The role of the meca gene in oxacillin resistance in a pvl-positive:st59 genetic. background of a Staphylococcus aureus clinical strain

Transcription

1 AAC Accepts, published online ahead of print on 25 November 2013 Antimicrob. Agents Chemother. doi: /aac Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 The role of the meca gene in oxacillin resistance in a pvl-positive:st59 genetic 2 background of a Staphylococcus aureus clinical strain 3 Feng-Jui Chen,# Chen-Her Wang, Ching-Yi Chen, Yu-Chieh Hsu, Kaun-Ting Wang 4 5 National Institute of Infectious Diseases and Vaccinology, National Health Research 6 Institutes, Zhunan, Taiwan 7 8 Running Head: Effect of meca gene on the oxacillin susceptibility #Address correspondence to Feng-Jui Chen, National Institute of Infectious Diseases and 13 Vaccinology, National Health Research Institutes Keyan Road, Zhunan Town, Miaoli County 350, Taiwan 15 Tel.: ext Fax: frchen@nhri.org.tw Key words: Methicillin-resistant Staphylococcus aureus (MRSA); oxacillin resistance; meca 1

2 20 ABSTRACT 21 The most prevalent community-associated methicillin-resistant Staphylococcus 22 aureus (C-MRSA) strains in Taiwan, ST59 clones, carry staphylococcal cassette 23 chromosome mec (SCCmec) type V and, to a lesser extent, type IV. These strains show 24 wide variation in sensitivity to oxacillin, but the reasons for this variation are unknown. 25 Here we compared the sequence of the meca gene from different SCCmec type clinical 26 strains and found they contain different meca promoter mutations. Analysis of meca 27 promoter activity by reporter-gene fusions showed that single base substitutions in the 28 promoter have a strong influence on meca transcription. The different meca variants 29 including promoter sequences were expressed in the methicillin-sensitive Staphylococcus 30 aureus (MSSA) strain C195 (ST59 background). PBP2a production among the parental 31 and promoter mutant meca genes showed a close correlation with meca transcription 32 levels. Furthermore, the quantity of PBP2a also closely correlated with the level of 33 oxacillin resistance in the C195 background. Our data suggest that meca promoter 34 mutations play an important role in determining the level of oxacillin resistance. The 35 meca promoter mutation G-25A (25 bases upstream of the meca translation start site) 36 was found to be associated with high oxacillin minimum inhibitory concentration (MIC) 37 (256 µg/ml), G-7T conferred a moderate oxacillin MIC (32-64 µg/ml), C-33T showed a 2

3 38 low oxacillin MIC (4-8 µg/ml), and A-38G reversed the effect of the C-33T mutation, 39 restoring the oxacillin resistance level in the double mutant A-38G/C-33T. These 40 observations may explain why C-MRSA strains in Taiwan carrying SCCmec type IV or 41 V have such enormous variation in oxacillin MIC. 3

4 42 INTRODUCTION 43 Community-associated methicillin-resistant Staphylococcus aureus (C-MRSA) infections 44 emerged in the late 1990s and increased dramatically over the past several years (1, 2). 45 The changing epidemiology of MRSA has become one of the most important public 46 health concerns worldwide (3). 47 The most prevalent C-MRSA strains in Taiwan, ST59 clones, mostly carry 48 staphylococcal cassette chromosome mec (SCCmec) type V and are pvl-positive, while 49 the pvl-negative ST59 MRSA clones mostly carry SCCmec IV (4-7). The epidemiological 50 factors that have contributed to the dissemination of ST59 clones in Taiwan are not well 51 understood. However, we recently identified a pvl-positive ST59:SCCmec V clone with 52 borderline resistance to oxacillin that is the major contributor to a low-level oxacillin 53 resistant meca-positive phenotype, which may provide a clue to ST59 prevalence (7, 8). 54 MRSA strains are resistant to -lactams in two ways: by production of penicillinase, 55 which hydrolyzes the penicillin -lactams but not semi-synthetic penicillins, and by 56 production of an altered penicillin-binding protein, PBP2a (or PBP2 ),with lower 57 binding affinity for -lactams, resulting in resistance to virtually all available -lactam 58 drugs (9) but not to the latest generation cephalosporins, such as ceftaroline (10). 59 Penicillinase is encoded by the blaz gene and PBP2a is encoded by the meca gene 4

5 60 located in the SCCmec element. Transcription of meca and blaz is usually regulated by 61 their cognate regulators, mecr1 (sensor/signal transducer)-meci (repressor) and 62 blar1-blai (11-13), but MecI and BlaI can each repress transcription of the other gene 63 (i.e., blaz and meca, respectively) (14). However, although there is functional overlap 64 between the repressors, the corresponding sensor-transducer molecules, MecR1 and 65 BlaR1, only work with their respective repressors (15). Moreover, if the mecr1-meci 66 regulatory elements are absent or truncated, the control of meca expression is then 67 carried out by the structurally similar blar1-blai regulators (16, 17); indeed, this is the 68 case for SCCmec type IV and V, whose mecr1-meci regulatory elements are disrupted by 69 IS1272 and IS431, respectively (18, 19). 70 In Switzerland, a MRSA strain with low-level oxacillin resistance (0.5-4 µg/ml) is 71 spreading among intravenous drug users (20). This so-called drug clone has the ability 72 to generate highly resistant subclones. A recent study found that, although meca promoter 73 mutations have significant influence on the level of meca transcription and PBP2a levels 74 in this clone, they have little effect on the level of -lactam resistance. Rather, the genetic 75 background of the strain appears to play the major role in governing the level of -lactam 76 resistance (17). 77 There is wide variation in the level of oxacillin resistance [minimum inhibitory 5

