to transformation, takes just under two hours. Gibson ssembly cloning method Gibson ssembly Cloning Kit (NE #E550) Gibson ssembly Master Mix (NE #E26) ssemble multiple fragments and transform in just under two hours Clone into any vector with no additional sequence added dsdn fragments with overlapping ends Gibson ssembly Master Mix Incubate at 50 C for 5-60 minutes Gibson ssembly Exonuclease chews back ends. DN fragments anneal. DN polymerase extends ends. Gibson ssembly Cloning Kit includes the Gibson ssembly Master Mix and NE 5-alpha Competent E. coli No PCR cleanup step required TOOLS & RESOURCES Visit NEGibson.com to find: Online tutorials to help with assembly and primer design pplication notes utilizing Gibson ssembly ccess to NEuilder ssembly Tool, our online primer design tool DN ligase seals nicks. Fully ssembled DN Gibson ssembly Cloning Kit provides robust transformation efficiencies INTRODUCTION TO GISON SSEMLY Number of recombinant colonies (x0 3 ) Gibson ssembly In-Fusion Genert For help with designing primers, try NEuilder ssembly Tool at NEuilder.neb.com 0 0 kb 3kb 5 kb Fragment size ssembly reactions containing 25 ng of linear puc9 vector and 0.04 pmol of each fragment were performed following individual suppliers recommended protocols and using the competent cells provided with the kit. The total number of recombinant colonies was calculated per 25 ng of linear puc9 vector added to the assembly reaction. Some components of this product are manufactured by New England iolabs, Inc. under license from Synthetic Genomics, Inc. 4
5 SYNTHETIC IOLOGY NE Golden Gate ssembly The efficient and seamless assembly of DN fragments, commonly referred to as Golden Gate assembly (,2), has its origins in 996 when, for the first time, it was shown that multiple inserts could be assembled into a vector backbone using only the sequential (3) or simultaneous (4) activities of a single Type IIS restriction enzyme and T4 DN Ligase. This method can be accomplished using Type IIS restriction enzymes, such as sai, and can also be used for the cloning of single inserts. The method is efficient and can be completed in one tube in as little as 5 minutes for single inserts, or can utilize cycling steps for multiple inserts. The NE Golden Gate ssembly Mix incorporates digestion with sai and ligation with T4 DN Ligase into a single reaction, and can be used to assemble up to 0 fragments in a single step. NE Golden Gate ssembly workflow NE Golden Gate ssembly Mix (NE #E600) Seamless cloning no scar remains following assembly Ordered assembly of up to 0 fragments in a single reaction Efficient with regions with high GC content and areas of repeats Compatible with a broad range of fragment sizes (< 00 bp to > 5 kb) TOOLS & RESOURCES sai sai Visit to find: NNNNNGGCC NNNNNCTCTGG P GGTCTCNNNNN CCGGNNNNN P2 P3 P4 P5 P6 Publications and protocols related to Golden Gate ssembly ccess to NE Golden Gate ssembly Tool, our online assembly tool PCR amplification of vector and fragments Single-tube reaction sai DN ligase PCRlinearized vector + PCR-amplified fragments In its simplest form, Golden Gate ssembly requires a Type IIS recognition site, in this case, sai (GGTCTC), added to both ends of a dsdn fragment. fter digestion, these sites are left behind, with each fragment bearing the designed 4-base overhangs that direct the assembly. NE Golden Gate ssembly Mix offers improved assembly INTRODUCTION TO GOLDEN GTE SSEMLY Speed up your experimental design with our online assembly tool at NEGoldenGate.neb.com 7,000 6,000 6,560 5,750 NE Golden Gate ssembly Mix (NE #E600) Invitrogen Genert Type IIs ssembly Kit, sai Number of Transformants per Plate 5,000 4,000 3,000 2,000, ,370 