Relative Virulence of Botrytis cinerea and B. mali in Apple Lesions

Transcription

1 2010 Plant Management Network. Accepted for publication 2 July Published. Relative Virulence of Botrytis cinerea and B. mali in Apple Lesions Reza H. Etebarian, Abourayhan Campus, University of Tehran, P.O. Box 11365/4117, Tehran, Iran; Daniel T. O Gorman and Peter L. Sholberg, Pacific Agri-Food Research Centre, Agriculture and Agri-Food Canada, Summerland, BC V0H 1Z0, Canada Corresponding author: Peter L. Sholberg. Peter.Sholberg@agr.gc.ca Etebarian, R. H., O Gorman, D. T., and Sholberg, P. L Relative virulence of Botrytis cinerea and B. mali in apple lesions. Online. Plant Health Progress doi: /php rs. Abstract Botrytis cinerea and recently B. mali have been identified as important postharvest pathogens of apples in British Columbia (BC), Canada. Three isolates of both B. cinerea and B. mali were studied alone and in combination by inoculating mature Gala apple fruit to compare their potential for causing decay. The fruit were incubated at 20 C for 6 and 8 days when lesion areas were calculated from lesion diameters. The lesion areas in apples inoculated with B. cinerea ranged from 1020 to 1514 mm² compared to 130 to 293 mm² for B. mali after 6 days. Primers developed to specifically amplify B. mali or B. cinerea were used in a PCR test to determine which Botrytis spp. was present in a particular lesion and estimate the quantity of each species. Relative fluorescent intensity of DNA extracted from apple tissue co-inoculated with B. cinerea + B. mali and amplified with the B. cinerea specific primer averaged 102.3%. On the other hand, the fluorescence produced by the B. mali primer averaged only 11.6% from the same DNA samples. These results confirmed that when both B. cinerea and B. mali are mixed together, B. cinerea becomes the dominant pathogen. Introduction Postharvest losses in apple caused by fungi have been reported to be as high as 21% in England and 22.6% in France although generally losses are much lower in refrigerated storage facilities (12). Of the major causes of postharvest decay in apples, gray mold rot is second only to blue mold rot in causing postharvest decay during storage and marketing (16). Lennox and Spotts (7) found that for winter pears placed into storage, gray mold decay was the result of stem infections at harvest and possibly conidia surviving in the calyxes late in the season. Apples are likely infected similarly by B. cinerea when placed into controlled atmosphere storage at 1 to 2 C and can be completely decayed in 4 to 5 months. Gray mold is usually thought to be caused by B. cinerea but in the state of Washington, it was also reported to be caused by B. mali Ruehle (17). Botrytis mali was first reported as a new species in 1931 and has recently been revived by O Gorman et al. (14,15). They found that after testing 28 Botrytis spp. isolates consisting of 10 different species including two B. mali herbarium specimens from 1932, that B. mali was an unique species based on DNA sequence analysis. Because of the economic impact of gray mold of apple in British Columbia where it is a major disease on stored apples, identification and virulence of the pathogen are major concerns (18). New techniques are needed for identification of closely related fungal species and for evaluation of virulence in mixed populations of pathogens. The polymerase chain reaction (PCR) technique which has grown exponentially since its development in 1985 could be the answer to these important questions (1). For example, any nucleic acid sequence can be cloned, analyzed or modified, and even rare sequences can be detected by PCR (4,22). The technology offers plant pathologists many advantages compared to traditional methods of diagnosis: organisms need not be cultured prior to detection by PCR; it is

