Inexpensive Biosensors based on Cell-Free Extracts
|
|
- Sandra Newman
- 6 years ago
- Views:
Transcription
1 Inexpensive Biosensors based on Cell-Free Extracts Pitt igem 2015 Konstantin Borisov, Robert Donahue, Garrett Green, Apurva Patil, Alexander Szul
2 Inspiration Paper-based tests are currently used sparingly: ph paper pregnancy tests glucose meters
3 Inspiration The media of paper has huge advantages: Inexpensive cost of production Simple storage and transportation Does not require use of laboratory equipment
4 The idea: Could Paper-based Sensors Detect: Diseases: HIV, Malaria, Salmonella, Cancer Pollutants: Hormones, Heavy metals, Environmental pharmaceutical pollutants
5 Inspiration Pardee et al (2014) successfully used paper-based sensors with freeze-dried cell-free lysates Expressing a significant, selective signal Detecting RNAs Dehydrated system for long term storage Pardee, K., Green, A. A., Ferrante, T., Cameron, D. E., Keyser, A. D., Yin, P., Collins, J. J. "Paper-Based Synthetic Gene Networks" Cell. 159, 4, 6 November
6 Pitt igem Target Analytes Environmental Pollutants Estrogen: Feminization of wildlife Drinking water contamination Cancer Biomarkers Matrix metalloproteinases: Biomarkers for colon, breast, prostate, and intestinal cancers Small Protein Detection Model system for future development: Anti-MUC1 antibody Vascular endothelial growth factor A
7 Human Practices Questions raised during initial project design How would we want the final product to look like? How would the signal be detected on a paper? If this product would be designed for at-home use how would we minimize the false positives, false negatives, and uninterpretable results? Similar concerns of pregnancy tests and knowledge of terminal illness
8 Investigative Methodology Analyte Detection Transcriptional activation in cell-free extract Signal Processing Signal Detection Amplification/Quenching Fluorescent proteins/ Colorigenic substrates
9 Investigative Methodology Many reporter genes available with different advantages: strong signal, readily available mrfp1 fluoresces in visible light LacZ enzymatic conversion of substrates to colored products We chose for the majority of our experiments In future studies, increasing the potential outputs could be quite beneficial
10 Synthesis of Sensor Extract Standardized cell-free extract protocol for detection systems Reduced production costs Minimized production time; extracts can be made within two days Proteins of interest can be expressed in E. coli BL21 prior to lysis
11 Creation of Sensor Extract Step 1 Step 2 Step 3 Step 4 Culture E. coli BL21 with desired proteins Lyse by sonication and dialyze contents Implement extract contents on biosensor paper Flash-freeze biosensor for long term storage
12 Analyte Detection Transcriptional activation of specific RNA Polymerases in response to the targeted analyte Amplification of signal through in vitro transcription and translation Detectable signal within an hour Cell-free extract Modified estrogen receptive T7 RNA polymerase developed by team CMU Estrogen Synthetic repressor cleaved by a specific protease Protease Recruitment of RNAP to DNA through a 3- hybrid system
13 Estrogen Sensing System Based on Carnegie Mellon s estrogen-sensitive T7 RNA Polymerase Can be applied to other analyte-response RNA polymerases Estrogen Input No Estrogen Input T7* T7* Activated T7* Activated T7* T7* X pt7 X pt7
14 Estrogen Sensing System Estrogen Input No Estrogen Input T7* T7* Activated T7* Activated T7* T7* X pt7 X pt7
15 Protease Sensing System Neither DNA binding domain is strong enough to repress the synthetic promoter by itself, but the presence of both domains in proximity causes repression Protease Input Protease No Protease Input pprot E. coli RNAP X pprot X E. coli RNAP pprot
16 Protease Sensing System Protease Input Protease No Protease Input pprot E. coli RNAP X pprot X E. coli RNAP pprot
17 Protease Sensing System
18 Three-Hybrid Versatile System Designed novel three-hybrid detection system Recruits E. coli RNAP to a synthetic promoter through a 3-hybrid contact Possibilities for contacts are limitless however they need to be strong
19 Three-Hybrid Versatile System Anti-MUC1 antibody sensor utilizes the MUC1 immunogenic epitope as bait VEGF-A sensor uses a single chain variable fragment as bait VEGF-A is dimeric with two antibodies capable of binding the protein simultaneous (Chen et al 1999) Chen, Y. et al. "Selection and Analysis of an Optimized Anti-VEGF Antibody: Crystal Structure of an Affinity-matured Fab in Complex with Antigen." J. Mol. Biol. (1999) 293,