3, Precloned ( hour, 37 C) Precloned (30 cycles/ min. steps),663,636 ssembly Protocol 3 2 mplicons ( hour, 37 C), mplicons (30 cycles/ min. steps) ssembly reactions were set up using either precloned inserts or PCR amplicons directly. Reaction conditions were set up according to manufacturer, and are shown above. Two separate experiments are shown for each reaction type. References:. Engler, C. et al. (2008) PLoS ONE, 3: e Engler, C. et al. (2009) PLoS ONE, 4: e Lee, J.H. et al. (996) Genetic nalysis: iomolecular Engineering, 3; Padgett, K.. and Sorge, J.. (996) Gene, 68,
6 0 0 0 SYNTHETIC IOLOGY USER Enzyme The USER-friendly DN engineering method enables multiple PCR fragment assembly, nucleotide sequence alteration and directional cloning. Target DN molecules and cloning vector are generated by PCR with 6-0 bases of homology between the neighboring fragments. PCR primers contain a single deoxyuracil residue (du) flanking the end of the homology region, and can accommodate nucleotide substitutions, insertions and/or deletions. The primers are then used to amplify the vector and target DN with discrete overlapping fragments that incorporate a du at each end. Subsequent treatment of PCR fragments with USER Enzyme creates a single nucleotide gap at each du, resulting in PCR fragments flanked with ss-extensions that allow seamless and directional assembly of customized DN molecules into a linearized vector. Multi-fragment assemblies and/or various mutagenic changes can be performed in a single experiment. USER Enzyme (NE #M5505) Seamless and directional assembly Multiple fragment assemblies and/or mutations can be performed in a single experiment USER assembly is performed at 37 C or room temperature (no need for thermocycler) USER method can be used for assembly of small fragments (< 00bp) or oligo duplexes and for sequences with end repeats. DN assembly with USER Enzyme n optional TG should be included TG if protein expression is desired. Left primer GGGCUNNNNNN Target DN NNNNNNUGGGG Right primer PCR GGGCU CCTCTGT CTTTCCC UGGGG USER CCTCTGT CTTTCCC ssembly pne206 ssembled DN Transformation iorick ssembly With the iorick synthetic biology approach, DN fragments encoding proteins, promoters, ribosome binding sites, etc., have been standardized and are contained in a "parts" registry of plasmids with identical restriction sites flanking the "payload" of the part. y employing standardized flanking sites that are not contained within the coding sequence of the part, they can be ligated in any order to create a novel "device". y choosing restriction sites with compatible ends that destroy the recognition site when ligated to one another, parts can be combined together and the original flanking sites re-used for the next round of assembly. Despite the limitations of introducing a sequence scar for every ligation event and the multiple rounds of assembly required to fabricate a device, a wide assortment of exciting systems have been designed and built. iorick ssembly Kit (NE #E0546) The iorick ssembly Kit was developed in partnership with Ginkgo ioworks The iorick approach has been used to build a wide variety of novel biological systems For more details and for technical questions, please visit ginkgobioworks.com/support 6