2 extremely sensitive; and it is rapid and versatile (5). Adaptation of standard PCR protocols have also been used to estimate the proportion of one species relative to another in the same sample as reported by Burke et al. (2), who used relative fluorescent intensity of amplified ribosomal DNA to determine the relative abundance of ectomycorrhizal species. Nahimana and colleagues (11) used a similar approach using fluorescent intensities of PCR single-strand conformation polymorphisms to estimate the relative abundance of each special forms of Pneumocystis carinii. Thus in this study a species-specific PCR test is used to distinguish B. cinerea from B. mali and estimate the relative proportion of each species in the lesion where the two were mixed during the initial inoculation. This would indicate which species dominated and would also show their likely importance in causing the decay. Direct measurement of lesion size is the traditional method of measuring virulence by a postharvest pathogen (23). Kerssies et al. (6) studied pathogenicity among different B. cinerea isolates on gerbera and rose flowers by measuring lesion size as an indication of virulence. In this study a similar method was used to determine which of two closely related species of Botrytis, B. cinerea or B. mali, are most virulent on apple by measuring lesion size caused by either species alone or when mixed together. The PCR technique discussed above was also used to clearly show whether one species or the other was present and to indicate in what quantity the species was present. Criteria for identification of B. cinerea and B. mali. Characterization of the isolates used in this study was based on both colony morphology (17) and DNA sequence analysis of the β-tubulin gene (15). Three isolates of Botrytis cinerea Pers:Fr [teleomorph Botryotinia fuckeliana (de Bary) Whetzel] isolates Bc-116 and Bc-27 from Braeburn apple (Kelowna and Summerland, BC), and isolate Bc1710 from strawberry (Summerland, BC) and three isolates of B. mali Ruelhe isolate Bm-153 from Spartan apple (Westbank, BC), isolate Bm-127 from Gala apple (Summerland, BC) and isolate Bm-26 from Braeburn apple (Oliver, BC) were used. The following accession numbers from Genbank were given to these isolates: EF216707, EF216712, and EF for B. cinerea; and EF393988, EF216692, and EF for B. mali. All cultures were derived from single spore isolates and maintained on potato dextrose agar (PDA) at 2 C in darkness until needed. Pathogenicity of B. cinerea and B. mali on apple fruit Gala apples that had been harvested at commercial maturity and kept at 1 ± 0.5 C in cold storage were used to evaluate the pathogenicity of the six different isolates and their combinations. The apples were warmed to room temperature (20 C) for 24 h, washed in 70% ethanol for 30 sec, followed by dipping in 0.1% sodium hypochlorite solution, and rinsed with sterile distilled water three times. The fruit were wounded in triplicate with a 2.5 mm diameter nail to a depth of 3 mm. Botrytis spp. isolates were grown on PDA plates (90 cm diameter) for 10 to 30 days. Conidia were harvested by pouring a few milliliters of sterile distilled water (SDW) containing 0.05% Tween 20 on the plate. The conidial suspension for each isolate and for each combination of isolates was adjusted to ³ conidia/ml by counting the number of conidia with the aid of a hemacytometer. A 20 µl aliquot of SDW, conidial suspension of a particular isolate, or equal volumes of paired combinations of isolates were applied to each wound (Table 1). The treated apples were placed on cardboard trays that were enclosed in plastic bags. The inside of the bags were sprayed with SDW to maintain high relative humidity in the bags. The apples were incubated at 20 C for 8 days. Each apple constituted a single replicate and each treatment was replicated four times. Lesion diameters were measured 6 and 8 days after inoculation. The lesion diameter was the average of two caliper measurements (Mitutoyo Canada Inc., Toronto, ON) and the lesion area was calculated from these measurements (πr²).

3 Table 1. Lesion area (mm²) produced by isolates of B. cinerea (Bc) or B. mali (Bm) or their combinations on wounded Gala apples. Isolates used for inoculations x Bc27 Bc1710 Bc27 + Bc1710 Bm26 +Bc1710 Bc27 + Bm153 Bc Bm153 Bc116 + Bc1710 Bc27 + Bc116 Bc116 Bc27 + Bm127 Lesion area after 6 days (mm²) 1514 a y 1265 ab 1125 bc 1111 bc 1090 bc 1066 bc 1028 bc 1025 bc 1020 bc 1009 bc Bc27 +Bm bc Bm127 + Bc cd Bc116 + Bm cde Bc116 + Bm def Bc116 + Bm efg Bm127 + Bm fgh Bm26 + Bm ghk Bm ghk Bm hk Bm127 + Bm hk Bm k x Mature Gala apples were wounded in triplicate with a 2.5 mm diameter nail to a depth of 3 mm. A 20 µl aliquot of isolate suspension or equal combination of isolate suspension (4.0 10³ conidia/ml) was used to inoculate each wound. Four replicate apples per treatment. y Means within columns followed by the same letter are not significantly different according to the Duncan s Multiple Range Test (P < 0.05). DNA extraction of Botryits spp. from apple tissue. Seven days after inoculation, three core samples from each apple (one core per wound) 8 mm in diameter by 5 mm deep was aseptically removed from the edge of a wound using a cork borer and placed in 2 ml screw-cap tubes with extraction buffer and frozen until needed. Total DNA was extracted directly from inoculated apple tissue using the Fast DNA Kit (Bio 101 Inc., Vista, Calif) and 60 sec of maceration using Fast Prep Machine (Thermo Electron Corp. Milford, MA). DNA was eluted in 100 µl volumes. PCR amplification of Botryits spp. DNA. Amplification of the DNA from the sample was performed using the polymerase chain reaction (PCR) with primers selected from the β-tubulin gene. A forward primer, Bt-2M-UP (3) targeting a conserved sequence, was paired with Bcin-bt-366r (TGAGTCAACTCTGGAACG) (21), the reverse primer specific for B. cinerea isolates (Bc-27, Bc-116, and Bc1710) or alternatively with Bmal-bt-294r (CCATGAAGAAATGGAGACGA), a primer designed from Genbank sequences (EF and EF216690) and specific for the B. mali isolates (Bm-127, Bm-26, and Bm-153) (19). Primer efficiency was tested individually for each primer

