Synapsis, Strand Scission, and Strand Exchange Induced by the

Transcription

1 MOLECULAR AND CELLULAR BIOLOGY, Sept. 1991, p /91/ $02.00/0 Copyright C) 1991, Americn Society for Microiology Vol. 11, No. 9 Synpsis, Strnd Scission, nd Strnd Exchnge Induced y the FLP Recominse: Anlysis with Hlf-FRT Sites ANTHONY AMIN, HERNAN ROCA, KAREN LUETKE, AND PAUL D. SADOWSKI* Deprtment of Medicl Genetics, University of Toronto, Toronto, Ontrio M5S IA8, Cnd Received 15 Jnury 1991/Accepted 13 June 1991 We hve used previously descried cross-linking ssy nd hlf-frt site sustrtes to exmine the requirements for synpsis, strnd exchnge, nd strnd scission. The cross-linking ssy showed tht the minimum functionl FRT site needed for synpsis contins two inverted FLP-inding elements surrounding n 8-p core. This indictes tht four FLP molecules interct with four inding elements in synptic complex. The nlysis using hlf-sites showed tht the enzyme cn ctlyze efficient strnd exchnge etween hlf-site nd the intct FRT site. The rection occurred only if the hlf-site hd t lest 2 p ut no more thn 4 p of the djoining core sequence. The exchnge occurred exclusively t the regions of limited core homology etween the respective hlf-site nd the FRT site. The sence of strnd exchnge etween n intct site nd hlf-site ering regions of core nonhomology indictes tht 1 p of homology is not sufficient for the formtion of stle recominnt structures. Qin et l. (X.-H. Qin, R. B. Inmn, nd M. M. Cox, J. Biol. Chem. 265: , 1990) hve recently shown tht the FLP protein cn ctlyze the formtion of dimeric, trimeric, nd tetrmeric complexes with hlf-frt sites. We show tht only hlf-sites tht contined t lest 2 p of djcent core could form stle dimer products nd e cleved y the enzyme. Stle dimers were formed etween nonclevle hlf-site nd clevle hlf-site, suggesting tht only single clevge event is needed for the formtion of the dimer. Site-specific recominses promote reciprocl exchnges etween short, defined, homologous DNA sequences. The use of in vitro systems for severl different site-specific recominses hs mde it possile to exmine the proteinprotein nd protein-dna interctions involved in the mny trnsition steps of the rections (9, 18, 26). This hs led to the formultion of models tht descrie the mechnisms of the vrious rections (10, 11). The FLP protein encoded y the 2,um plsmid of yest cells is one such site-specific recominse whose in vitro rection is menle to moleculr dissection (6, 8, 29). The trget sequence of the FLP protein, the FRT site, consists of three 13-p symmetry elements designted,, nd c (Fig. 1A). Two of these elements re in inverted orienttion nd seprted y n 8-p core sequence. The recominse ctlyzes clevge of the phosphodiester ond t the junction of the symmetry elements nd the core region (4, 7). This clevge is ccompnied y the formtion of 3' phosphotyrosyl linkge (12). These two junctions re the points of strnd exchnge etween two synpsed FRT sites (15, 21). When the protein is ound to the inverted symmetry elements, shrp end occurs within the core sequence (27, 28) Ẇe recently developed method of isolting synptic nd postsynptic intermedites of the FLP recomintion rection (1). An nlysis of these intermedites indicted tht synpsis occurred y protein-protein interctions etween FLP molecules ound to symmetry elements nd of ech of the pired wild-type FRT sites. In ddition, we showed tht synpsis occurred in the sence of core homology, nd we rgued tht core homology ws importnt only fter synpsis to llow the progression of the rection vi Hollidy intermedite. We hve now further investigted the requirement for * Corresponding uthor synpsis y using the ssy mentioned ove. In ddition, we hve used hlf-frt sites to determine the requirements for strnd clevge nd strnd exchnge. MATERIALS AND METHODS Construction of plsmids. Plsmids were used s vectors s well s sources of prtil FRT sites. The nomenclture of plsmids nd the respective FRT sites they contined is s follows: pgp25, (-]) (24); pba116, ( - -[) (4); nd pba114, (]<-) (5). (The rrows represent the 13-p symmetry elements nd their reltive orienttions. The squre rckets represent the mrgin[s] of the 8-p core region.) The full FRT site ws otined on 123-p EcoRI-BmHI frgment from plsmid pgp25. The ends of the frgment were repired y vin myelolstosis virus reverse trnscriptse nd the four deoxynucleoside triphosphtes (4) prior to ligtion into the respective recipient vector. Ech vector ws prepred for ligtion y lineriztion with PstI. The PstI ends were mde lunt y the 3' exonuclese of T4 DNA polymerse. The EcoRI-BmHI frgment contining the FRT site ws ligted to the pproprite vector, nd constructs with the core sequences in direct orienttion were isolted. A 263-p HincII-SspI frgment derived from plsmid pbr322 ws ligted into the lunt-ended HincII site etween the two FRT sites of ech of these new plsmids. Figure 1B summrizes the vrious constructs nd the pirwise comintions of FRT sites they contin. The reversecore FRT site contined in pcs31 ws constructed y using synthetic oligonucleotides nd ws identicl to tht contined in plb112 (5) except tht the 8-p core ws inverted with respect to its orienttion in the wild-type FRT site. This plsmid ws the gift of Crol Schwrtz. Purifiction of 32P-end-leled DNA sustrtes. Synptic sustrtes were prepred y digestion of 15,ug of the pproprite plsmid with EcoRI nd HindlIl. The hlf-site nd sustrtes were generted y digestion of plsmid

2 4498 AMIN ET AL. MOL. CELL. BIOL. A c It TAAGTTC CTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCA ACTTCAAGGATAACOCTTCAAGGATAAGAGATCTTTCATATCCTTGAAGT pgp25 : I pba116 : I B (1) pbai 14 : BW I _nkf+ 123 E W (i) pgp25: PHB 4F_, 131 E (ii) pba116 : PHB L E 77 (III) pba I 114 PH 44 E (2) H(x) 263 HInc 11 S(x (1) plt9: Plx) PWHB... _n E (II) plt1i: P(xW PWHB c E ll --r. (ii) plt8: pw POW)HB E (3) (I) pps799: I pw Fid--- PWx H HOWB.. _ E (1I) pps792: I pw P(x) H H(x)B c E.. --r. (I11) pps798: I PW P(x) H H(x) B E 5 0 FIG. 1. (A) The FRT site. The site comprises three 13-p symmetry elements designted,, nd c. Elements nd re in inverted orienttion seprted y n 8-p core region. Element c is in tndem with element. The sequence of the XI site is underlined, nd smll verticl rrows indicte the onds cleved y the restriction enzyme. Lrge verticl rrows show the sites of clevge y the FLP protein. Horizontl rs eneth the sites indicte the sequence of the FRT site in plsmids pgp25, pba116, nd pba114. (B) Construction of plsmids used to isolte synpsis sustrtes. (1) A 123-p BmHI-EcoRI frgment from pgp25 ws ligted into the lunt-ended PstI site of the prent plsmid pgp25 (i), pba116 (ii), or pba114 (iii). Ech of these plsmids contins prtil FRT site on PstI-to-EcoRI frgment. The lengths of these frgments nd the disposition of the FRT sites re shown t the right. (2) The resulting plsmids contined two prtil FRT sites nd were clled plt9 (i), plt1 (ii), nd plt8 (iii). A 263-p HincII-SspI frgment from pbr322 ws then ligted into the HinclI site of plt9, plt1, or plt8. (3) This gve plsmids pps799 (i), pps792 (ii), nd pps798 (iii). The synptic sustrtes lierted from ech of these plsmids with Hindlll nd EcoRI re shown in prt 3. Lengths re pproximtely to scle. Br = -50 p. Restriction sites: E, EcoRI; B, BmHI; H, HincII; P, PstI; I, Hindlll. The x in rckets indictes tht the site hs een destroyed y the cloning procedure. The numers re lengths of frgments (in se pirs). pgp25 with EcoRI nd XI or HindlIl nd XI, respectively (Fig. 1 nd 2). Frgments were leled t their 3' recessed ends y using vin myelolstosis virus reverse trnscriptse nd [o-32p]datp or t their dephosphorylted 5' ends y using polynucleotide kinse nd [y-32p]atp. If the frgment ws to e uniquely leled, the plsmid ws digested with the first enzyme nd the ends were leled y the pproprite method. The rection ws terminted y heting t 65 C for 15 min followed y digestion with the second enzyme. The frgments were purified y polycrylmide gel electrophoresis, electroelution, nd ethnol precipittion.