6 78 concentration (MIC) ranging from 1 to >256 µg/ml] of the meca-positive ST59 isolates 79 in Taiwan (7, 8), but the reasons for this variation are unknown. The present study 80 investigated the impact of meca gene polymorphisms from four SCCmec types on the 81 level of oxacillin resistance in an ST59 clinical S. aureus genetic background. 82 MATERIALS AND METHODS 83 Bacterial strains. The bacterial strains, plasmids and primers used are listed in Table Unless stated otherwise, Luria-Bertani (LB) broth and plates were used for growth of 85 Escherichia coli and S. aureus at 37 o C. E. coli strain XL10-Gold (Stratagene, La Jolla, 86 CA, USA) was used for cloning. S. aureus cells were transformed by electroporation as 87 described previously (21). Ampicillin (100 µg/ml) and chloramphenicol (5 µg/ml) were 88 used for plasmid selection in E. coli and S. aureus. 89 Antimicrobial susceptibility testing. Minimum inhibitory concentrations (MICs) 90 were determined by broth microdilution (BMD) on all S. aureus clinical strains using a 91 custom-designed Sensititre panel (Trek Diagnostic System, Thermo Fisher Scientific, 92 East Grinstead, UK). The MICs of antibiotics were also determined on certain strains and 93 constructs by Etest (AB Biodisk, Solna, Sweden) or BMD (22). The BMD method was 94 performed in Mueller Hinton II Broth (MHB, containing 2% NaCl for oxacillin wells), 6

7 95 from an inoculum of CFU/ml, and the MIC was read after incubation at 35 o C for hr. ATCC and ATCC S. aureus were used for quality control. 97 meca polymorphisms by sequencing. Seventeen clinical MRSA strains from our 98 previous study (5, 7) were chosen for meca gene sequencing, including one SCCmec II 99 isolate, two SCCmec III isolates, six SCCmec IV isolates, and eight SCCmec V isolates 100 (Table 3). Additional SCCmec type IV and V clinical isolates were included because they 101 exhibited more diverse oxacillin MIC values based on Etest results. 102 Production of mouse monoclonal anti-pbp2a antibody. The meca gene without 103 the first 23 amino acids of the transmembrane anchor (23) was cloned by PCR from S. 104 aureus clinical strain C027 into the pet-41 Ek/LIC vector using the LIC-specific primers 105 LIC-mecA-F and LIC-mecA-R (Table 2) according to the manufacturer s instructions. 106 The resulting fusion protein carried N-terminal glutathione S-transferase (GST), S-Tag 107 and His-Tag sequences from the pet-41 vector. The recombinant plasmid was 108 transformed into E. coli NovaBlue and then BL21 (DE3) cells (Novagen, Madison, WI, 109 USA). Protein was produced based on Studier s auto-induction method (24). Briefly, cells 110 were grown in 3 ml ZYM-5052 medium containing 50 µg/ml kanamycin for 2 hr at 37 o C 111 with agitation (250 rpm) and then poured into 100 ml of fresh medium in 500 ml flasks 112 for 2 hr at 37 o C, and then for an additional 20 hr at 26 o C. Cell pellets were lysed with 7

8 113 BugBuster protein extraction reagent (Novagen, Madison, WI, USA), and then 114 centrifuged to remove the debris. The recombinant His-tagged fusion protein in the 115 supernatant was purified by using a HisTrap affinity column according to the 116 manufacturer s instructions (GE Healthcare, Piscataway, NJ, USA). Tag-free recombinant 117 PBP2a was eluted from the HisTrap column after cleavage by recombinant enterokinase 118 (Novagen, Madison, WI, USA). Mouse monoclonal anti-pbp2a antibodies were 119 generated commercially by Genesis Biotech Inc. (Taipei, Taiwan) using the purified 120 tag-free recombinant PBP2a from this study. 121 Western blot analysis for PBP2a detection. For detection of PBP2a, strains or 122 transformants were adjusted in 0.85% NaCl to 0.5 McFarland turbidity, then diluted 123 1:100 in 30 ml MHB containing chloramphenicol as appropriate, and incubated at 37 o C 124 with shaking at 180 rpm to allow the cells to reach an OD 600 of 1. Cells were harvested, 125 washed and then disrupted in a Fastprep-24 homogenizer with Lysing Matrix B (MP 126 Biomedicals, Solon, OH, USA). The samples were centrifuged for 5 min at x g to 127 remove unbroken cells and debris, and the total protein concentration was determined by 128 Bradford protein assay (Bio-Rad Laboratories, Richmond, CA, USA). Protein samples (1 129 µg of protein per lane) were subjected to 10% sodium dodecyl sulfate polyacrylamide gel 130 electrophoresis (SDS-PAGE), and then transferred to polyvinylidene difluoride 8

9 131 membrane (Immobilon, Millipore Corp., Bedford, MA, USA). The membrane was 132 blocked with 5% skim milk in PBST (phosphate-buffered saline with 0.05% Tween 20) 133 followed by blocking with human IgG (Sigma-Aldrich, St Louis, MO, USA), 1:6,000 in 134 1% skim milk. PBP2a was probed with mouse monoclonal anti-pbp2a antibody (2F6F), 135 and sortase A, a transpeptidase, was used as an internal control, identified by rabbit 136 polyclonal anti-sortase A primary antibody (Abcam Inc., Cambridge, MA, USA). Band 137 signals were visualized with HRP-conjugated secondary antibodies (Abcam Inc., 138 Cambridge, MA, USA) followed by Western lightning chemiluminescence reagent plus 139 (Perkin Elmer Life Sciences, Boston, MA, USA). 140 Construction of meca promoter-reporter plasmids. For stable bioluminescence 141 activity controlled by a strong promoter within an optimal transcriptional reporter vector, 142 the luxabcde reporter was reconstructed using primers which incorporated three stop 143 codons in three frames and a ribosome binding site upstream of the luxa gene and a T terminator of E. coli rrnb gene (25) downstream of the luxe gene (Table 2). The 145 luxabcde operon was amplified by PCR from plasmid pfjc0601 (26) and digested with 146 SalI and PvuII and then cloned into psk5630 (27) to generate the transcriptional fusion 147 vector pluxt2. The meca promoter fragment was PCR-amplified from the chromosomes 148 of five clinical strains, V070 (SCCmec II), M088 (SCCmec III), C103 (SCCmec IV), 9