4 pair, by measuring the concentration of amplification products derived from a dilution series of DNA from both species. Efficiencies were found to be roughly equivalent (± 8.7%) (data not shown). Amplifications of inoculated apple tissue were replicated twice, in 20 μl reactions containing 13.4 μl of SDW, 2 μl 10X buffer, 1.6 μl MgCl 2 (20mM), 200 μm dntpmix, 0.4 μm BT2MUP, 0.4 μm Bcin-bt-366, or 0.4 μm Bstok294, 1 Unit of UltraTherm DNA polymerase and 1 μl of sample DNA. PCR amplification was carried out on a MyCycler Thermal Cycler [Bio-Rad Laboratories (Canada) Ltd., Mississauga, ON] with the following conditions: 95 C for 2 min followed by 40 cycles of 95 C for 30 s, 64 C for 30 s, and 72 C for 1 min, and a final extension cycle of 72 C for 7 min. Amplified products were electrophoresed on 2.5 % agarose gel containing 0.5 µg/ml ethidium bromide with 0.5X TBE running buffer. A 100 Bp ladder (Invitrogen, Gaithersburg, MD) was included on each gel to indicate molecular size. The relative fluorescent intensity of the bands was measured using ImageJ 1.30v. software (National Institute of Health, Bethesda, MD) and percentage of relative fluorescent intensity (RFU) of each band was calculated using the formula n = a / b 100 where n = percentage of relative flourescent intensity, a = RFU in the sample band, and b = RFU in the control. The controls were the RFU values of the PCR products produced by the B. cinerea primers in apple inoculated with Bc27, Bc1710, or Bc116. In the case of B. mali from apple the controls were Bm26, Bm153, and Bm127. Statistical analysis. The completely randomized design was used for these experiments. Analysis of variance was performed on the data and means were separated using Duncan s Multiple Range Test with P < 0.05 (8). Results of Botryits spp. in Producing Apple Lesions Individually the three B. cinerea isolates, Bc27, Bc1710, or Bc116, all produced larger lesions than any of the individual B. mali isolates, Bm26, Bm153, or Bm127, after incubation for six days (Table 1). If a combination of two isolates contained only B. cinerea or only one B. mali isolate it had larger lesions than B. mali alone or in combination with another B. mali. Although all the lesions increased in size from 6 to 8 days, the results after 8 days were the same with B. cinerea lesions larger than B. mali lesions. Results of PCR Analysis of Botryits spp. from Apple Lesions The relative fluorescent intensity produced with B. cinerea-specific primers on DNA extracted from combinations of B. cinerea + B. mali inoculated apple tissue ranged from 88.5 to 114.0% with a mean of 102.3% (Table 2). When the same DNA was amplified with B. mali-specific primers, the relative fluorescent intensity ranged from 0 to 30.5% with a mean of 11.6%. Relative fluorescence of control samples inoculated with either B. cinerea or B. mali alone, were used to normalize the data and received values of 100%. Amplification of DNA from coinoculated samples (B. cineria + B. mali) consistently produced much stronger B. cinerea specific bands in comparison to those produced for B. mali DNA (Fig. 1). However, in samples inoculated with B. mali alone, the band intensity was similar to that seen for B. cineria amplification.

5 Table 2. Percent relative fluorescent intensity (RFU) in amplified PCR product from DNA extracted from different combinations of B. cinerea (Bc) and B. mali (Bm). Isolates used for inoculation x % RFU with B. cinerea primer % RFU with B. mali primer Bc Bm d y 11.1 a Bc116 + Bm cd 13.2 a Bc Bm d 0.0 a Bc Bm d 6.5 a Bc27 + Bm abc 1.7 a Bc27 + Bm ab 12.2 a Bc116 + Bm ab 30.5 a Bc27 + Bm ab 7.4 a Bc116 + Bm a 21.8 a Controls: Bc27, Bc1710, & Bc Controls: Bm26, Bm153, & Bm x Cores of infected apple tissue 8 mm in diameter by 5 mm deep were removed from each apple and transferred to DNA extraction tubes. Four replicate apples per treatment were used. y Means within this column followed by the same letter are not significantly different according to Duncan s Multiple Range test (P < 0.05).