3 VOL. 1 l, 1991 SC FLP Glut Sc I ll-. RP-. -~~O~- -:O4- c -~~~~~~~~~~~~~~~~~~~ Co T- N w- s co v o 0 v X 0 _r _r v- :. il I - i45 S-:w FIG. 2. Synpsis ssy. 32P-end-leled sustrte ws incuted with FLP protein, where indicted, t 22 C for 10 min. Where indicted, glutrldehyde (Glut) ws dded to finl concentrtion of 0.02%, nd the smples were incuted for n dditionl 3 min. The cross-linking rections were quenched with lysine. nd the smples were sujected to electrophoresis on 3% polycrylmide gel. Lnes: 1, untreted sustrte -[]-: -[]-; 2, sustrte incuted with 60 U of FLP; 3, sustrte incuted with 30 U of FLP followed y the ddition of glutrldehyde; 4, sustrte incuted with 60 U of FLP followed y the ddition of glutrldehyde; 5 to 8, sustrte )-*[:-]- processed s descried for lnes 1 through 4; 9 to 12, sustrte ]:-]- processed s descried for lnes 1 through 4. S, sustrte; RP, recomintion product. SCI nd SCII re synptic complexes. FLP preprtion. The FLP used ws Sephcryl S300 frction (50 to 85% pure) tht contined 0.3 mg/ml nd 30 U/pl. This protein ws the gift of Hu Pn (23). In vitro synpsis ssys. The synpsis ssy ws done essentilly s previously descried with minor modifictions (1). Aout 0.02 pmol of 32P-end-leled sustrte ws incuted with FLP protein on ice for 4 min, fter which glutrldehyde (finl concentrtion of 0.02%) ws dded for 3 min. The rection ws quenched with 1 mm lysine. Smples were then immeditely sujected to electrophoresis on 3% polycrylmide gel t 8 C. The gels were dried nd exposed to X-ry film. In vitro recomintion ssys. For nlyticl rections, 0.02 pmol of 32P-end-leled frgment contining the hlfsite ws comined with 0.04 pmol of the PvuII-PvuII frgment of plsmid pgp25 in 25 pul of solution contining 50 mm TAPS uffer [N-tris(hydroxymethyl)methyl-3-minopropnesulfonic cid; ph 8.0), 0.2 M NCl, 20% polyethylene glycol 4000, nd 1.5 jig of dentured clf thymus DNA. Vrious concentrtions of FLP protein were dded, nd the smples were incuted t 22 C for 20 min. The rections were terminted y the ddition of sodium dodecyl sulfte (SDS) (0.004%) nd proteinse K (10,ug) nd were incuted FLP RECOMBINASE 4499 t 37 C for 20 min, fter which the smples were nlyzed on 4% ntive polycrylmide gel (2). Preprtion of recominnt structures. Preprtive rections were crried out essentilly s descried ove except tht 0.2 pmol of the pproprite 32P-leled hlf-site ws comined with 0.4 pmol of the PvuII-PvuII frgment of pgp25 in 75 RI of uffer contining 3,ug of dentured clf thymus DNA. In some experiments, the 5' termini of this PvuII frgment were lso leled with 32p. Purified FLP (45 to 150 U) ws dded, nd the smples were processed s descried ove. The recominnt structures were electroeluted from the gel slice nd recovered y ethnol precipittion. A portion of the DNA ws nlyzed on n 8% polycrylmide-ure gel s descried elsewhere (1). In vitro rections for hlf-site dimer formtion. Hlf-FRT site dimers were formed under the sme conditions s were descried for the recomintion ssys. The smples were sujected to electrophoresis on 4% polycrylmide gel without the ddition of SDS nd proteinse K. Assy for covlent ttchment of FLP to hlf-frt sites. The HindIII-XI frgment of hlf-site ws 32p leled t the 5' end of the HindIII terminus, nd the EcoRI-XI frgment of hlf-site ws 32p leled t the 5' end of the EcoRI terminus. Aout 0.16 pmol of hlf-site with 1-p core, hlf-site with 2-p core, or hlf-site with 3-p core ws incuted in 200,u1 of 50 mm TAPS uffer (ph 8.0)-0.2 M NCI-20% polyethylene glycol % glycerol-50 p.g of dentured clf thymus DNA per ml. Before ddition of FLP, 20 p,l of ech smple ws dded to 10 pul of 3 x denturing uffer (10% glycerol, 3% SDS, 62.5 mm Tris HCl [ph 6.8], 0.7 M 3-mercptoethnol) (17). Four microliters of FLP (120 U) ws dded to ech of the remining rections t room temperture, nd 20 pi of ech rection ws dded to 10 pu1 of 3x denturing uffer fter 2, 4, 6, 8, 10, nd 20 min of incution. 32P-leled Su3A frgments of pbr322 were used s size mrkers. The smples were heted t 37 C for 20 min nd then electrophoresed on 7.5% SDS-polycrylmide gel (17). Following electrophoresis, the gel ws shken gently in wter for 20 min to remove SDS. The gel ws dried nd exposed to X-ry film. RESULTS Efficient synpsis requires pir of FRT sites, ech contining two inverted symmetry elements. We previously developed method to isolte synptic nd postsynptic intermedites in the FLP recomintion rection (1). We lso used DNse I footprinting experiments to demonstrte tht the synptic intermedites contined FLP protein ound only to elements nd of the pired wild-type FRT sites. However, these studies did not ddress the minimum structurl requirements of the FRT sites involved in synpsis. The wild-type FRT site consists of three 13-p symmetry elements (,, nd c; Fig. 1). Since symmetry element c is dispensle for recomintion, the FLP protein must effect efficient synpsis nd strnd exchnge with miniml functionl site consisting of elements nd nd the core. To determine the minimum structurl requirements for synpsis, we sked whether the enzyme could promote synpsis etween the minimum FRT site nd vrious prtil FRT sites. Accordingly, plsmids tht contined vrious pirwise comintions of the miniml wild-type nd prtil FRT sites were constructed (see Mterils nd Methods nd Fig. 1). Figure 1B illustrtes the disposition of the vrious sites on the respective sustrtes derived from these plsmids. The sustrtes were designted ccording to the

4 4500 AMIN ET AL. comintion of sites they contined, i.e., []:[] from pps799, -*>[:- - from pps792, nd ]:[] from pps798. The results of this experiment re shown in Fig. 2. Two synptic complexes, designted SC I nd SC II, were detected only in rections contining sustrte -]:[] (lnes 3 nd 4). As expected, these intermedites were sent in the rection not treted with glutrldehyde (lne 2). The SC I complex likely contins the FRT sites ligned in the proper configurtion (s defined in reference 1), since the strnd exchnge products derived from this complex re of the size predicted for this lignment (dt not shown). We postulte tht the SC II complex contins the sites ligned in the errnt configurtion, since no strnd exchnge products were oserved (1). The mounts of cross-linked complexes otined from sustrte ]:-] (lnes 7 nd 8) or sustrte - >[:- ] (lnes 11 nd 12) were significntly reduced. These results suggest tht the FLP protein occupies elements nd of the FRT site ([]) to form complex which cn then synpse in specific wy with similr complex. FLP enzyme requires hlf-site with t lest 2 p of djoining core to ctlyze strnd exchnge with intct FRT site. The results given ove indicte tht four symmetry elements re involved in the formtion of synptic complex. However, we oserved extremely low mounts of cross-linked species in rections involving sustrtes > >[: -.