10 149 M183 (SCCmec V), and C027 (SCCmec V), using the primers P meca -F and P meca -R. 150 These amplified meca promoter fragments were fused upstream of the lux reporter genes 151 of pluxt2 using the BamHI and SalI sites, and the resulting plasmids were used for 152 transformation of the S. aureus strain RN4220, and then RN6390B and C195 (a 153 pvl-positive:st59 MSSA). The resulting meca promoter-reporter fusion constructs were 154 confirmed by restriction enzyme analysis and DNA sequencing. 155 Luciferase reporter assays. Bioluminescence measurements were performed using 156 the TopCount NXT system (Perkin-Elmer Biosystems, USA) to determine the 157 transcriptional level of the meca promoter constructs. Three independent transformants 158 harboring promoter-reporter fusion plasmids were grown overnight with shaking at 37 o C 159 in tryptic soy broth (TSB) containing chloramphenicol for reporter plasmid maintenance, 160 diluted 1:100 in the same medium and grown for an additional 2 hr, and then diluted fold in the same medium supplemented with 0.02 µg/ml oxacillin as appropriate for 162 induction. Aliquots (200 l) of the cultures were transferred into 96-well plates in 163 duplicate and incubated at 37 o C. Both OD 595 and bioluminescence (in relative light units, 164 RLU) were monitored every hour for 7 hr. 165 Cloning of the meca gene. The meca gene and its promoter were amplified from S. 166 aureus clinical strains V070 (SCCmec II), M088 (SCCmec III), C103 (SCCmec IV), 10

11 167 M183 (SCCmec V), and C027 (SCCmec V) by PCR using the primers meca-f and 168 meca-r (Table 2). The DNA fragments were digested and cloned into the HindIII and 169 PvuII sites of psk5630. The resulting constructs were confirmed by restriction enzyme 170 analysis and DNA sequencing. These meca gene-containing plasmids were then 171 electroporated into RN4220 and then C195 cells. Oxacillin and cefoxitin MICs were 172 determined for three independent transformants by BMD using MHB containing 173 chloramphenicol and 2% NaCl for oxacillin wells. 174 Probing the meca gene by site-directed mutagenesis. To evaluate the effect of 175 meca polymorphisms on oxacillin resistance, site-directed mutagenesis was performed by 176 PCR (28) on pm088meca template plasmid DNA using the primers described in Table After PCR using the mutant primers, meca promoter mutants were treated with DpnI and 178 ligated into a circle with T4 DNA ligase, and then used to transform XL10-Gold cells. 179 Mutagenesis of the meca coding sequence was performed with a QuikChange 180 site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the 181 manufacturer s instructions. Whole meca genes were then cloned from the mutated 182 plasmids into psk5630 again to eliminate potential mutation of the vector sequence. The 183 resulting mutants were confirmed by restriction enzyme analysis and DNA sequencing. 184 These meca gene mutant plasmids were then electroporated into RN4220 and then C195 11

12 185 cells. Oxacillin and cefoxitin MICs were determined for three independent transformants 186 by BMD as described above. 187 RESULTS 188 Correlation of meca polymorphisms and oxacillin resistance. The meca genes from 189 seventeen clinical MRSA strains were found to have polymorphisms in promoter and/or 190 coding sequences (Table 3), but the promoter region was especially polymorphic: each 191 SCCmec type, except SCCmec III (whose promoter is the same as the consensus 192 sequence), can be characterized by promoter sequences that differ by one or two unique 193 base substitutions (Table 3). The meca promoter in the single SCCmec II strain examined 194 has a G to A substitution located at 25 bp (-25) upstream of the meca translation start site. 195 Three of the six SCCmec IV strains (C103, M153 and V043) have a G to T substitution in 196 the ribosomal binding site (-7), thus distinguishing two classes of promoter sequence in 197 this SCCmec type. Similarly, the meca promoter of the seven SCCmec V strains can be 198 divided into two classes: all seven strains have a C to T substitution at -33 while three of 199 the strains have an additional A to G substitution at The highest concentration of oxacillin in our Sensititre panel used in this study was µg/ml; therefore, the oxacillin MIC of these 17 isolates was also determined by Etest 12

13 202 (Table 3). The single SCCmec II and two SCCmec III strains tested all had oxacillin 203 MICs >256 µg/ml. In contrast, the seven SCCmec IV strains had a range of oxacillin 204 MICs, from moderate values (48-64 µg/ml) to high values (256 µg/ml). Among the 205 SCCmec V strains, those possessing only the C-33T substitution in the promoter showed 206 low oxacillin resistance (1.5 to 16 µg/ml). To assess the correlation of oxacillin MIC and 207 PBP2a production, six clinical MRSA strains [V070 (SCCmec II), M088 (SCCmec III), 208 C103 (SCCmec IV), M183 (SCCmec V), M046 (SCCmec V), and C027 (SCCmec V)] 209 were chosen for PBP2a quantification. High PBP2a production, as quantified by western 210 blots, was found to correlate with high oxacillin MIC (Fig. 1). 211 Variable activity of meca promoters. The different levels of PBP2a production 212 observed for the different promoter sequences suggested that meca transcription could be 213 influenced by certain mutations within the meca promoter. To assess promoter activity 214 directly, meca promoters from V070 (SCCmec II), M088 (SCCmec III), C103 (SCCmec 215 IV), M183 (SCCmec V), and C027 (SCCmec V) were cloned upstream of the luxabcde 216 reporter gene cluster to create promoter-reporter gene fusion constructs. The 217 transcriptional activity of the meca promoter variants was compared in the strains C and RN6390B; the former strain contains a -lactamase plasmid (encoding the BlaI 219 repressor of meca transcription) and the latter does not. A bioluminescent assay was 13