20 Three-Hybrid Versatile System Anti-MUC1 antibody detection Antibody Input No Input Antibody TP Activation Domain Activation Domain TP TP DBD TP DBD X p3h p3h
21 Three-Hybrid Versatile System Anti-MUC1 antibody detection
22 Amplification T3 RNAP Input NoT3 RNAP Input Signal Amplification X pt3 T3 RNAP T3 RNAP pt3 X T3 RNAP X pt3 pt3
23 Investigative Methodology Optimizing Mechanisms: DNA decoy hairpins bind RNA polymerases, acting as competitive inhibitors and reducing the amount of active polymerases Quenching mechanisms minimize leaky expression
24 Results Majority of the summer was spent cloning the constructs needed for the four subprojects, as well as optimizing the process of creating sensor extracts
25 Sensor extract We created a sensor extract protocol that retains crucial proteins from original cells These extracts can express genes from plasmids in vitro on paper
26 Hairpin Quenching Results
27 Future Project Directions Pitt igem has made sensor extracts for the estrogen and protease projects, and will upload the data to their igem page after the Jamboree Estrogen sensor parts (CMU, BBa_K ) and protease sensor parts (Pitt, BBa_K BBa_K ) available in igem registry for future teams Sensor extract protocol available at 2015.igem.org/Team:Pitt/Protocols
28 Acknowledgements Dr. Jason Lohmueller, who provided the team with project support and advice, helped bring igem to Pitt for the second straight year! Dr. Alex Deiters, who provided advice at all stages of the project and contributed useful feedback and critique of data collection Dr. Hanna Salman, who generously provided lab space, and provided supplies and chemicals Dr. Sanjeev Shroff, who gathered funding from various university sources, and took care of logistics of forming a university team Dr. Cheryl Telmer from CMU s igem team and Keith Pardee from the Collins Lab at MIT, who provided DNA for our project The University of Pittsburgh departments that came together to fund the Pitt 2015 igem team
29 Thank you! Questions?
30 Three-Hybrid Versatile System VEGF-A detection VEGF-A Input No Input VEGF-A Activation Domain Activation Domain VEGF-A DBD DBD X p3h p3h
31 Proteins in Sensor Extract
32 Fluorescence (RFU) Estrogen Sensor Preliminary Results ERT7 Extract + pt7, e, 100 um Estrogen T7 Extract, No DNA T7 Extract + pt7, e, 100 nm Estrogen T7 Extract + pt7, e, 30 um Estrogen ERT7 Extract + pt7, e, 10 nm Estrogen 500 ERT7 Extract + pt7, e, 3 um Estrogen T7 Extract + pt7, e, 1 nm Estrogen T7 Extract + pt7, e, 300 nm Estrogen T7 Extract + pt7, e, 100 um Estrogen ERT7 Extract + pt7, e, 30 nm Estrogen ERT7 Extract + pt7, e, 10 um Estrogen T7 Extract + pt7, e, 3 nm Estrogen 100 T7 Extract + pt7, e, 1 um Estrogen Time (minutes) T7 Extract + pt7, e, 300 um Estrogen ERT7 Extract + pt7, e, 100 nm Estrogen ERT7 Extract + pt7, e, 30 um Estrogen
AP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationProkaryotic Transcription
Prokaryotic Transcription Contents 1 The Lactose Intolerance of Bacteria 2 The Lac Operon 3 Lac Operon Simulation 4 LacZ as a reporter gene The Lactose Intolerance of Bacteria The standard growth kinetics
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More information7.1 The lac Operon 7-1
7.1 The lac Operon The lac operon was the first operon discovered It contains 3 genes coding for E. coli proteins that permit the bacteria to use the sugar lactose Galactoside permease (lacy) which transports
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationUse of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter. Michael Brinton BIOL 230W.
Use of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter Michael Brinton BIOL 230W.001 28 October 2013 TA: Sashi Gollapudi Introduction Many human
More informationYeast Two Hybrid Assay: A Fishing Tale
KEYWORDS: yeast two hybrid, molecular interactions, galactose metabolism Special section on techniques: Yeast Two Hybrid Assay: A Fishing Tale Solmaz Sobhanifar Pathology, University of British Columbia
More informationA Discovery Laboratory Investigating Bacterial Gene Regulation
Chapter 8 A Discovery Laboratory Investigating Bacterial Gene Regulation Robert Moss Wofford College 429 N. Church Street Spartanburg, SC 29307 mosssre@wofford.edu Bob Moss is an Associate Professor of
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationREGULATION OF GENE EXPRESSION
REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationCertificate of Analysis
Certificate of Analysis pet6xhn Expression Vector Set Contents Product Information... 1 pet6xhn-n, pet6xhn-c, and pet6xhn-gfpuv Vector Information... 2 Location of Features... 4 Additional Information...