[]*- nd ]:[] (rely visile in Fig. 2, lnes 7, 8, 11, nd 12, ut discernile in longer exposures). Therefore, we wished to use more sensitive technique to determine whether the FLP protein could ctlyze strnd exchnge (nd therefore synpsis) etween hlf-frt site nd the minimum functionl FRT site from plsmid pgp25 (24). We therefore dpted the hlf-site ssy descried y Lndy nd coworkers for the lmd Int recomintion system (22, 23). The sis of this ssy is tht if FLP ctlyzes strnd scission of hlf-frt site, the oligonucleotide tht is generted is lost y diffusion, leving the FLP protein covlently ound to the hlf-site vi phosphotyrosine ond (12) (Fig. 3, prt ii). The FRT site of pgp25 is composed of the inverted symmetry elements nd seprted y n 8-p core region tht lso contins n XI restriction site. XI digestion will therefore generte two frgments: one contins element with 3 p of the intct core sequence (hlf-site ), nd the other contins element nd 1 p of the djcent core (hlf-site ). Ech frgment lso contins 4-nucleotide single-strnded til. Restriction frgments contining hlfsites with either element or element were prepred y digestion of plsmid pgp25 with either EcoRI-XI or XI-HindIII, respectively, nd the ends were leled with 32p (Fig. 3, prts i nd ii). The nonrdioctive PvuII-PvuII frgment contining the FRT site of pgp25 (Fig. 3, prt iii) ws comined with ech hlf-site nd incuted with vrious concentrtions of FLP protein. A strnd trnsfer rection etween hlf-site nd the intct FRT site would result in the formtion of 32P-leled three-rmed Y structure with single-strnded rnch point. The recominnt structure should migrte more slowly thn the progenitor hlf-site in the polycrylmide gel. The results of this experiment (Fig. 4A) show the presence of mjor slowly migrting species (XP1). This structure ws detected only in the rections contining hlf-site (lnes 2, 3, nd 4) nd not in rections with hlf-site (lnes 5 to 8). Two other minor nds tht migrte fster thn XP1 ut more slowly thn the sustrte re lso detectle (XP2 nd XP3). The possile origin of «I ) H _CTAGAAA _E 11AGATC TTT x ii) H T -AGA~AGTC X iii) t *T-*Ti H x E MOL. CELL. BIOL. FIG. 3. Sustrtes used in recomintion ssys. (i) The HindIll- EcoRI frgment of plsmid pgp25 contins n FRT site with elements nd nd the core etween them. The XI site in the core sequence is underlined, nd onds cleved y XI re shown y smll verticl rrows. The clevge sites of the FLP protein re indicted y lrge rrows. (ii) Hlf-site generted y clevge with HindlIl (H) nd XI (X) nd hlf-site generted y clevge with EcoRI (E) nd XI (X). Strred nucleotides will e lost fter FLP clevge t the sites indicted y the verticl rrows. (iii) PvuII- PvuII (P) frgment, which contins the FRT site symmetriclly positioned with respect to the ends of the frgment. The lengths of pertinent frgments re indicted (in se pirs) y the numers etween djcent restriction sites. these species is discussed elow. The pprent inility of the FLP protein to ctlyze strnd exchnge etween hlfsite nd the FRT site ws further investigted nd shown to e due to the presence of only single se pir of the djcent core. One ovious difference etween the nd hlf-sites ws tht the former contins 3 p of the core region wheres the ltter contins only 1 p (Fig. 3). We therefore wished to determine whether lengthening the duplex core region djcent to hlf-site rendered the site recomintion competent. The pproprite nonrdioctive nucleotides were incorported into the 3' recessed end of the XI terminus of the restriction frgment contining hlf-site to produce hlfsites with 2, 3, 4, nd 5 p of the djoining core sequence. The recomintion rections were repeted with these modified hlf-sites nd the intct FRT site s descried ove. The results, shown in Fig. 4B, show the presence of recomintion product (XP1) in the rections with the modified sustrtes. The yield of the recominnt structure ws highest when the hlf-site contined 2 p of the core sequence (lnes 6 to 8). Moderte yields were oserved for the hlf-sites with core sequences of 3 p (lnes 10 to 12) nd 4 p (lnes 14 to 16), nd low ut detectle yield ws oserved with the hlf-site contining 5 p of the core (lnes 18, 19, nd 20). One of the puttive minor recomintion products (XP3) ws lso visile. The product (XP2) corresponding to tht formed with the hlf-site might hve comigrted with XP1. Thus, there is strict requirement for 2 to 4 p of the djoining core region in order for FLP to ctlyze n efficient strnd exchnge rection etween hlfsite nd the intct FRT site. Chrcteriztion of recomintion products. If the hlfsites re forming stle products y recomining with full site, we should e le to deduce the origin of recominnt structures y nlyzing the size of the products y denturing gel electrophoresis. Accordingly, recomintion rections etween ppropritely 5'-leled or hlf-sites nd

5 VOL. 1 l, 1991 A W " m - N n v XP1 XP2 XP3 -.. B XP1. 3 '4- ( l ) (2) (3) o - c-4 - cq m V mn od r. C)% FLP RECOMBINASE 4501 (4) " V Lf O (5) r- :l 0 Q% 0 - Cq Si S2 S FIG. 4. (A) In vitro recomintion ssys with hlf-sites nd. The PvuII-PvuII frgment ws incuted with hlf-site or nd FLP protein t room temperture for 20 min. Rections were terminted with SDS nd proteinse K, nd the mixtures were sujected to electrophoresis on polycrylmide gel. Si nd S2, nd hlf-site sustrtes, respectively; XP1, XP2, nd XP3, recomintion products of S1; M, 32P-leled Su3A-cut pbr322 frgments (numers indicte lengths in se pirs). Lnes: 1 nd 5, no FLP; 2 nd 6, 7.5 U of FLP; 3 nd 7, 15 U of FLP; 4 nd 8, 30 U of FLP; 1 to 4, hlf-site ; 5 to 8, hlf-site with 1 p of core. (B) Formtion of recominnt structures with hlf-sites contining 1 to 5 p of the djcent core region. The XI end of the hlf-site sustrte ws repired in the presence of no triphosphte [(1)]; dctp [(2)]; dctp nd TTP [(3)]; dctp, dttp, nd datp [(4)]; or dctp, dttp, datp, nd dgtp [(5)] nd reverse trnscriptse to give cores with 1 to 5 p, respectively. These sustrtes were incuted with the PvuII-PvuII frgment, nd the rections were processed nd nlyzed s descried for pnel A. Lnes: 1, 5, 9, 13, nd 17, no FLP; 2, 6, 10, 14, nd 18, 7.5 U of FLP; 3, 7, 11, 15, nd 19, 15 U of FLP; 4, 8, 12, 16, nd 20, 30 U of FLP. S, sustrte. Recominnt products XP1 nd XP3 re indicted. 