14 220 performed to determine the transcriptional levels driven by the meca promoters (Fig. 2). 221 In the absence of BlaI repressor (RN6390B background), meca promoter is constitutively 222 expressed, as illustrated in Fig. 2A. The V070 promoter (P V070, G-25A) had higher 223 promoter activity than the M088 promoter (P M088 ). In contrast, the C027 promoter (P C027, 224 C-33T) had the lowest promoter activity, producing only minor bioluminescence (Fig A). The C103 promoter (P C103, G-7T) had moderate promoter activity, whereas the 226 M183 promoter (P M183, C-33T/A-38G) had promoter activity similar to that of P M Even though P C103 carries a single substitution (G-7T) in the ribosomal binding site of 228 meca, the reporter assay indicated that this substitution was still able to cause a reduction 229 in meca transcription (note that our transcriptional fusion vector pluxt2 carries its own 230 ribosome-binding site upstream of the luxa gene, so that the observed reduction in 231 reporter gene activity caused by the G-7T mutation was unlikely due to a protein 232 translation problem, but rather to an effect on transcription). In addition to the meca 233 promoter variants, we also investigated the effect of the single A-38G substitution found 234 in P M183. A P M088 A-38G mutant promoter was constructed by site-directed mutagenesis 235 and found to have the highest promoter activity of all the mutants examined (Fig. 2A). In 236 the presence of BlaI repressor (C195 background), meca promoter activity was strongly 237 repressed by BlaI repressor without induction, and only the P V070 and P M088 A-38G 14

15 238 promoters retained moderate promoter activity (Fig. 2B). The activities of other 239 promoters appear to parallel the time curve, indicating that repression of meca 240 transcription by BlaI repressor is stronger than meca promoter activity. 241 BlaI repressor could be cleaved by BlaR1 sensor-transducer upon induction by 242 -lactam to allow transcription of meca. For the induction assay, an optimal 243 concentration of 0.02 µg/ml oxacillin was determined; this concentration had minimal 244 effect on bacterial growth and maintained inducer activity. The bioluminescent assay 245 again showed that, upon oxacillin induction in the C195 background, these promoters had 246 similar activity orders to what they showed in the RN6390B background (Fig. 2C). There 247 was maximum bioluminescence after 2 hr induction, and thereafter the meca promoter 248 activity was strongly repressed by BlaI repressor as illustrated in Fig. 2C. Again, P M A-38G proved to be an extraordinarily strong promoter in the C195 strain upon induction, 250 directing approximately 30-fold more transcription than did P C027 (P M088 A-38G, RLU vs. P C027, RLU; Fig. 2C). ODs of all strains were monitored 252 simultaneously and there were no significant differences (data not shown). Therefore, 253 there is a positive correlation between meca promoter activity and the level of PBP2a 254 production. 15

16 255 Impact of meca genes on oxacillin resistance level. To eliminate the influence of 256 genetic background of clinical strains on oxacillin resistance, meca genes including the 257 promoter regions from five clinical strains [V070 (SCCmec II), M088 (SCCmec III), 258 C103 (SCCmec IV), M183 (SCCmec V), and C027 (SCCmec V)] were cloned into the 259 low-copy-number vector psk5630. Oxacillin susceptibility testing and western blots 260 were performed to evaluate the impact of meca polymorphisms on oxacillin resistance 261 levels and PBP2a production in the isogenic background of the pvl-positive:st59 MSSA 262 strain C195. We found that the oxacillin MICs of some transformants were difficult to 263 interpret because there was a thin layer of growth in the ellipse area around the Etest 264 strips. Therefore, the following oxacillin MICs were determined by BMD, including 265 those of the parental clinical strains. In addition, to provide additional data regarding the 266 impact of meca polymorphisms, we also obtained cefoxitin MICs by BMD. The oxacillin 267 MICs of the parental clinical strains determined by the Etest and BMD methods were 268 comparable, except for strains M088 and M183. Both of the latter strains had oxacillin 269 MICs >256 µg/ml by Etest but only 128 µg/ml by the BMD method (Table 4). 270 The oxacillin resistance levels and PBP2a expression of these meca genes in the 271 C195 background were similar to those of their respective parental clinical MRSA strains 272 (Table 4 and Fig. 3). However, major relevant differences in oxacillin MICs were seen 16

17 273 between the C027 clinical strain and pc027meca/c195 transformants, for which the MIC 274 of the former was in the susceptible range (2 µg/ml) and that of the latter was in the 275 resistant range (8 µg/ml). In contrast, the C027 clinical strain and pc027meca/c transformants had cefoxitin MICs all in the resistant range (16 µg/ml). PBP2a production 277 quantified by western blots showed that pv070meca/c195 transformants yielded higher 278 amounts of PBP2a, followed by pm088meca/c195 and pm183meca/c195 transformants, 279 both with moderate levels of PBP2a production. In contrast, PBP2a expression in 280 pc103meca/c195 and pc027meca/c195 transformants was much lower, especially in 281 the latter, which only had residual PBP2a signal (Fig. 3A). Besides the pvl-positive:st MSSA strain C195 genetic background, we also wanted to test the effects of these meca 283 genes in other genetic backgrounds. Therefore, we transferred these meca genes into 284 another MSSA clinical strain, KSM144 (29), representative of the diverse ST6 genetic 285 background. The oxacillin and cefoxitin resistance levels conferred by these meca genes 286 in the KSM144 background were similar to those in the C195 background (Table 4). 287 Probing the effects of meca gene variants on oxacillin resistance level. To clarify 288 the effects of nucleotide substitutions in the meca promoter on oxacillin resistance in the 289 C195 background, site-directed mutagenesis was performed on the pm088meca plasmid, 290 which carries the meca promoter consensus sequence. In addition to oxacillin 17