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationCell-free synthetic biology provides an experimental
pubs.acs.org/synthbio An E. coli Cell-Free Expression Toolbox: Application to Synthetic Gene Circuits and Artificial Cells Jonghyeon Shin and Vincent Noireaux* School of Physics and Astronomy, University
More informationHeterologous protein expression systems
IMBB-FORTH Heterologous protein expression systems What are they? Protein expression systems producing desired polypeptides from recombinant genes. Plasmids carry and express the desired recombinant genes
More informationGENE REGULATION IN PROKARYOTES
GENE REGULATION IN PROKARYOTES Prepared by Brenda Leady, University of Toledo Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene regulation refers to
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationChapter 10 Analytical Biotechnology and the Human Genome
Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based
More informationCell-free TX-TL systems for synthetic biology
Cell-free TX-TL systems for synthetic biology Vincent Noireaux, University of Minnesota Caltech workshop, August 2013 1 Outline: Introduction - Motivations. Cell-free TX-TL. Synthetic gene circuits and
More informationStrategies for Improving Soluble Protein Production in E. coli
Strategies for Improving Soluble Protein Production in E. coli Key Learning Objectives Overview of recombinant protein expression in E. coli Challenges in protein expression Solutions Clone quickly Reduce
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationRegulation of gene expression. (Lehninger pg )
Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationChem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary
More informationAg-goat-ination: Combating Antibiotic Resistance through Diagnostic Agglutination Assays. igem 2014 Giant Jamboree 10/31/14
Ag-goat-ination: Combating Antibiotic Resistance through Diagnostic Agglutination Assays igem 2014 Giant Jamboree 10/31/14 Our Team 1 2 Overall Project Goal Design a New Method for Disease Diagnostics
More informationCharacterization of Aptamer Binding using SensíQ SPR Platforms
Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationUSB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
More informationBIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.
BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationChemical Peptide Synthesis in the Development of Protein Therapeutics
Chemical Peptide Synthesis in the Development of Protein Therapeutics Stephen Kent Abstract Effective automated SPPS is key to the synthesis of peptide building blocks for chemical protein synthesis, and
More informationChromatin and Transcription
Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation
More informationTranscription in Prokaryotes. Jörg Bungert, PhD Phone:
Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating
More informationChapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs
Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO
More informationChapter 31. Transcription and RNA processing
Chapter 31 Transcription and RNA processing RNA polymerase (RNAP) E. coli promoters Components of E. coli RNA Polymerase Holoenzyme (α 2 ββ'ωσ) Structure of prokaryotic RNAP The closed and open state of
More informationPractice Test #3. Multiple Choice Identify the choice that best completes the statement or answers the question.
Practice Test #3 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists would be _. a.
More informationMyBioSource.com. Human VEGF ELISA Kit
Human VEGF ELISA Kit Catalog No.: MBS355343 Size: 96T Range: 31.2 pg/ml-2000 pg/ml (human serum, plasma, body fluids) 15.6 pg/ml-1000 pg/ml (cell culture supernates) Sensitivity < 1 pg/ml Storage and Expiration:
More informationEukaryotic & Prokaryotic Transcription. RNA polymerases
Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000
More informationGreen Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography
Green Fluorescent Protein (GFP) Purification Hydrophobic Interaction Chromatography What is the GFP gene? GFP is a green fluorescent protein that is normally found in jellyfish. It has been engineered
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationSystematic Evolution of Ligands by Exponential Enrichment SELEX
Systematic Evolution of Ligands by Exponential Enrichment SELEX SELEX Systematic evolution of ligands by exponential amplification * Isolation of new RNs with novel properties * New therapeutics, New diagnostics
More informationThe World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.