411-p unleled frgment contining complete FRT site were crried out, nd the mjor recomintion product (XP1) ws isolted. The leled strnds were nlyzed on denturing crylmide gel. Schemtic digrms of the simplest possile three-rmed Y structures tht would e formed etween or hlf-sites nd the full FRT site re shown in Fig. 5A. If FLP ctlyzed strnd exchnge etween hlf-site nd the symmetry element-core junction of the FRT site, the recominnt product would contin single strnd tht ws 323 nucleotides (nt) in length (Fig. 5A, prt i) nd would e detected when the 5' end-leled EcoRI terminus of the hlf-site ws used. If the exchnge occurred etween hlfsite nd the symmetry element-core junction of the FRT site, the product would contin 286-nt single strnd (Fig. 5A, prt ii). Since only the 323-nt product ws oserved (Fig. SB, lne 4), the recominnt structure ws formed only y n exchnge etween hlf-site nd the element-core junction of the intct site. The product tht could hve resulted from n exchnge etween hlf-site nd the element-core junction of the FRT site ws not detected (lne 4). The strnd leled t the 5' end of the XI terminus hd not undergone strnd exchnge in the formtion of the recominnt structure s expected (lne 2). Likewise, if the enzyme ctlyzed strnd exchnge etween hlf-site nd the symmetry element-core junction of the intct FRT site, s shown in Fig. 5A, prt iii, the product would contin 232-nt single strnd nd would e detected only when the 5' end of the HindlIl terminus of the hlf-site ws leled. On the other hnd, if the exchnge occurred etween hlf-site nd the element-core junction of the FRT site, s indicted in Fig. 5A, prt iv, the single strnd would e 269 nt long. The results indicte tht the only single strnd present in the exchnge product ws 232 nt (see Fig. 5B, lne 8), reveling tht only the exchnge etween hlf-site nd the symmetry element-core junction of the intct site occurred. The single strnd resulting from n exchnge etween hlf-site nd the element-core junction of the FRT site ws not detected (lne 8). In ddition, the recominnt strnd leled t the 5' terminus of the XI end hd not undergone strnd exchnge (lne 6). These results indicte tht the stle recominnt structures re formed in strnd exchnge rection etween the respective hlf-sites nd the intct FRT site only t the region of core homology. As digrmmed in Fig. SA, prt i, the puttive Y structure would contin nick on the ottom strnd, with FLP ttched to the 3' end t the nick. Since the rections were treted with proteinse K, this strnd (183 nt) would hve een detectle if the 5' ends of the 411-p PvuII frgment hd een 32p leled. Nicking of the top strnd of the PvuII frgment would give 220-nt strnd. Therefore, the experiment ws repeted using oth 5'-leled hlf-site nd 5'-leled PvuII frgment (Fig. 6). When the entire rection ws run directly on denturing gel (Fig. 6A, lne 1), frgments indictive of nicking of oth the ottom nd top strnds of the PvuII frgment (183 nd 220 nt, respectively) were detected. However, frgment indictive of only one of the two possile strnd exchnge products (323 nt) ws seen. When the isolted recominnt structure XP1 ws nlyzed (Fig. 6B, lne 1), only the 323-nt strnd exchnge product nd the product of nicking of the ottom strnd (183 nt) were seen. Thus, the recominnt structure XP1 is consistent with tht digrmmed in Fig. 5A, prt i. When the sme experiment ws done with the hlf-site, similr results were otined. In the entire rection, oth nicked strnds of the PvuII frgment (183 nd 220 nt) ut only one recominnt strnd (232 nt) were seen (Fig. 6B, lne 1). XP1 contined only the 232- nd 220-nt strnds. The

6 4502 AMIN ET AL. MOL. CELL. BIOL. A (i) p 98 X 5 s* rx_ '~- I 4 -t ' n 5' E B C e l (ii) p E 3_ 5' 2 20 e 286 5' 3' D, P1i (323) P2 - (232) 1t 378 -w 6 68P S ' 321 : (i) p 5 / 4 2 t 8 ~~~~ P 5' Si - t98) 0"Y (iv) P 5 3' 269 e 3' ---~- - * - - 5'.P _\- -5 X 5' - 3' H 42 FIG. 5. (A) Possile structures formed y n FLP-ctlyzed strnd exchnge etweeni the PvuII-PvuII frgment (411 p) nd either the or the hlf-site. (i) Exchnge etween hlf-site nd element-core junction. (ii) Exchnge etween hlf-site nd element-core junction. (iii) Exchnge etween hlf-site nd element-core junction. (iv) Exchnge etween hlf-site nd element-core junction. P, PvuII; H, HindIII; E, EcoRI; X, XI. The polrity (5' nd 3') of strnds is indicted. Sizes (in nucleotides) of unrected, nicked, nd recominnt strnds re indicted y the numers. Filled circle indictes FLP covlently ound to the FRT site. (B) Strnd-denturing gel of recominnt structures. Recominnt structures were formed in n FLP-medited rection contining the PvuII-PvuIl frgment of the FRT site nd either hlf-site or hlf-site with 2 p of core (Mterils nd Methods). The respective XP1 structures were gel purified nd sujected to electrophoresis on n 8% denturing polycrylmide-ure gel. Lnes: 1, hlf-site sustrte 5' leled t XI end; 2, XP1 otined from sme hlf-site; 3, hlf-site 5' leled t EcoRI end; 4, XP1 otined with sme hlf-site; 5, hlf-site 5' leled t XI end; 6, XP1 derived from sme sustrte; 7, hlf-site 5' leled t HindlIl end; 8, XP1 from sme sustrte. S1, hlf-site sustrte; P1, strnd exchnge product from the rection with hlf-site ; S2, hlf-site sustrte; P2, strnd exchnge product from the rection with hlf-site with 2 p of the core; M, mrkers from Su3A digest of pbr322 plsmid 3' leled with 32p. Numers indicte lengths of strnds (in nucleotides). S2 _ (42) 50 structure of XP1 is thus consistent with tht shown in Fig. 5A, prt iii. The nture of minor products XP2 nd XP3. In order to gin some insight into the structures of products XP2 nd XP3, smll mounts of these products were recovered from preprtive gel used to nlyze the products of rection of 5'-32P-leled hlf-site ( or ) with the nonrdioctive PvuII frgment. Both XP2 nd XP3 contined the sme 323- or 232-nt leled single strnd found in XP1 (Fig. 7). We were unle to isolte preprtive mounts of XP2 nd XP3 when the PvuII frgment ws 32p leled. This my e ecuse they comigrted either with XP1 (for XP2) or with the PvuII sustrte (for XP3). The possile origin of the recomintion products XP1, XP2, nd XP3 will e ddressed in the discussion. Homology of core regions is required for formtion of recominnt structure XPl. Although core homology etween recomining FRT sites is required for the progression of FLP-induced recomintion (3), it should e noted tht the nucleotide sequence of the element differs from tht of the element t position 2 p from the element-core junction of the FRT site (Fig. 1). Therefore, it ws importnt to scertin whether the formtion of stle recominnt structures ws dependent on core homology etween the hlf-site nd the intct FRT site or on homology etween the symmetry elements of the hlf-site nd the intct FRT site. To ddress this issue, we used n FRT site tht hd n inverted core region surrounded y the norml symmetry elements nd (clled reverse-core sustrte). This reverse-core FRT site ws otined on n 80-p EcoRI-BmHI frgment. If core homology is importnt for formtion of stle recominnt structures, hlf-site should recomine with the symmetry element-core junction of the reversecore FRT site, wheres hlf-site should recomine only with the symmetry element-core junction of the site. Accordingly, nonrdioctive reverse-core sustrte ws incuted with 32P-leled frgment contining either hlfsite or hlf-site with 2 p of the core in the presence of FLP. DNA from the resulting recominnt products ws then sujected to electrophoresis on polycrylmide-ure