18 291 susceptibility testing, western blots were performed to evaluate the contribution of 292 individual nucleotide substitutions to PBP2a production (Fig. 3B). PBP2a in pm088meca 293 G-25A/C195 and pm088meca A-38G/C195 was produced in higher amounts compared 294 to pm088meca, especially in the pm088meca A-38G/C195 mutant, which had the 295 highest amount of PBP2a. The single base mutation in the ribosomal binding site of 296 pm088meca (pm088meca G-7T/C195) caused a significant reduction in expression of 297 PBP2a. In addition, transformants carrying a single-base C to T mutation 33bp (-33) 298 upstream of the meca translation start site (pm088meca C-33T/C195) expressed only a 299 residual amount of PBP2a. Remarkably, an additional A to G mutation located at position (pm088meca C-33T, A-38G/C195) reversed the effect of the C-33T mutation, 301 restoring the expression of PBP2a to a level similar to that of pm088meca. 302 The oxacillin resistance levels of these pm088meca sited-directed promoter mutants 303 in a C195 background were similar to those of the original meca promoter mutants on 304 which they are based (Table 4). For example, pm088meca C-33T/C195 shares the same 305 promoter sequence with pc027meca/c195, and both exhibited similar low levels of 306 oxacillin resistance. In contrast, the meca coding-sequence site-directed mutants of 307 pm088meca had little or no effect on oxacillin resistance, with only pm088meca 308 A438T/C195 and pm088meca G612T/C195 showing minor variability in oxacillin 18

19 309 resistance (Table 4). Thus, these results demonstrate that the promoter-sequence mutants 310 but not the coding-sequence mutants exert important effects on oxacillin resistance. To 311 confirm the effects of the meca coding-sequence mutants, we also performed 312 site-directed mutagenesis on the meca coding sequence of pm183meca plasmid to 313 determine the contributions of positions 438 and 612 on oxacillin resistance. The 314 resulting mutants, pm183meca T438A/C195, pm183meca T612G/C195, pm183meca 315 A675T/C195, and pm183meca G737A/C195, all showed oxacillin resistance levels 316 comparable to that of pm183meca/c195 (128 µg/ml). In contrast to oxacillin resistance, 317 cefoxitin resistance levels of these wild-type and mutant meca genes in a C background exhibited narrow variation (16 to 128 µg/ml) (Table 4). 319 DISCUSSION 320 Although polymorphisms in the meca gene from clinical isolates have been described 321 previously (30), their correlation with the level of -lactam resistance has not been 322 proven. In addition, a number of factors have also been reported to affect the level of 323 methicillin resistance in meca-positive S. aureus. Chromosomal factors such as fem 324 (factors essential for methicillin resistance), aux (auxiliary), and the VraS/VraR 325 two-component regulatory system (31, 32), and environmental factors such as 19

20 326 temperature and salt concentration, have all been shown to influence the level of 327 methicillin resistance (9). The loss of penicillin-binding protein 4 (PBP4) has been shown 328 to cause a reduction in resistance to -lactams in the most common C-MRSA strains in 329 the United States but not in hospital-associated MRSA (H-MRSA) strains (33). A recent 330 study found that, although meca promoter mutations have significant influence on the 331 level of meca transcription and PBP2a levels in a so-called drug clone, they have little 332 effect on the level of -lactam resistance. Rather, the genetic background of the strain 333 appeared to play the major role in governing the level of -lactam resistance (17). Their 334 results concurred with previous conclusions, that there is no direct correlation between 335 the level of -lactam resistance and the quantity of PBP2a (34). Therefore, the regulation 336 of methicillin resistance in meca-positive S. aureus is complex and remains to be 337 elucidated (35). 338 In the present study, sequences of the meca gene from different SCCmec type 339 clinical strains revealed that they contain variable meca promoter substitutions, which 340 appear to correlate with their oxacillin MICs. Analysis of meca promoter-reporter-gene 341 fusion constructs showed that different meca promoter substitutions can indeed have a 342 significant influence on meca transcription, especially a C to T mutation 33bp (-33) 343 upstream of the meca translation start site. This C to T substitution, localized in the

21 344 hexamer region of the meca promoter, is identical to that in various SCCmec V isolates 345 and drug clone CHE482 (17, 18, 36). The majority of these isolates have low-level 346 oxacillin resistant phenotypes. In the absence of BlaI repressor, P C027 (C-33T) exhibited 347 minimal promoter activity, indicating that this substitution allows only relatively 348 low-level transcription in S. aureus unassociated with the binding affinity of BlaI 349 repressor. Some of our SCCmec V isolates had an additional A to G substitution at 350 position -38 within the -10 hexamer and the binding site of BlaI repressor. Because this 351 substitution could increase meca transcription, it thereby compensated the loss of meca 352 promoter activity caused by the C-33T substitution. Another substitution, G-25A in an 353 SCCmec II strain, seems to have a similar effect on meca transcription as the A-38G 354 substitution; both have equivalent transcriptional profiles. A nucleotide substitution at -7, 355 located in the ribosomal binding site of meca and occurring more commonly in SCCmec 356 IV strains (30), also caused down-regulation of promoter activity. This is potentially very 357 interesting, that a specific base within the ribosomal binding site could influence both 358 promoter activity as well as downstream protein production. 359 In the present study, meca gene variants, including promoter and coding region 360 mutants, were cloned into a low-copy-number vector and expressed in an MSSA strain 361 with an ST59 background so as to eliminate the influence of genetic background of 21