7 SYNTHETIC IOLOGY Cas9 Nuclease, S. pyogenes Cas9 Nuclease is a double stranded DN nuclease and central component of CRISPR(clustered regularly interspaced short palindromic repeat)-based immunity. In bacteria and archea, the CRISPR/Cas9 system functions to protect cells from foreign DN. CRISPR genomic loci are transcribed and processed into guide RNs that are incorporated into Cas9 Nuclease. Guide RNs direct the Cas9 nuclease to its target by complementary base pairing. Cas9 Nuclease has been adapted for use in genome engineering, because it can be easily programmed for target specificity by supplying guide RNs of almost any sequence. In vitro, Cas9 permits flexible, user-specified, introduction of double stranded breaks at ~20 bp recognition sequences. In cells and animals, genome editing is performed by expressing Cas9 Nuclease and guide RN (often singleguide RN sgrn) from DN constructs (plasmid or virus), supplying RN encoding Cas9 nuclease and sgrn, or by introducing RN-programmed Cas9 Nuclease directly. Targeted doubled stranded breaks can be repaired by nonhomologous end joining (NHEJ), knocking out gene function and enabling large scale deletions, or homology-directed repair (HDR) in the presence of an HDR template, enabling targeted insertions or substitutions. Cas9 Nuclease, S. pyogenes sequence recognition and DN cleavage Cas9 Nuclease, S. pyogenes (NE #M0386) vailable in standard (NE #M0386S/L) and high concentration (NE #M0386M) Coming soon: Cas9 with nuclear localization signal (NLS) TOOLS & RESOURCES Visit to find: Up-to-date listing of products and protocols to support this application Tips for planning your Cas9 experiment Strategies for sgrn template construction for Cas9 gene editing Protocols for measuring targeting efficiency with the T7 Endonuclease I ssay Cas9 Nuclease, S. pyogenes DN PM (NGG) CGCTTGTTTCGGCGTGG GTTGG Cleavage Cleavage GCGCGCCGCCC CTCC CGCUUGUUUCGGCGUGG GU Nucleotide position (upstream of PM) sgrn PURExpress In Vitro Protein Synthesis Kit rapid method for gene expression analysis, PURExpress is a novel cell-free transcription/translation system reconstituted from purified components necessary for E. coli translation. Express a wide range of proteins free of modification or degradation by simply mixing two tubes followed by the addition of template DN. With results available in only a few hours, PURExpress saves valuable laboratory time and is ideal for high throughput technologies. Product selection includes the original kit, with all components in two tubes, as well as options for protein translation experiments, protein synthesis/ribosomal display experiments and synthesis with modified amino acids. PURExpress In Vitro Protein Synthesis Kit (NE #E6800) Suitable for circular or linear DN template Visualize synthesized protein directly on a Coomassie stained gel Protein expression in approximately 2 hours Transcription/translation components can be removed by affinity chromatography 7
8 Ordering Information Ordering Information PRODUCT NE # SIZE NEuilder HiFi DN ssembly Cloning Kit E5520S 0 reactions NEuilder HiFi DN ssembly Master Mix E262S/L/X 0/50/250 reactions Gibson ssembly Cloning Kit E550S 0 reactions Gibson ssembly Master Mix E26S/L 0/50 reactions NE Golden Gate ssembly Mix E600S 5 reactions RECOMMENDED RESOURCES Programming Life: Inquiry & Engineering Through Synthetic iology Follow the evolution of synthetic biology by visiting our feature article at USER Enzyme M5505S/L 50/250 units iorick ssembly Kit E0546S 50 reactions Cas 9 Nuclease, S. pyogenes M0386S/L/M 50/250/500 pmol PURExpress In Vitro Protein Synthesis Kit E6800S/L 0/00 reactions PURExpress Ribosome Kit E333S 0 reactions PURExpress (aa, trn) Kit E6840S 0 reactions PURExpress RF23 Kit E6850S 0 reactions PURExpress Disulfide ond Enhancer E6820S 50 reactions E. coli Ribosome P0763S mg dditional Reagents to Facilitate Synthetic iology Experiments PRODUCT NE # SIZE RESTRICTION ENZYMES sai R0535S/L,000/5,000 units sai-hf R3535S/L,000/5,000 units bsi R0539S/L 300/,500 units Training the Next Generation of ioengineers Since its inception in 2004, igem has evolved into a highly