The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration
More informationProtein Expression PURIFICATION & ANALYSIS. be INSPIRED drive DISCOVERY stay GENUINE
Expression PURIFICATION & ANALYSIS be INSPIRED drive DISCOVERY stay GENUINE OVERVIEW Expression & Purification expression can be a very complex, multi-factorial process. Each protein requires a specific
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationTechnical tips Session 5
Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationOptimizing Synthetic DNA for Metabolic Engineering Applications. Howard Salis Penn State University
Optimizing Synthetic DNA for Metabolic Engineering Applications Howard Salis Penn State University Synthetic Biology Specify a function Build a genetic system (a DNA molecule) Genetic Pseudocode call producequorumsignal(luxi
More informationPeptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST
Peptide libraries: applications, design options and considerations Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Overview 1 2 3 4 5 Introduction Peptide library basics Peptide library design considerations
More informationProtein-protein interaction analysis
Protein-protein interaction analysis Protein-protein interactions Golemis & Adams CSHL Press, 2005 Review and research papers (referenced on slides) doc. Jan Paleček jpalecek@sci.muni.cz - Matrix/beads-based:
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationSynthetic Biology of Genetic Circuit
Synthetic Biology of Genetic Circuit 1 Mallar, K. N. and 2 Prasenjit, D. 1 M.Sc. (Agri.), Dept. of Biotechnology, AAU, Jorhat, Assam 2 M.Sc. (Agri.), Dept. of Biotechnology, UAS, Dharwad, Karnataka Correspondence
More informationTECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics
TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics INTRODUCTION The development of renewable capture reagents
More informationTECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits
In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial
More informationGenetics Lecture Notes Lectures 17 19
Genetics Lecture Notes 7.03 2005 Lectures 17 19 Lecture 17 Gene Regulation We are now going to look at ways that genetics can be used to study gene regulation. The issue is how cells adjust the expression
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationDNA Structure and Properties Basic Properties Predicting Melting Temperature. Dinesh Yadav
DNA Structure and Properties Basic Properties Predicting Melting Temperature Dinesh Yadav Nucleic Acid Structure Question: Is this RNA or DNA? Molecules of Life, pp. 15 2 Nucleic Acid Bases Molecules of
More informationTranscriptional Regulation in Eukaryotes
Transcriptional Regulation in Eukaryotes Concepts, Strategies, and Techniques Michael Carey Stephen T. Smale COLD SPRING HARBOR LABORATORY PRESS NEW YORK 2000 Cold Spring Harbor Laboratory Press, 0-87969-537-4
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationCell Growth and DNA Extraction- Technion igem HS
Growing Cells and DNA Extraction Goals 1. Become familiar with the process of growing bacteria 2. Get to know the DNA extraction process 3. Perform miniprep in the lab Keywords 1. Growth stages 6. Techniques
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationSupplemental Information. Natural RNA Polymerase Aptamers. Regulate Transcription in E. coli
Molecular Cell, Volume 67 Supplemental Information Natural RNA Polymerase Aptamers Regulate Transcription in E. coli Nadezda Sedlyarova, Philipp Rescheneder, Andrés Magán, Niko Popitsch, Natascha Rziha,
More informationThe dialkylglycine decarboxylase repressor DgdR. Functional aspects and relation to other LysR proteins
11/29/2011 1 The dialkylglycine decarboxylase repressor DgdR. Functional aspects and relation to other LysR proteins 1. Dialkylglycine amino acids 2. In vivo and in vitro studies on the DgdR repressor
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationB-cell Epitope Prediction and Cloning monoclonal ADAs
B-cell Epitope Prediction and Cloning monoclonal ADAs Stefan Ryser, CEO, Trellis Bioscience 3 rd International Symposium on Higher Order Structure of Protein Therapeutics Arlington, Virginia, February
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationCHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES
CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.
More informationAffinity Reagents: The Landscape and Affimer Technology Competitive Advantages
Affinity Reagents: The Landscape and Affimer Technology Competitive Advantages Introduction It is well accepted that the limitations of antibodies present valuable commercial opportunities for alternative
More informationIntroduction to Protein Purification
Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography
More informationGeneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit
GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit Universal kit for isolation of total DNA from gram positive bacteria and yeast. The kit contains glass beads for mechanical cell disruption. Cat.
More informationHuman Cell-Free Protein Expression Maxi System
Cat. # 3285 For Research Use Human Cell-Free Protein Expression Maxi System Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage...
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationGenetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping
Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction
More informationCHAPTER 13 LECTURE SLIDES
CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationMOLECULAR RECOGNITION
MOLECULAR RECOGNITION Bioanalytical Methods Classification 1. Biassay: molecular recognition, signal generation and detection in solution or on inert solid phase 2. Biosensor: molecular recognition system
More informationRecombinant Antibody Production in Therapeutic Antibody Projects. Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016
Recombinant Antibody Production in Therapeutic Antibody Projects Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016 Presentation Outline 1 2 3 4 5 Introduction Recombinant Ab Production
More informationHow Do You Clone a Gene?
S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are
More informationSession 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
More informationStudent Manual. pglo Transformation
Student Manual pglo Transformation Lesson 1 Introduction to Transformation In this lab you will perform a procedure known as genetic transformation. Remember that a gene is a piece of DNA which provides
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationDo you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
More informationRNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation
RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss
More informationGenetic Engineering for Biofuels Production
Genetic Engineering for Biofuels Production WSE 573 Spring 2013 Greeley Beck INTRODUCTION Alternative transportation fuels are needed in the United States because of oil supply insecurity, oil price increases,
More information