22 362 clinical strains on PBP2a production and oxacillin resistance level. Analysis of PBP2a 363 production among the parental and promoter-mutant meca genes revealed a close positive 364 correlation between PBP2a production levels and meca transcription levels. Furthermore, 365 the quantity of PBP2a was also closely correlated with the level of oxacillin resistance in 366 a C195 background. Our results challenge previous conclusions, that there is no direct 367 correlation between the oxacillin MIC and amounts of PBP2a (34). This discrepancy may 368 suggest that the C195 background has not yet acquired (unknown) factors outside the 369 meca gene that contribute to the phenotypic expression of resistance. A previous study by 370 Katayama et al. showed that two mutations in the meca coding sequence produced 371 high-level resistance against -lactams (37). However, this was investigated by passage 372 of a homogeneous MRSA strain COL in L-695,256, an investigational carbapenem. In 373 contrast, polymorphisms in the meca coding sequence from clinical isolates in the present 374 study did not show obvious effects on oxacillin resistance levels. 375 MRSA arises when MSSA acquires an SCCmec element, which contains the meca 376 gene encoding a PBP2a with lowered binding affinity for -lactams (38). Therefore, 377 when some MSSA strains such as C195 and KSM144 newly acquire SCCmec type IV or 378 V they may get one of four types of meca promoter sequence. If a strain acquires a meca 379 gene with the consensus promoter sequence or C-33T/A-38G substitution, it will have a 22

23 380 high oxacillin MIC; with the G-7T substitution it will have a moderate oxacillin MIC; 381 and with the C-33T substitution it will have a low oxacillin MIC. Another possibility is 382 that a low-level resistant clone with a C-33T substitution could become a highly resistant 383 clone by acquiring an additional A-38G mutation upon exposure to -lactam agents. Our 384 results differ from those of a previous study (17), in which meca genes were introduced 385 into the low-level resistant strain CHE482 and the highly resistant strain COLn. Both 386 strains may have carried extraneous chromosomal mutations contributing to the 387 extremely low- or high-level -lactam resistance; therefore, resistance levels did not 388 directly correlate with meca transcription levels in that study. Similarly, in the present 389 study, the SCCmec type V strain C027 was found to have an extremely low oxacillin 390 MIC (see Table 4), which may be caused by extraneous chromosomal mutations, but this 391 remains to be investigated. However, our results could explain the interesting observation 392 that C-MRSA strains in Taiwan carrying SCCmec type IV or V have such enormous 393 variation in oxacillin MICs. 23

24 394 ACKNOWLEDGMENTS 395 We are grateful to Paul Williams (University of Nottingham, UK) for kindly providing 396 many of the bacterial strains and plasmids used in the present study. We thank Tsai-Ling 397 Lauderdale for providing the clinical isolates used in the present study. This project was 398 supported by intramural grants from the National Health Research Institutes 399 (ID-100-PP-07). 24

25 REFFERENCES 1. Vandenesch F, Naimi T, Enright MC, Lina G, Nimmo GR, Heffernan H, Liassine N, Bes M, Greenland T, Reverdy ME, Etienne J Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg. Infect. Dis. 9: Zetola N, Francis JS, Nuermberger EL, Bishai WR Community-acquired meticillin-resistant Staphylococcus aureus: an emerging threat. Lancet Infect Dis 5: Chambers HF The changing epidemiology of Staphylococcus aureus? Emerg Infect Dis 7: Wang CC, Lo WT, Chu ML, Siu LK Epidemiological typing of community-acquired methicillin-resistant Staphylococcus aureus isolates from children in Taiwan. Clin Infect Dis 39: Chen FJ, Lauderdale TL, Huang IW, Lo HJ, Lai JF, Wang HY, Shiau YR, Chen PC, Ito T, Hiramitsu K Methicillin-resistant Staphylococcus aureus in Taiwan. Emerg Infect Dis 11: Huang YC, Su LH, Wu TL, Lin TY Changing molecular epidemiology of methicillin-resistant Staphylococcus aureus bloodstream isolates from a teaching hospital in Northern Taiwan. J Clin Microbiol 44: Chen FJ, Hiramatsu K, Huang IW, Wang CH, Lauderdale TL Panton-Valentine leukocidin (PVL)-positive methicillin-susceptible and resistant Staphylococcus aureus in Taiwan: identification of oxacillin-susceptible meca-positive methicillin-resistant S. aureus. Diagn Microbiol Infect Dis 65: Chen FJ, Huang IW, Wang CH, Chen PC, Wang HY, Lai JF, Shiau YR, Lauderdale TL meca-positive Staphylococcus aureus with low-level oxacillin MIC in Taiwan. J Clin Microbiol 50: Chambers HF Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev 10: Saravolatz LD, Stein GE, Johnson LB Ceftaroline: a novel cephalosporin with activity against methicillin-resistant Staphylococcus aureus. Clin Infect Dis 52: Clarke SR, Dyke KG The signal transducer (BlaRI) and the repressor (BlaI) of the Staphylococcus aureus beta-lactamase operon are inducible. Microbiology 25

26 : Zhang HZ, Hackbarth CJ, Chansky KM, Chambers HF A proteolytic transmembrane signaling pathway and resistance to beta-lactams in staphylococci. Science 291: Kuwahara-Arai K, Kondo N, Hori S, Tateda-Suzuki E, Hiramatsu K Suppression of methicillin resistance in a meca-containing pre-methicillin-resistant Staphylococcus aureus strain is caused by the meci-mediated repression of PBP 2' production. Antimicrob Agents Chemother 40: Lewis RA, Dyke KG MecI represses synthesis from the beta-lactamase operon of Staphylococcus aureus. J Antimicrob Chemother 45: McKinney TK, Sharma VK, Craig WA, Archer GL Transcription of the gene mediating methicillin resistance in Staphylococcus aureus (meca) is corepressed but not coinduced by cognate meca and beta-lactamase regulators. J Bacteriol 183: Hiramatsu K, Suzuki E, Takayama H, Katayama Y, Yokota T Role of penicillinase plasmids in the stability of the meca gene in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 34: Ender M, McCallum N, Berger-Bachi B Impact of meca promoter mutations on meca expression and beta-lactam resistance levels. Int J Med Microbiol 298: Ito T, Ma XX, Takeuchi F, Okuma K, Yuzawa H, Hiramatsu K Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrc. Antimicrob Agents Chemother 48: Ma XX, Ito T, Tiensasitorn C, Jamklang M, Chongtrakool P, Boyle-Vavra S, Daum RS, Hiramatsu K Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains. Antimicrob Agents Chemother 46: Qi W, Ender M, O'Brien F, Imhof A, Ruef C, McCallum N, Berger-Bachi B Molecular epidemiology of methicillin-resistant Staphylococcus aureus in Zurich, Switzerland (2003): prevalence of type IV SCCmec and a new SCCmec element associated with isolates from intravenous drug users. J. Clin. Microbiol. 43: Schenk S, Laddaga RA Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol Lett 73:

27 Clinical and Laboratory Standards Institute Performance Standards for Antimicrobial Susceptibility Testing: 23rd Informational Supplement M100-S23, Clinical and Laboratory Standards Institute, Wayne, PA Lim D, Strynadka NC Structural basis for the beta-lactam resistance of PBP2a from methicillin-resistant Staphylococcus aureus. Nat Struct Biol 9: Studier FW Protein production by auto-induction in high density shaking cultures. Protein Expr Purif 41: Orosz A, Boros I, Venetianer P Analysis of the complex transcription termination region of the Escherichia coli rrnb gene. Eur J Biochem 201: Chen LC, Tsou LT, Chen FJ Ligand-receptor recognition for activation of quorum sensing in Staphylococcus aureus. J Microbiol 47: Grkovic S, Brown MH, Hardie KM, Firth N, Skurray RA Stable low-copy-number Staphylococcus aureus shuttle vectors. Microbiology 149: Weiner MP, Costa GL Rapid PCR site-directed mutagenesis. PCR Methods Appl 4:S Chen FJ, Siu LK, Lin JC, Wang CH, Lu PL Molecular typing and characterization of nasal carriage and community-onset infection methicillin-susceptible Staphylococcus aureus isolates in two Taiwan medical centers. BMC infectious diseases 12: Shukla SK, Ramaswamy SV, Conradt J, Stemper ME, Reich R, Reed KD, Graviss EA Novel polymorphisms in mec genes and a new mec complex type in methicillin-resistant Staphylococcus aureus isolates obtained in rural Wisconsin. Antimicrob Agents Chemother 48: Berger-Bachi B, Rohrer S Factors influencing methicillin resistance in staphylococci. Arch Microbiol 178: Boyle-Vavra S, Yin S, Daum RS The VraS/VraR two-component regulatory system required for oxacillin resistance in community-acquired methicillin-resistant Staphylococcus aureus. FEMS Microbiol Lett 262: Memmi G, Filipe SR, Pinho MG, Fu Z, Cheung A Staphylococcus aureus PBP4 is essential for beta-lactam resistance in community-acquired methicillin-resistant strains. Antimicrob Agents Chemother 52: de Lencastre H, de Jonge BL, Matthews PR, Tomasz A Molecular aspects of methicillin resistance in Staphylococcus aureus. J Antimicrob Chemother 27

28 : Rohrer S, Maki H, Berger-Bachi B What makes resistance to methicillin heterogeneous? J Med Microbiol 52: O'Brien FG, Coombs GW, Pearson JC, Christiansen KJ, Grubb WB Type V staphylococcal cassette chromosome mec in community staphylococci from Australia. Antimicrob Agents Chemother 49: Katayama Y, Zhang HZ, Chambers HF PBP 2a mutations producing very-high-level resistance to beta-lactams. Antimicrob Agents Chemother 48: Hiramatsu K, Cui L, Kuroda M, Ito T The emergence and evolution of methicillin-resistant Staphylococcus aureus. Trends Microbiol 9: Novick RP Genetic systems in staphylococci. Methods Enzymol. 204:

29 519 TABLE 1 Bacterial strains and plasmids used in this study Strain/plasmid Description* Reference/source Strains E. coli NovaBlue BL21(DE3) Competent cell Protein expression cell Novagen Novagen XL10-Gold Ultra-competent cell Stratagene S. aureus RN4220 RN6390B Restriction-deficient strain Laboratory strain (39) (39) V070 ST5:SCCmec type II This study M088 C103 ST239:SCCmec type III ST59:SCCmec type IV, PVL+ This study This study M183 C027 ST59:SCCmec type V, PVL+ ST59:SCCmec type V, PVL+ This study (7) C195 KSM144 ST59 MSSA, PVL+ ST6 MSSA This study (29) 520 Plasmids vector, pet-41 Ek/LIC psk5630 Protein expression vector, Km r Stable low-copy-number shuttle Novagen (27) Ap r, Cm r pluxt2 luxabcde with T2 terminator inserted into SalI/PvuII site of psk5630, Ap r, Cm r This study *Ap r, ampicillin resistance; Cm r, chloramphenicol resistance; Km r, kanamycin resistance 29