7 VOL. 11, 1991 FLP RECOMBINASE 4503 A 1 2 X B *'2 il2 *itu 1.2.it. - 23> 1 1): X X CL _ 0C L Vn x x x en X x (41 1) -" -363 (3 2 3) _ (232) _ 282 (220) ( 183)- I I I- (4 1 1 ) } _ 1= (232)_ (220) - (183)- to _, (323)..._ -.- (232) i: l (98) -# ni - 95 (98) (98)-m (42) _ (42) - 50 FIG. 6. Anlysis of products of FLP rection with 5'-32P-leled hlf-sites nd 5'-32P-leled PvuII frgment. Rection conditions were identicl to those used for Fig. 5B except tht the Pvull frgment ws lso 5' leled with 32p. (A) Entire rection mixtures were treted with proteinse K nd SDS, ethnol precipitted, nd nlyzed on denturing 8% ure-crylmide gel. Lnes: 1, leled hlf-site nd PvuII frgment with FLP (15 U); 2, sme s lne 1 ut no FLP; 3, leled hlf-site nd unleled PvuII frgment with FLP; 4, sme s lne 3 ut no FLP; 5, leled hlf-site nd PvuII frgment with FLP; 6, sme s lne 5 ut no FLP; 7, leled hlf-site nd unleled PvuII frgment with FLP; 8, sme s lne 7 ut no FLP. Numers in prentheses t the left indicte the lengths (in nucleotides) of the pertinent sustrte strnd exchnge products or nicked strnds. The numers t the right re the lengths (in nucleotides) of mrker frgments. (B) Bnds were excised from preprtive 4% ntive crylmide gel tht contined the rection mixtures descried ove. After electroelution nd ethnol precipittion, DNA ws nlyzed s for pnel A. Lnes: 1, XP1- hlf-site; 2, PvuII sustrte; 3, hlf-site ; 4, XP1- hlf-site; 5, PvuII sustrte; 6, hlf-site. Numers indicte the sme frgments indicted in pnel A. gel eside dentured 32P-leled mrker frgments. The possile results re shown in Fig. 8A. When 32P-leled hlf-site ws used, the exchnge product of the recominnt structure ws 122 nt (P1, lne 2, Fig. 8B; Fig. 8A, prt i). However, when 32P-leled hlfsite ws used, the exchnge product ws 98 nt (P2, lne 6, Fig. 8B; Fig. 8A, digrm iii). The products of exchnge etween the hlf-site nd the element -core junction (152 nt) nd etween the hlf-site nd the element -core junction (62 nt) were not seen. These results indicte tht strnd exchnge in the formtion of recominnt structures requires the presence of core homology nd strengthen the conclusion tht homology etween the two recomining cores of hlf-site nd full FRT site is necessry to stilize the recominnt structure. Only recomintion-proficient hlf-sites form stle dimer complexes with the FLP protein. Qin et l. (25) hve shown (42) FIG. 7. Single strnds contined in recominnt products XP1, XP2, nd XP3. The recominnt products were isolted from preprtive rection mixture contining 5'-32P-leled hlf-site (lnes 1 to 4) or hlf-site (lnes 5 to 7) nd run on n 8% ure-sequencing gel. Lnes: 1, sustrte; 2, XP1; 3, XP2; 4, XP3; 5, sustrte; 6, XP1; 7, XP3. Numers indicte the sme frgments s in Fig. 6A. tht the FLP protein cn ind to hlf sites nd promote the formtion of stle dimers of the hlf-sites through strong protein-protein interctions cross the core region. The ility of the protein to promote dimer formtion is dependent on the length of the core sequence of the hlf-sites nd the strnd clevge ctivity of the FLP protein. We were interested in lerning if there might e correltion etween the ility of FLP to form dimers nd to ctlyze the formtion of recominnt structures with hlf-sites. The 32P-leled hlf-sites were ech incuted with FLP protein, nd the rections were nlyzed on ntive polycrylmide gel (Fig. 9). FLP could ind to the single symmetry element of ll the hlf-sites to form complex I. The slowly migrting nd designted D is the puttive dimer nd ws detected in sustntil mounts in rections contining the hlf-site sustrtes with core sequences of 2 p (Fig. 9A, lnes 6, 7, nd 8), 3 p (lnes 10, 11, nd 12), nd 4 p (lnes 14, 15, nd 16) ut not with the hlf-site contining core sequence of only 1 p (lnes 2, 3, nd 4). The highest yield of dimer ws detected for the site hving 3 to 4 p of the core, nd low yields were otined with the site contining 5 p of the core (lnes 18, 19, nd 20). Smller mounts of pprent trimeric nd tetrmeric species were seen long with the dimers. We identify these species s the sme s the multimeric species

8 4504 AMIN ET AL. MOL. CELL. BIOL. ii) E A i) B5B ' E 3' ~~~~~~~~~5' X 5- B 5ff~~ ~~~II._ C ' B 53' 3 3' qi oi 5' X 5' B x * zc * -J X,J IZ I sl X 1 G V1, X Ln X U1 X (} > B M ' B 3 1' PT 1CP / iii) H - 5X v' 42 c 98 3 E 5' P1 - P2 _ s 1-1o iv) B 5 c 5 E J62 X \ 5 H S2 _ x 3 42 FIG. 8. (A) Possile exchnge products of hlf-frt sites with reverse core sustrte. (i) hlf-site hs ligned with the symmetry element of the reverse-core sustrte nd formed 122-nt exchnge product (pnel B, lne 2). (ii) hlf-site hs ligned with the symmetry element of the reverse-core sustrte nd formed 152-nt exchnge product (not found). (iii) hlf-site hs ligned with the symmetry element of the reverse-core sustrte nd formed 98-nt exchnge product (pnel B, lne 6). (iv) hlf-site hs ligned with the symmetry element of the reverse-core sustrte nd formed 62-nt exchnge product (not found). The reverse-core sustrte (top duplex of ech digrm) is 80 p, the hlf-site is 94 p, nd the hlf-site is 38 p.,, nd c, symmetry elements,, nd c, respectively; B, BmHI end; E, EcoRI end; H, Hindlll end; X, XI end. The filled circle represents FLP covlently ttched to the 3'-phosphoryl terminus. (B) DNA from recominnt structures (XP1) ws processed s indicted in the legend to Fig. SB. Lnes: 1 nd 2, DNA from hlf-site sustrte 32P leled t the 5' end of the EcoRI terminus; 3 nd 4, hlf-site 32P leled t the 5' end of the XI terminus; 5 nd 6, hlf-site with 2 p of core 32p leled t the 5' end of the HindIlI terminus; 7 nd 8, hlf-site with 2 p of core 32p leled t the 5' end of the X terminus; 1, 3, 5, nd 7, unrected sustrte DNA (S); 2, 4, 6, nd 8, DNA from recominnt products (P); Si, hlf-site sustrte (98 nt); P1, strnd exchnge product from rection with hlf-site (122 nt); S2, hlf-site sustrte (42 nt); P2, strnd exchnge product from rection with hlf-site with 2 p of core (98 nt); M, mrker frgments. For the Su3A digest of pbr322 plsmid, lengths re indicted (in nucleotides). 50 of Qin et l. (25) for the following resons. First, their formtion is dependent on the length of the core; they do not form if the doule strnd in the core is too long (Fig. 9). Second, the formtion of the multimers requires strnd clevge nd covlent ttchment of the FLP protein. If the sustrte (this pper) or the FLP protein (dt not shown) is deficient in this ility, the multimeric species do not form. Third, we hve oserved tht the dimeric species comigrtes with FLP-DNA complex formed when two molecules of FLP ind to n FRT site locted in the middle of DNA molecule tht is twice the length of n hlf-site (19). We interpret this to men tht the DNA of the hlf-site dimeric species is cutely ent, just s DNA of n intct site undergoes FLP-induced ending (27, 28). As shown in Fig. 9B, the dimer product ws lso oserved in rections with hlf-site which hd 3 p of the djoining core (lnes 2, 3, nd 4). Hlf-site with 4-p core showed drstic reduction in dimer formtion with the FLP protein (lnes 6, 7, nd 8). These nd the previous results suggest tht dimer formtion requires t lest 2 p of the core nd tht FLP-medited formtion of stle dimers etween two hlf-sites is importnt for the strnd exchnge with n intct FRT site. We oserved drstic reduction in the yield of dimers nd recominnt structures with hlf-site with 5-p core, suggesting tht stle dimer formtion is medited y protein-protein interctions cross