successful vehicle for training and showcasing a new generation of biological engineers using the synthetic biology framework To date, more than 28,000 students have participated in this competition Teams are supported by various organizations, including NE For more information, visit smi R0580S/L 200/,000 units DN LIGSES & MODIFYING ENZYMES Thermos aquaticus (Taq) DN Ligase M0208S/L 2,000/0,000 units T4 DN Ligase M0202S/L/T/M 20,000/00,000 units T5 Exonuclease M0363S/L,000/5,000 units COMPETENT CELLS NE 5-alpha Competent E. coli (High Efficiency) C2987H/I/P 20 x 0.05 ml/6 x 0.2 ml/ x 96 well plate NE 0-beta Competent E. coli (High Efficiency) C309H/I 20 x 0.05 ml/6 x 0.2 ml NE Stable Competent E. coli (High Efficiency) C3040H/I 20 x 0.05 ml/6 x 0.2 ml DN LDDERS Quick-Load Purple 2-log DN Ladder ( kb) N0550S gel lanes Quick-Load Purple 00 bp DN Ladder N055S 25 gel lanes Quick-Load Purple kb DN Ladder N0552S 25 gel lanes NEW ENGLND IOLS, NE, HF, NEUILDER, PUREXPRESS and QUICK-LOD are registered trademarks of New England iolabs, Inc. GENERT is a registered trademark of Life Technologies, Inc. GISON SSEMLY is a registered trademark of Synthetic Genomics, Inc. IN-FUSION is a registered trademark of Clontech Laboratories, Inc. IORICK is a registered trademark of The ioricks Foundation ( USER is a trademark of New England iolabs, Inc. GINKGO IOWORKS is a trademark of Ginkgo ioworks, Inc. ISO 900 Registered Quality Management ISO 400 Registered Environmental Management ISO 3485 Registered Medical Devices New England iolabs, Inc., 240 County Road, Ipswich, M Telephone: (978) Toll Free: (US Orders) Toll Free: (US Tech) Fax: (978) info@neb.com SYN_IO Version.0 5/5
DNA Assembly & Synthetic Biology
DN ssembly & Synthetic Biology OOLS O SUPPOR DESIGN ND DN SSEMBLY E UPD 8 20 be INSPIRED drive DISCOVERY stay GENUINE 0 0 0 SYNHEIC BIOLOGY DN ssembly & Synthetic Biology ools to support your design and
More informationMolecular Cloning TECHNICAL GUIDE
Molecular Cloning TECHNICL GUIDE 2 OVERVIEW Molecular Cloning Overview Molecular cloning refers to the process by which recombinant DN molecules are produced and transformed into a host organism, where
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
More informationFast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase
APPLICATION NOTE Platinum Superi Polymerase ast and efficient site-directed mutagenesis with Platinum Superi Polymerase Introduction Site-directed mutagenesis is one of the most essential techniques to
More informationCRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationEnGen Mutation Detection Kit
DNA MODIFYING ENZYMES EnGen Mutation Detection Kit Instruction Manual NEB #E3321S 25 reactions Version 2.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes only.
More informationUse of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary
No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationQ5 Site-Directed Mutagenesis Kit
DNA MODIFYING ENZYMES Q5 Site-Directed Mutagenesis Kit Instruction Manual NEB #E0554S 10 reactions Version 1.0 1/13 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More informationGenBuilder TM Cloning Kit User Manual
GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationMolecular Biology Techniques Supporting IBBE
Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning
More informationCold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual
Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.
More informationSupplementary Information
Single day construction of multi-gene circuits with 3G assembly Andrew D. Halleran 1, Anandh Swaminathan 2, and Richard M. Murray 1, 2 1. Bioengineering, California Institute of Technology, Pasadena, CA.