30 521 TABLE 2 Primers used in this study Primer Nucleotide sequence (5-3 )* Cloning of meca for recombinant PBP2a purification LIC-mecA-F GACGACGACAAGATGGCTTCAAAAGATAAAGAA ATTAATAATAC LIC-mecA-R GAGGAGAAGCCCGGTTTATTCATCTATATCGTATT TTTTATTACC luxabcde reporter lux-f(sali) lux-r(pvuii) Cloning of meca promoter P meca -F (BamHI) P meca -R (SalI) Cloning of meca gene meca-f (HindIII) meca-r (PvuII) Site-directed mutagenesis P meca A-38G-F P meca A-38G-R P meca G-7T-F P meca G-7T-R P meca G-25A-F P meca G-25A-R P meca C-33T-F P meca C-33T-R P meca C-33T,A-38G-R ACGCGTCGACTAGGTAGGTAATCAGGAGGACTC TCTATGAAATTTG CTCAGCTGTGTAGAAACGCAAAAAGGCCATCC GTCAGGATGGCCTTCTGCTTATCAACTATCAAA CGCTTCGG CGCGGATCCACACATATCGTGAGCAATGAAC ACGCGTCGACCCAAACCCGACAACTACAAC CGCAAGCTTACACATATCGTGAGCAATGAACTGA CGCCAGCTGTGGACTCGTTACAGTGTCACTTTCA GTATACTACAAATGTAGTCTTATA P-TACAAATGTAGTATTTATGTC TATATTGATGAAAAAGATAAAAAT P-CTCCTTATATAAGACTACATTTGTA ATAGTCTTATATAAGGAGGATATT P-ATTTGTAGTATATTACAAATGTAGT TTACAAATGTAGTCTTATATAAGG P-TATATTACAAATGTAGTATTTATGT P-TATACTACAAATGTAGTATTTATGT meca A438T-F AAGCATACATATTGAAAATTTAAAATCAGAACG TGGT meca A438T-R ACCACGTTCTGATTTTAAATTTTCAATATGTATG CTT meca G612T-F CAACAAATGGATCAAAATTGGGTACAAGATGAT AC meca G612T-R GTATCATCTTGTACCCAATTTTGATCCATTTGTT G meca T675A-F AAATGGATGAATATTTAAGAGATTTCGCAAAAA AATTTC meca T675A-R GAAATTTTTTTGCGAAATCTCTTAAATATTCATC CATTT meca A737G-F CGTAACTATCCTCTAGGAAAAGCGACTTCACAT meca A737G-R ATGTGAAGTCGCTTTTCCTAGAGGATAGTTACG *Restriction enzyme sites are underlined. Start and stop codons are double underlined. P represents phosphorylation. Terminator and mutant nucleotides are in boldface. 30

31 TABLE 3 Polymorphisms in the meca gene of different SCCmec-type clinical strains and their oxacillin MICs SCCmec type/strain Nucleotide polymorphisms in the meca gene* Oxacillin MIC ( g/ml) by Etest II V070 A C A G T T T G >256 III M088 A C G G A G T A >256 T177 A C G G A G T A >256 IV C103 A C G T T T T G 48 M153 A C G T T T T A 128 V043 A C G T T T T G 96 T107 A C G G T T T A 64 V088 A C G G T T T A 256 C130 A C G G T T T G 64 V M183 G T G G T T A G >256 M023 G T G G T T A G 16 M187 G T G G T T A G >256 C072 A T G G T T A G 12 T092 A T G G T T A G 16 M204 A T G G T T A G 3 M046 A T G G T T A G 4 C027 A T G G T T A G 1.5 *The positions of the nucleotide substitutions refer to sites upstream (-) or downstream (+) of the meca translational start site. The nucleotide variants are in boldface. Strain names highlighted in bold were chosen for further study. 31

32 529 TABLE 4 Antibiotic MIC values of different strains Strain/Plasmid transformant MIC ( g/ml) by BMD Oxacillin Cefoxitin V070 (II) >256 >256 M088 (III) C103 (IV) C027 (V) M183 (V) psk5630/c * 4 pv070meca/c195 pm088meca/c (3), 256 (3) (5), 128 (1) 32 (3), 64 (3) pc103meca/c195 pc027meca/c pm183meca/c (1), 64 (5) pm088meca/c (3), 64 (3) pm088meca G-25A/C195 pm088meca G-7T/C (4), 256 (2) 32 (4), 64 (2) 64 (5), 128 (1) 32 pm088meca C-33T/C195 pm088meca C-33T, A-38G/C195 4 (5), 8 (1) (3), 64 (3) pm088meca A-38G/C (1), 256 (5) 64 pm088meca A438T/C (2), 128 (4) 32 (3), 64 (3) pm088meca G612T/C195 pm088meca T675A/C (1), 128 (5) (1), 64 (5) 64 pm088meca A737G/C (3), 128 (3) pm183meca/c195 pm183meca T438A/C pm183meca T612G/C (5), 128 (1) pm183meca A675T/C195 pm183meca G737A/C (4), 128 (2) 32 (1), 64 (5) psk5630/ksm pv070meca/ksm (4), 256 (2) 128 pm088meca/ksm (5), 128 (1) pc103meca/ksm144 pc027meca/ksm (3), 64 (3) 8 32 (5), 64 (1) 16 (5), 32 (1) pm183meca/ksm (3), 128 (3) *Antibiotic MIC was determined on three independent transformants on two separate days by BMD using MHB containing chloramphenicol and 2% NaCl for oxacillin wells. Numbers in parentheses indicate the number of times the particular antibiotic MIC value was obtained. 32

33 534 FIGURE LEGEND 535 Figure 1. Western blot of PBP2a. Analysis was performed in the six clinical MRSA 536 strains V070 (SCCmec II), M088 (SCCmec III), C103 (SCCmec IV), M183 (SCCmec V), 537 M046 (SCCmec V), and C027 (SCCmec V). C195 MSSA strain was used as the negative 538 control. Sortase A was used as internal control. 539 Figure 2. Bioluminescent assay was performed to determine the transcriptional level of 540 meca promoter variants. Data are expressed as relative light units (RLU) from three 541 independent transformants in duplicate. (A) In the absence of BlaI repressor, RN6390B 542 background. (B) In the presence of BlaI repressor, C195 background. (C) In a C background with 0.02 g/ml oxacillin induction. 544 Figure 3. Western blots of PBP2a. Analysis was performed on different meca variants in 545 the strain C195. psk5630 vector was used as a negative control. Sortase A was used as 546 an internal control. (A) meca genes under the control of the promoter from clinical strains 547 V070, M088, C103, M183, and C027 were cloned into the psk5630 vector. (B) The 548 pm088meca promoter mutants by site-directed mutagenesis. Quantification of bands was 549 analyzed by densitometric analysis using ImageJ 1.47 software (National Institutes of 550 Health, MD, USA). pm088meca was set at 100% and promoter mutants were expressed 33

34 551 relative to this value. Results are expressed as mean percentages + S.D of three 552 independent experiments. 34

35

36

37