the core. This result is consistent with tht of Qin et l. (25). FLP protein is unle to cleve hlf-site hving 1 p of core. Qin et l. (25) hve lso oserved correltion etween strnd clevge nd dimer formtion in rections with hlf-frt sites. The inility of the FLP protein to form stle dimers with hlf-site hving 1 p of core could hve een due to the inility of the protein to ctlyze strnd clevge. To detect strnd clevge, we looked for intermedites in which FLP ws covlently ttched to the hlf-site. Unmodified hlf-site (1 p of core), hlf-site with 2 or 3 p of core, nd hlf-site were ech incuted with fixed concentrtion of enzyme; the rection ws terminted t vrious times with SDS nd mercptoethnol; nd the smples were nlyzed on n SDS-polycrylmide gel (17). The results, shown in Fig. 10, indicte time-dependent increse of n intermedite in which FLP ws covlently ound to hlf-site hving core sequences with 2 p (lnes 9 to 14) nd 3 p (lnes 16 to 21) s well s to hlf-site (lnes 23 to 28). No covlent intermedite ws oserved with the unmodified hlf-site contining only 1 p of the core (lnes 2 to 7). These results suggest tht the enzyme requires hlf-site with t lest 2 p of core to ctlyze strnd clevge. These results re comptile with the possiility tht strnd clevge is prerequisite for the formtion of stle dimers, ut it is eqully likely tht protein-protein interctions medite the dimeriztion nd tht clevge nd covlent ttchment follow. In fct, studies with mutnt FLP protein tht is

9 VOL. 1 l, 1991 A (l) (2) (3) (4) (5) - N, pn v U)' co 0^- Q " r- N o 0 I" *11 so! 0 *9 V%, FLP RECOMBINASE 4505 M _ T D C I =- 258 _ 207 v _r _~Ci C1 S M le i B (3) o(4) 8(5) (6) e(7) _ IV r- c E Ln - %0 r- O Cl TT TR Ci S FIG. 9. (A) Dimer formtion with hlf-site sustrtes. 32P-endleled sustrtes of hlf-site were incuted with FLP protein t room temperture for 20 min. Rection mixtures were then sujected to electrophoresis on polycrylmide gel. Lnes: 1 to 4, hlf-site with 1 p of core incuted with 0, 7.5, 15, nd 30 U of FLP, respectively; 5 to 8, 9 to 12, 13 to 16, nd 17 to 20, sustrtes of hlf-site with 2, 3, 4, nd 5 p of core, respectively, processed s indicted ove. S, sustrte; CI, complex I; D, dimer; T, trimer. (B) Dimer formtion with hlf-site sustrtes. Sustrtes of hlf-site contining core of 3 p (lnes 1 to 4), 4 p (lnes 5 to 8), 5 p (lnes 9 to 12), 6 p (lnes 13 to 16), or 7 p (lnes 17 to 20) were incuted with protein nd sujected to electrophoresis s indicted ove. Lnes: 1, 5, 9, 13, nd 17, no FLP; 2, 6, 10, 14, nd 18, 7.5 U of FLP; 3, 7, 11, 15, nd 19, 15 U of FLP; 4, 8, 12, 16, nd 20, 30 U of FLP. S, sustrte; CI, complex I; D, dimer; TR, trimer; TT, tetrmer. cple of clevge ut deficient in its ility to form stle dimers led us to fvor the second hypothesis (ll). FLP cn promote stle dimer formtion etween clevge-incompetent nd clevge-competent hlf-site. We showed ove tht the FLP protein could not promote stle dimer formtion with the hlf-site with the 1 p of core nd could not promote strnd clevge of this site. We therefore wished to determine whether the FLP protein could medite stle dimer formtion etween nonclevle hlf-site nd clevle hlf-site. Since the frgment contining hlf-site is 56 p longer thn tht contining hlf-site, the heterodimer product of these two frgments will migrte more quickly thn the homodimer product formed with hlf-site. The complexes were resolved on ntive polycrylmide gel. As shown in Fig. 11A, sustntil mount of the heterodimer product ws formed (lnes 11 nd 12). C1 FIG. 10. Covlent ttchment of FLP to hlf-sites. The 32P-endleled hlf-site sustrtes were incuted with FLP, nd liquots were removed t vrious times nd dded to denturing uffer (see Mterils nd Methods). The smples were incuted t 37 C for 20 min nd then sujected to electrophoresis on 7.5% polycrylmide-sds gel. Lnes: 1 to 7, hlf-site with 1 p of core; 8 to 14, hlf-site with 2 p of core; 15 to 21, hlf-site with 3 p of core; 22 to 28, hlf-site with 3 p of core. Time points were 0 min (lnes 1, 8, 15, nd 22), 2 min (lnes 2, 9, 16, nd 23), 4 min (lnes 3, 10, 17, nd 24), 6 min (lnes 4, 11, 18, nd 25), 8 min (lnes 5, 12, 19, nd 26), 10 min (lnes 6, 13, 20, nd 27), nd 20 min (lnes 7, 14, 21, nd 28) fter FLP ws dded. S, sustrte; CI, intermedite of FLP covlently ound to hlf-site ; CI, intermedite of FLP covlently ound to hlf-site ; M, 32P-Su3A-cut pbr322 mrkers. Numers indicte lengths of frgments (in se pirs). The heterodimer nd smll mounts of the presumed heterotrimer species re lso seen. The heterodimer migrted fster thn the homodimer product of hlf-site (lnes 2 nd 3) nd more slowly thn the homodimer product of hlf-site with the 3 p of core (lnes 8 nd 9). The heterodimer product nd the homodimer products were lso detected in rections contining oth hlf-site with 3 p of core nd hlf-site (lnes 14 nd 15). (No homodimer product of hlf-site with 1 p of core is formed [Fig. 11A, lnes 5 nd 6].) This experiment suggests tht only one of the two hlf-sites must e cleved y the protein to result in the formtion of stle dimer. It ws possile tht the hlf-site held in the heterodimer in stle ssocition with the hlf-site might undergo FLP-induced clevge. To exmine this possiility, we nlyzed the products of rection such s tht whose results re shown in Fig. 11A y SDS-polycrylmide gel electrophoresis to detect FLP covlently ttched to either the or the hlf-site. Incution of the hlf-site with FLP resulted in detection of the expected covlent ttchment of FLP to the hlf-site (Fig. lib, lne 4), wheres no such ttchment ws detected with the hlf-site contining 1 p

10 4506 AMIN ET AL. A (3) ) (3) N StuLC) r odc - N J ) v LU)D r- 0 B (1) (2) MOL. CELL. BIOL. - HTT - HMD -thtde _ HMD _C Ie _C l %w _. wkw4 -FLP t o--flp - Se - S _w FIG. 11. (A) Mixed dimer formtion etween hlf-sites nd. Hlf-site sustrtes were incuted with FLP protein t room temperture for 20 min nd sujected to electrophoresis on polycrylmide gel. Lnes: 1 to 3, hlf-site (3 p of core); 4 to 6, hlf-site (1 p of core); 7 to 9, hlf-site (3 p of core); 10 to 12, hlf-sites nd (1 p of core); 13 to 15, hlf-sites nd (3 p of core); 16 to 18, hlf-sites (1 nd 3 p of cores); 1, 4, q, 10, 13, nd 16, no FLP; 2, 5, 8, 11, 14, nd 17, 15 U of FLP; 3, 6, 9, 12, 15, nd 18, 30 U of FLP. S, hlf-site sustrte; S, hlf-site sustrte; CI, complex I of hlf-site ; CI, complex I of hlf-site ; HMD, homodimer of hlf-site ; HMD, homodimer of hlf-site with 3 p of core; HTD, heterodimer of hlf-sites nd ; HTT, heterotrimers of hlf-sites nd. The legend ove the figure indictes the presence (+) or sence (-) of hlf-site with 3 p of core [(3)] nd hlf-site with either 1 p [(1)] or 3 p [(3)] of core. (B) Clevge nd covlent ttchment during mixed dimer formtion. Rections were crried out s for pnel A, nd rection mixtures were nlyzed for covlent ttchment of FLP to the leled hlf-site s descried in the legend to Fig. 10. Lnes: 1, hlf-site; 2, hlf-site (1 p of core) lone; 3, hlf-site (2 p of core); 4, hlf-site with FLP; 5, hlf-site (1 p of core) with