More informationSimple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
More informationAmplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events
Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Steve Siembieda, MS MBA VP Commercialization ABRF Conference February 2015 What Is CRISPR? Clustered
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More informationIn-Fusion HD Cloning Plus System
In-Fusion HD Cloning Plus System One trustworthy solution for all your cloning and mutagenesis projects Seamless 15-30 Directional Any vector GOI + Any insert Anywhere Large & small inserts or vectors
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationData Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
More informationSupplementary Methods pcfd5 cloning protocol
Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous
More informationGibson Assembly Master Mix
DNA MODIFYING ENZYMES Gibson Assembly Master Mix Instruction Manual NEB #E2611S/L 10/50 reactions Limited Use Label License: The Gibson Assembly Master Mix, and components and products thereof, are to
More informationProgrammable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors
Supplementary Information Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors Feng Zhang 1,2,3,5,7 *,±, Le Cong 2,3,4 *, Simona Lodato 5,6, Sriram
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationChapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears
Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and
More informationXXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
More informationComputational Biology 2. Pawan Dhar BII
Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
More informationAlt-Ring the genome with CRISPR- Cas9
Alt-Ring the genome with CRISPR- Cas9 Genome editing done easily and fast CHIA Jin Ngee Regional Application Specialist 1 Integrated DNA Technologies The Custom Biology Company 2 IDT was founded by a scientist
More informationBBF RFC 57: Assembly of BioBricks by the Gibson Method
BBF RFC 57: Assembly of BioBricks by the Gibson Method Bill Collins, Hannah Copley, Peter Emmrich, Will Handley, Anja Hohmann, Emily Knott, Paul Masset, Ben Reeve and Theo Sanderson October 28, 2010 1
More informationAmplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
More informationHighly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase
Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase H. Liu, R. Ye and Y.Y. Wang Department of Medical Microbiology and Parasitology, School of
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationBEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS
BEST QUALITY HIGHEST PURITY Recombinant ENZYMES & PROTEINS We offer a wide range of highest quality enzymes and proteins for molecular biology including DNA polymerases, reverse transcriptases, DNA ligases,
More informationCloning,! 免付費客服專線 TEL (02) TEL (05) TEL (03) TEL (06) TEL (04) TEL (07) U040114
2015 Cloning, Cloning,! U040114 TEL (02)2720-2215 TEL (05)2844-162 TEL (03)6684-5 8 6 TEL (06)2890-665 TEL (04)2463-3591 TEL (07)3470-143 免付費客服專線 (Genetic Cloning) Cloning, (Molecular Cloning), (Restriction
More informationSupplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
More informationNZYGene Synthesis kit
Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm
More informationEnhanced Arginase production: rocf
Enhanced Arginase production: rocf Purpose and Justification: Bacillus subtilis produces urease, which catalyses the hydrolysis of urea into ammonium and carbonate. Since the cell wall of the bacteria
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:
More informationDNA Ligases and Ligase Master Mixes
DNA Ligases and Ligase Master Mixes STICK TOGETHER be INSPIRED drive DISCOVERY stay GENUINE Stick together. DNA Ligases and Ligase Master Mixes from New England Biolabs With over 40 years of experience
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationNEBNext Ultra Ligation Module
LIBRARY PREPARATION NEBNext Ultra Ligation Module Instruction Manual NEB #E7445S/L 24/96 reactions This product is intended for research purposes only. This product is not intended to be used for therapeutic
More informationCRISPR Ribonucleoprotein (RNP) User Manual
CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationProtocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationEnGen sgrna Synthesis Kit, S. pyogenes
RNA ENZYMES & GENE ANALYSIS EnGen sgrna Synthesis Kit, S. pyogenes Instruction Manual NEB #E3322S 20 reactions Version 2.0 7/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research
More informationPlatinum II Taq Hot-Start DNA Polymerase for high-throughput PCR
WHITE PAPER Platinum II Taq Hot-Start DNA Polymerase Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR Abstract The advances in thermal cycler technology permit a substantial increase in
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationKAPA HiFi HotStart ReadyMix PCR Kit
KAPA HiFi HotStart ReadyMix PCR Kit KR0370 v10.19 This provides product information and a detailed protocol for the KAPA HiFi HotStart ReadyMix PCR Kit. This document applies to the following kits: 07958919001,
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
More informationNew Plant Breeding Technologies
New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations
More informationHigh-Fidelity PCR Kit
POLYMERASES & AMPLIFICATION Q5 High-Fidelity PCR Kit Instruction Manual NEB #E0555S/L 50/200 reactions Version 3.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes
More informationMonarch DNA Gel Extraction Kit
NUCLEIC ACID PURIFICATION Monarch DNA Gel Extraction Kit Instruction Manual NEB #T1020S/L Version 1.2 3/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes only.
More informationProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.
DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationFAQs: PCR Polymerases from Takara Bio
FAQs: PCR Polymerases from Takara Bio Contents: PCR Basics Q1 Q2 Q3 What parameters do I need to consider when designing primers? What is the optimum amount of template to use? Which conditions are particularly
More informationPhosphorothioate-based BioBrick cloning (Potsdam) Standard
BBF RFC 91: phosphorothioate-based BioBrick cloning 1 Document Version 1.0, October 26, 2012 Phosphorothioate-based BioBrick cloning (Potsdam) Standard igem Team Potsdam 2012 1, Tobias Baumann 1, Kristian
More informationNEBNext. for Ion Torrent LIBRARY PREPARATION KITS
NEBNext for Ion Torrent LIBRARY PREPARATION KITS NEBNEXT PRODUCTS FOR ION TORRENT Table of Contents 3 General Introduction TOOLS & RESOURCES Visit NEBNext.com to find: T he full list of products available
More informationII First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationOneTaq One-Step RT-PCR Kit
POLYMERASES & AMPLIFICATION OneTaq One-Step RT-PCR Kit Instruction Manual NEB #E5315S 30 reactions Version 2.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes
More informationSome types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationHetero-Stagger PCR Cloning Kit
Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer
More informationBiotechnology. Review labs 1-5! Ch 17: Genomes. Ch 18: Recombinant DNA and Biotechnology. DNA technology and its applications
Biotechnology DNA technology and its applications Biotechnology and Molecular Biology Concepts: Polymerase chain reaction (PCR) Plasmids and restriction digests Recombinant protein production UV spectrophotometry
More informationCELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)
Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression
More informationNEBNext da-tailing Module
SAMPLE PREPARATION NEBNext da-tailing Module Instruction Manual NEB #E6053S/L 20/100 reactions Version 2.0 4/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes only.
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationSynthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
More informationIncreased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit
be INSPIRED drive DISCOVERY stay GENUINE TECHNICAL NOTE Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit Highly sensitive, robust generation of high quality
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationApplications of Cas9 nickases for genome engineering
application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,
More informationA Guide to CRISPR/Cas9
Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse
More informationVector Linearization. igem TU/e 2016 Biomedical Engineering
igem TU/e 2016 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2016.igem.org/Team:TU_Eindhoven Vector
More informationNEBNext Quick Ligation Module
SAMPLE PREPARATION NEBNext Quick Ligation Module Instruction Manual NEB #E6056S/L 20/100 reactions Version 3.0 1/19 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes
More informationLigation Independent Cloning (LIC) Procedure
Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationHE Swift Cloning Kit
HE Swift Cloning Kit For high-efficient cloning of PCR products either blunt or sticky-end Kit Contents Contents VTT-BB05 phe Vector (35 ng/µl) 20 µl T4 DNA Ligase (3 U/µl) 20 µl 2 Reaction Buffer 100
More informationVector Linearization. igem TU/e 2015 Biomedical Engineering
igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector
More informationNEB EXPRESSIONS. Gibson Assembly Building a Synthetic Biology Toolset page 3. Gibson Assembly Master Mix page 6
NEB EXPRESSIONS A scientific update from New England Biolabs Winter Edition 2012 Gibson Assembly Building a Synthetic Biology Toolset page 3 Gibson Assembly Master Mix page 6 RE-Mix Restriction Enzyme
More informationReady_to_use Fast Seamless Cloning Kit. User Manual
For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationCELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)
Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationGenome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
More informationDNA Cloning with Cloning Vectors
Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning
More informationSite-directed Mutagenesis
Site-directed Mutagenesis Applications Subtilisin (Met à Ala mutation resistant to oxidation) Fluorescent proteins Protein structure-function Substrate trapping mutants Identify regulatory regions/sequences
More information