6 Fig. 1. PCR amplification of single or mixed populations of B. cinerea and B. mali isolates from DNA extracted from Gala apple fruit tissue using species-specific primers. Top row of lanes shows B. cinerea specific amplification. Lanes from left to right. 1 = 100-bp DNA ladder. 2 = negative control, 3 = Bc116 + Bm26, 4 = Bc27 + Bm26, 5 = Bc116 + Bm153, 6 = Bc27 + Bm127, 7 = Bc27 + Bm153, 8 = Bc Bm153, 9 = Bc Bm127, 10 = Bc116 + Bm127, 11 = Bm26 + Bc1710, 12 = B. cinerea isolate Bc27, 13 = B. cinerea isolate Bc116, 14 = B. cinerea isolate Bc1710. Bottom row of lanes shows B. mali specific amplification. Lanes from left to right. 1 to 11 samples are the same as for top row; 12 = B. mali isolate, 13 = B. mali isolate Bm127, 14 = B. mali isolate Bm153. Discussion of Method Measurements of lesion development and species-specific detection using PCR were successfully utilized to asses the virulence of the two Botrytis spp. in this study, B. cinerea and B. mali. Both species could be detected by amplification of DNA extracted from lesions that had been inoculated with both pathogens. In addition, we used an approach taken in other studies for measuring fluorescent values of PCR products to estimate the relative proportion of each species in the co-inoculated samples (2,11). In terms of simplicity and overall cost, the PCR assay designed and used in this study was shown to be a viable option to alternative methods such as Q-PCR, cloning or dilution plating. In general our method compared well with the PCR assay used by Nielsen et al. (13) who were able to distinguish five groups: B. aclada type A1 and AII, B. byssoidea, B. squamosa, and B. cinerea. Discussion of Botryits spp. Virulence The larger lesions produced by B. cinerea isolates clearly showed that they were more virulent and likely more pathogenic than B. mali. For example, B. cinerea lesions were 5 times larger than those of B. mali after six days and four

7 times larger after eight days. In most cases there were no significant differences observed between apples inoculated with B. cinerea alone or B. cinerea + B. mali in combination. The values recorded for lesion development for inoculations with B. cinerea + B. mali, also correlated well with the PCR results. When DNA from B. cinerea + B. mali combinations was amplified with B. cinerea-specific primer, the relative fluorescent intensities of the bands were approximately 10 times stronger than those produced by the B. mali primer, indicating that B. cinerea was the dominant species colonizing the lesion. However, amplification of DNA from samples containing only B. mali produced bands of similar intensity to those produced by B. cinerea specific amplification. This would suggest that the primer efficiency was not an issue with the differences observed in specific amplification of the two species. It is likely that B. cinerea is more aggressive and can simply out compete B. mali under these conditions. Conclusion Botrytis cinerea is the dominant pathogen when these two species occur either together or separately on apple fruit. The results agree with the initial findings by Ruehle (17) who reported that the rot produced by B. mali was similar to that produced by B. cinerea but simply develops at a slower rate. Furthermore, the method used in this study enhances our ability to correctly diagnose the causal agent even when in a mixture of these two closely related organisms. Differentiation between the various Botrytis species could have important epidemiological implications that affect management control strategies (9). For example, infection by B. cinerea would require fewer infecting propagules and lead to more rapid decay (20). When monitoring spore densities or early occurrence of lesions in a packinghouse, control measures would need to be implemented more quickly if the predominant organism was B. cinerea than if it was B. mali. On the other hand the dominance of B. cinerea over B. mali is perplexing because in previous studies on apple where the isolates were identified, B. mali appeared to be relatively abundant and occurs in other areas where apples are grown such as Iran (10). This leads to questions on the role of B. mali in the apple ecosystem and the possibility that it may be surviving on a host other than apple. Further research will be needed to answer these questions. Acknowledgments We would like to thank Tehran University, Tehran, Iran, and Agriculture and Agri-Food Canada (AAFC) for funding of this project. Literature Cited 1. Bridge, P. D., Arora, D. K., Reddy, C. A., and Elander, R. P Applications of PCR in Mycology. P. D. Bridge, D. K. Arora, C. A. Reddy, and R. P. Elander, eds. CAB Int'l, Wallingford, Oxon, UK. 2. Burke, D. J., Martin, K. J., Rygiewicz, P. T., and Topa, M. A Relative abundance of ectomycorrhizas in a managed loblolly pine (Pinus taeda) genetics plantation as determined through terminal restriction fragment length polymorphism profiles. Can. J. Bot. 84: de Jong, S. N., Lévesque, C. A., Verkley, G. J., Abeln, E. C., Rahe, J. E., and Braun, P. G Phylogenetic relationships among Neofabraea species causing tree cankers and bull s-eye rot of apple based on DNA sequencing of ITS nuclear DNA, mitochrondrial rdna, and β-tubulin gene. Mycol. Res. 105: Edel, V Polymerase chain reaction in mycology: An overview. Pages 1-20 in: Applications of PCR in Mycology. P. D. Bridge, D. K. Arora, C. A. Reddy, and R. P. Elander, eds. CAB Int'l, Wallingford, Oxfordshire, UK. 5. Henson, J. M., and French, R The polymerase chain reaction and plant disease diagnosis. Annu.Rev. Phytopathol. 31: Kerssies, A., Bosker-van Zessen, A. I., Wagemakers, C. A. M., and van Kan, J. A. L Variation in pathogenicity and DNA polymorphism among Botrytis cinerea isolates sampled inside and outside a glasshouse. Plant Dis. 81: Lennox, C. L., and Spotts, R. A Timing of preharvest infection of pear fruit by Botrytis cinerea and the relationship to postharvest decay. Plant Dis. 88:

8 8. Little, T. M., and Hills, F. J Agricultural Experimentation: Design and Analysis. John Wiley & Sons, New York, NY. 9. Madden, L. V., Hughes, G., and van den Bosch, F The Study of Plant Disease Epidemics. American Phytopathological Society, St. Paul, MN. 10. Mikani, A., Etebarian, H. R., Sholberg, P. L., O Gorman, D. T., Stokes, S., and Alizadeh, A Biological control of apple gray mold caused by Botrytis mali with Pseudomonas fluorescens strains. Postharvest Biol. Technol. 48: Nahimana, A., Cushion, M. T., Blanc, D. S., and Hauser, P. M Rapid PCRsingle-strand conformation polymorphism method to differentiate and estimate relative abundance of Pneumocystis carinii special forms infecting rats. J. Clin. Microbiol. 39: Narayanasamy, P Postharvest Pathogens and Disease Management. John Wiley & Sons, Hoboken, NJ. 13. Nielsen, K., Yohalem, D. S. and Jensen, D. F PCR detection and RFLP differentiation of Botrytis species associated with neck rot of onion. Plant Dis. 86: O Gorman, D. T., Stokes, S., and Sholberg, P. L Identification of Botrytis mali within the Botrytis population causing fruit decay on apple in the orchards of British Columbia. Can. J. Plant Path. 27: O Gorman, D. T., Sholberg, P. L., Stokes, S. C., and Ginns, J DNA sequence analysis of herbarium specimens facilitates the revival of Botrytis mali, a postharvest pathogen of apple. Mycologia 100: Rosenberger, D. A Gray mold. Compendium of Apple and Pear Diseases. A. L. Jones and H. S. Aldwinkle, eds. American Phytopathological Society, St. Paul, MN. 17. Ruehle, G. D New apple-rot fungi from Washington. Phytopathology 21: Sholberg, P. L., and Haag, P. D Incidence of postharvest pathogens of stored apples in British Columbia. Can. J. Plant Pathol. 18: Sholberg, P., Bedford, K., and O Gorman, D Development of a molecular assay for screening post-harvest pathogens of apple and pear. Project report PH Washington Tree Fruit Res. Commission, WSU-Tree Fruit Res. & Ext. Center, Wenatchee, WA. 20. Spotts, R. A., and Cervantes, L. A Disease incidence-inoculum dose relationships for Botrytis cinerea and Penicillium expansum and decay of pear fruit using dry, airborne conidia. Plant Dis. 85: Spotts, R. A., Wallis, K. M., Serdani, M., O Gorman, D. T., and Sholberg, P. L Methodology for determining relationships between inoculum concentration of Botrytis cinerea and Penicillium expansum and stem end decay of pear fruit. Plant Dis. 92: Steffan, R. J., and Atlas, R. M Polymerase chain reaction: Application in environmental microbiology. Annu. Rev. Microbiol. 45: Tenberge, K. B Morphology and cellular organisation in Botrytis interactions with plants. Pages in: Botrytis: Biology, Pathology and Control. Y. Elad, B. Williamson, P. Tudzynski, and N. Delen, eds. Kluwer Academic Publ., Dordrecht, the Netherlands.