FLP; 6, hlf-site (2 p of core) with FLP; 7, hlf-site nd hlf-site (1 p of core) with FLP; 8, hlf-site nd hlf-site (2 p of core) with FLP. Where indicted, 0.5 U of FLP ws used., hlf-site;, hlf-site; -FLP, FLP covlently ttched to hlf-site; -FLP, FLP covlently ttched to hlf-site. of core (Fig. lib, lne 5). When oth the nd hlf sites were incuted with FLP, we detected FLP covlently ttched to the hlf-site ut no covlent intermedite etween FLP nd the hlf-site (lne 7). Control experiments using the hlf-site with the 2-p core showed the expected FLP- hlf-site covlent intermedite (lnes 6 nd 8). Thus, one hlf-site cn exist in stle dimer without eing cleved y FLP. DISCUSSION Requirements for synpsis. Our results suggest tht the minimum functionl FRT site tht llows efficient formtion of synptic complex contins elements nd nd the core. These results re consistent with our previous oservtion tht only elements nd of ech of the two wild-type FRT sites in synptic complex were occupied y FLP (1). We propose tht elements nd re first occupied y FLP protein. Protein-protein interctions with nother such complex result in synpsis of the two FRT sites. Thus, there is no definle role for element c in the synptic rection in vitro (24), lthough we cnnot rule out possile function in vivo (6, 14). Role of core homology in recomintion y hlf-frt sites. Stle recominnt structures form only when there re t lest 2 p of core homology etween the hlf-site nd the full FRT site. The hlf-sites recomine only t the homologous symmetry element-core junction of the FRT site. No recominnt structures were oserved tht resulted from strnd exchnge etween hlf-site nd the element -core junction or etween hlf-site nd the element -core junction. Therefore, it ppers tht 1 p of homology is not sufficient to stilize the recominnt structure, perhps ecuse the rection is redily reversile. In exchnges etween hlf-site nd the -core junction or etween hlf-site nd the -core junction, there is short stretch of homology etween the single-strnded til of the hlf-site (the XI end) nd the core of the intct FRT site. Three-strnded-rnch migrtion through this homology my prevent reversl of strnd exchnge, thus llowing the ccumultion of recominnt structures. The effect of core homology ws corroorted in recomintion rection using the reverse-core FRT site. We suggest the following pthwy for synpsis nd strnd exchnge. FLP molecules ind to elements nd of the FRT site to form ent DNA complex which forms synptic intermedite through protein-protein interctions with similr complex. FLP ctlyzes strnd clevge t one of the two clevge junctions in ech of the two FRT sites. This is fcilitted y protein-protein interction cross the core. Strnd clevge then triggers n symmetric conformtionl chnge in the intermedite tht llows formtion of Hollidy junction vi pir of reciprocl strnd exchnges (1, 15, 21). Suunit rottion drives rnch migrtion through the core (28) to moilize the junction to the opposite side of the core, where clevge nd nother pir of strnd exchnges occur. Unlike the A Int protein or the P1 Cre

11 VOL. 1l, 1991 B A + //*.. _- 7/,- w 0 + FLP -_ -.f/- { FLP FIG. 12. Possile structures of recominnt intermedites formed y rection of hlf-site (htched lines) with whole FRT site (solid lines). (A) Three-rmed Y structure (Fig. 5A, mp i) undergoes second round of recomintion with the full site vi exchnge of ottom strnds. The result is five-rmed structure. Further rounds of recomintion re possile. Such structures could form XP1. (B) Y structure undergoes FLP-induced nicking nd covlent ttchment of its top (solid) strnd resulting in recominnt molecule with short gp in the top strnd with FLP covlently ttched t the 3' side of the gp. A 5'-OH-terminted hlf molecule with covlently ttched FLP is lso lierted. This is the likely structure of XP3. Ovls represent covlently ound FLP molecules. protein, FLP pprently shows little preference for which strnd exchnge occurs first (13, 15, 16, 21, 22). Likewise, there is nothing to prevent mislignment of the site during synpsis (1). Hence, should n errnt strnd exchnge e ttempted (e.g., etween nick next to element on one prtner ut next to element on the other), then rnch migrtion through the core will e impeded y heterology (3) nd the exchnge will e quickly reversed. We ssume tht this will led to disssemly of the nonproductive synptic complex. Thus, core homology plys key role in preventing errnt recomintion events. Occsionl filure of this homology filter or muttions within the homologous cores will led to rre nomlous rerrngements (19) or to the evolution of ltered FRT sites nd ltered FLP proteins tht cn interct with them (20). Structure of recominnt intermedites. We hve chrcterized the single-strnd-exchnge products of the recominnt intermedites XP1, XP2, nd XP3 nd found tht ech product contins either the 323-nt or the 232-nt strnd, depending on whether the or hlf-site ws used. The mjor product, XP1, lso contins nick in the recipient ottom (with site) or top (with site) strnd. Although we hve digrmmed simple Y structure (Fig. 5A), in fct this structure my e cple of undergoing further rounds of recomintion with n intct FRT site contined in the PvuII frgment. An exmple of such five-rmed product is shown in Fig. 12A. Such structure would e indistinguishle from the simple Y structures shown in Fig. 5A when nlyzed y ure denturing crylmide gels. In fct, when the XP1 products re isolted y electroelution nd rerun on FLP RECOMBINASE 4507 higher-percentge gel thn ws used to isolte them, they cn e resolved into three nds (dt not shown), suggesting tht XP1 (nd perhps XP2) my contin heterogeneous recominnt products tht rise vi multiple rounds of FLP-induced recomintion. In fct, it is possile tht the minor product XP2 is simple Y structure nd tht XP1 is mixture of more complex structures. The XP3 products could rise from the ction of FLP on simple Y structure (Fig. 12B). A second FLP molecule might cut nd covlently ttch to the strnd opposite the nicked strnd, llowing the right ottom rm of the Y structure to e lierted. The result would e liner structure with short gp. The recominnt strnd would e identicl to tht found in the Y structure. However, the fct tht the products clled XP3 migrted ner the expected position for liner molecule of either 320 or 226 p is consistent with this ide. Requirements for multimer formtion with hlf-frt sites. At lest 2 p of the djoining core sequence re required for strnd scission nd strnd exchnge y hlf-site. A hlf-site with only 1 p of the core cnnot e cleved y the FLP protein, nd the enzyme is thus unle to ctlyze strnd trnsfer rection etween this hlf-site nd the intct FRT site. We postulte tht the FLP protein intercts with these 2 p in such wy s to position the scissile phosphodiester ond ner ctlytic residues of the ctive site. Consistent with our proposl is the oservtion y Bruckner nd Cox tht the protein estlishes phosphte contct t the T residues 3' to the onds cleved y the enzyme (7). Although no contcts with the second se distl to the clevge site were oserved, it is possile tht the protein cn contct this residue (C or T) in wys not detectle y current chemicl footprinting techniques. It is lso interesting tht the djoining core of the hlf-site hs n optiml size of 3 to 4 p for efficient strnd clevge nd strnd exchnge. This led us to exmine the reltionship etween FLP-medited clevge nd FLP-medited dimer formtion with the hlf-sites. Qin et l. (25) hve provided strong evidence tht FLP molecules ind to hlf-sites nd promote stle dimer formtion etween the sites, provided the core spcing etween sites does not exceed 10 p. They suggested tht the dimer is mintined y protein-protein interctions cross the core region of the two hlf-sites. We demonstrte here tht the FLP protein is unle to ctlyze strnd clevge of the hlf-site with 1 p of core nd is lso unle to promote stle dimer formtion with this sme site. However, the enzyme will promote stle dimer formtion etween clevle hlf-sites contining 2 p of the djoining core. Thus, t lest 2 p of core sequence re required for strnd clevge nd dimer formtion. This effect is clerly different from the core spcing effect descried ove. However, we found tht the nonclevle hlf-sites with 5 p of core sequence showed drstic reduction in dimer formtion. FLP will promote heterodimer formtion etween nonclevle hlf-site nd clevge-competent hlf-site, suggesting tht only one of the two strnds needs to e cleved in the formtion of dimer. Our result is thus consistent with tht of Qin et l. (25), who demonstrted tht 50% of the scissile onds in dimer were cleved y the protein nd tht the strnd clevge ctivity of the protein ws importnt for the formtion of dimers. Together, these results suggest tht protein-protein interctions cross the core ccompny single clevge event during which FLP ttches covlently to the FRT site. This cuses conformtionl chnge of the protein which stilizes the dimer through stronger cross-core interctions to form the symmetric structure

12 4508 AMIN ET AL. descried y Qin et l. (25). We elieve tht it is this symmetric complex tht synpses with the intct FRT site. This leds to single-strnd exchnge to form the recominnt structures. ACKNOWLEDGMENTS This work ws supported y the Medicl Reserch Council of Cnd. We thnk Lind G. Betty for constructing the synptic sustrtes nd Crol Schwrtz for her gift of the reverse-core sustrte. We re grteful to the memers of the Sdowski lortory for their criticl reding of the mnuscript nd to Fried Chn for typing it. REFERENCES 1. Amin, A. A., L. G. Betty, nd P. D. Sdowski Synptic intermedites promoted y the FLP recominse. J. Mol. Biol. 214: Andrews, B. J., L. G. Betty, nd P. D. Sdowski Isoltion of intermedites in the inding of the FLP recominse of the yest plsmid 2 micron circle to its trget sequence. J. Mol. Biol. 193: Andrews, B. J., M. McLeod, J. Broch, nd P. D. Sdowski Interction of the FLP recominse of the Scchromyces cerevisie 2,um plsmid with mutted trget sequences. Mol. Cell. Biol. 7: Andrews, B. J., G. A. Proteu, L. G. Betty, nd P. D. Sdowski The FLP recominse of the 2p, circle DNA of yest: interction with its trget sequences. Cell 40: Betty, L. G., nd P. D. Sdowski The mechnism of loding of the FLP recominse onto its trget sequence. J. Mol. Biol. 204: Broch, J. R., V. R. Gurscio, nd M. Jyrm Recomintion within the yest 2 micron circle is site-specific. Cell 29: Bruckner, R. C., nd M. M. Cox Specific contcts etween the FLP protein of the yest 2 micron plsmid nd its recomintion site. J. Biol. Chem. 261: Cox, M. M DNA inversion in the 2p.m plsmid of Scchromyces cerevisie, p In D. E. Berg nd M. M. Howe (ed.), Moile DNA. Americn Society for Microiology, Wshington, D.C. 9. Crig, N. L The mechnism of conservtive site-specific recomintion. Annu. Rev. Genet. 22: Droge, P., nd N. R. Cozzrelli Recomintion of knotted sustrtes y Tn3 resolvse. Proc. Ntl. Acd. Sci. USA 86: Droge, P., G. F. Htfuli, N. D. F. Grindley, nd N. R. Cozzrelli The two functionl domins of y resolvse ct on the sme recomintion site: implictions of the mechnism of strnd exchnge. Proc. Ntl. Acd. Sci. USA 87: Friesen, H., nd P. Sdowski. Unpulished dt. 12. Gronostjski, R. M., nd P. D. Sdowski The FLP recominse of the Scchromyces cerevisie 2,u plsmid ttches covlently to DNA vi phosphotyrosyl linkge. Mol. Cell. Biol. 5: Hoess, R., A. Wierzicki, nd K. Aremski Isoltion nd MOL. CELL. BIOL. chrcteriztion of intermedites in site-specific recomintion. Proc. Ntl. Acd. Sci. USA 84: Jyrm, M Two-micrometer circle site-specific recomintion: the miniml sustrte nd possile role of flnking sequences. Proc. Ntl. Acd. Sci. USA 82: Jyrm, M., K. L. Crin, R. L. Prsons, nd R. M. Hrshey Hollidy junctions in FLP recomintion: resolution y step-rrest mutnts of FLP protein. Proc. Ntl. Acd. Sci. USA 85: Kitts, P. A., nd H. A. Nsh Homology-dependent interctions in phge A site-specific recomintion. Nture (London) 329: Lemmli, U. K Clevge of structurl proteins during the ssemly of the hed of cteriophge T4. Nture (London) 227: Lndy, A Dynmic, structurl nd regultory spects of A site-specific recomintion. Annu. Rev. Biochem. 58: Leong, J. M., S. E. Nunes-Duy, nd A. Lndy Genertion of single se-pir deletions, insertions nd sustitutions y site-specific recomintion system. Proc. Ntl. Acd. Sci. USA 82: Luetke, K. Unpulished dt. 20. Murry, J. H., G. Cesreni, nd P. Argos Unexpected divergence nd moleculr coevolution in yest plsmids. J. Mol. Biol. 200: Myer-Leon, L., R. B. Inmn, nd M. M. Cox Chrcteriztion of Hollidy structures in FLP protein-promoted sitespecific recomintion. Mol. Cell. Biol. 10: Nunes-Duy, S. E., L. Mtsumoto, nd A. Lndy Sitespecific recomintion intermedites trpped with suicide sustrtes. Cell 50: Nunes-Duy, S. E., L. Mtsumoto, nd A. Lndy Hlf-tt site sustrtes revel the homology independence nd miniml protein requirements for productive synpsis in k excisive recomintion. Cell 59: Pn, H., D. Clry, nd P. D. Sdowski Identifiction of the DNA-inding domin of the FLP recominse. J. Biol. Chem. 266: Proteu, G., D. Sidenerg, nd P. D. Sdowski The miniml duplex DNA sequence required for site-specific recomintion promoted y the FLP protein of yest in vitro. Nucleic Acids Res. 14: Qin, X.-H., R. B. Inmn, nd M. M. Cox Protein-sed symmetry nd protein-protein interctions in FLP recominse medited site-specific recomintion. J. Biol. Chem. 265: Sdowski, P Site-specific recominses: chnging prtners nd doing the twist. J. Bcteriol. 165: Schwrtz, C. J. E., nd P. D. Sdowski FLP recominse of the 2 p.m circle plsmid of Scchromyces cerevisie ends its DNA trget. Isoltion of FLP mutnts defective in DNA ending. J. Mol. Biol. 205: Schwrtz, C. J. E., nd P. D. Sdowski The FLP protein of the 2-micron circle plsmid of yest induces multiple ends in the FLP recognition trget site. J. Mol. Biol. 216: Vetter, D., B. J. Andrews, L. Roerts Betty, nd P. D. Sdowski Site-specific recomintion of yest 2 micron DNA in vitro. Proc. Ntl. Acd. Sci. USA 80: