Inexpensive Biosensors based on Cell-Free Extracts

Size: px
Start display at page:

Download "Inexpensive Biosensors based on Cell-Free Extracts"

Transcription

1 Inexpensive Biosensors based on Cell-Free Extracts Pitt igem 2015 Konstantin Borisov, Robert Donahue, Garrett Green, Apurva Patil, Alexander Szul

2 Inspiration Paper-based tests are currently used sparingly: ph paper pregnancy tests glucose meters

3 Inspiration The media of paper has huge advantages: Inexpensive cost of production Simple storage and transportation Does not require use of laboratory equipment

4 The idea: Could Paper-based Sensors Detect: Diseases: HIV, Malaria, Salmonella, Cancer Pollutants: Hormones, Heavy metals, Environmental pharmaceutical pollutants

5 Inspiration Pardee et al (2014) successfully used paper-based sensors with freeze-dried cell-free lysates Expressing a significant, selective signal Detecting RNAs Dehydrated system for long term storage Pardee, K., Green, A. A., Ferrante, T., Cameron, D. E., Keyser, A. D., Yin, P., Collins, J. J. "Paper-Based Synthetic Gene Networks" Cell. 159, 4, 6 November

6 Pitt igem Target Analytes Environmental Pollutants Estrogen: Feminization of wildlife Drinking water contamination Cancer Biomarkers Matrix metalloproteinases: Biomarkers for colon, breast, prostate, and intestinal cancers Small Protein Detection Model system for future development: Anti-MUC1 antibody Vascular endothelial growth factor A

7 Human Practices Questions raised during initial project design How would we want the final product to look like? How would the signal be detected on a paper? If this product would be designed for at-home use how would we minimize the false positives, false negatives, and uninterpretable results? Similar concerns of pregnancy tests and knowledge of terminal illness

8 Investigative Methodology Analyte Detection Transcriptional activation in cell-free extract Signal Processing Signal Detection Amplification/Quenching Fluorescent proteins/ Colorigenic substrates

9 Investigative Methodology Many reporter genes available with different advantages: strong signal, readily available mrfp1 fluoresces in visible light LacZ enzymatic conversion of substrates to colored products We chose for the majority of our experiments In future studies, increasing the potential outputs could be quite beneficial

10 Synthesis of Sensor Extract Standardized cell-free extract protocol for detection systems Reduced production costs Minimized production time; extracts can be made within two days Proteins of interest can be expressed in E. coli BL21 prior to lysis

11 Creation of Sensor Extract Step 1 Step 2 Step 3 Step 4 Culture E. coli BL21 with desired proteins Lyse by sonication and dialyze contents Implement extract contents on biosensor paper Flash-freeze biosensor for long term storage

12 Analyte Detection Transcriptional activation of specific RNA Polymerases in response to the targeted analyte Amplification of signal through in vitro transcription and translation Detectable signal within an hour Cell-free extract Modified estrogen receptive T7 RNA polymerase developed by team CMU Estrogen Synthetic repressor cleaved by a specific protease Protease Recruitment of RNAP to DNA through a 3- hybrid system

13 Estrogen Sensing System Based on Carnegie Mellon s estrogen-sensitive T7 RNA Polymerase Can be applied to other analyte-response RNA polymerases Estrogen Input No Estrogen Input T7* T7* Activated T7* Activated T7* T7* X pt7 X pt7

14 Estrogen Sensing System Estrogen Input No Estrogen Input T7* T7* Activated T7* Activated T7* T7* X pt7 X pt7

15 Protease Sensing System Neither DNA binding domain is strong enough to repress the synthetic promoter by itself, but the presence of both domains in proximity causes repression Protease Input Protease No Protease Input pprot E. coli RNAP X pprot X E. coli RNAP pprot

16 Protease Sensing System Protease Input Protease No Protease Input pprot E. coli RNAP X pprot X E. coli RNAP pprot

17 Protease Sensing System

18 Three-Hybrid Versatile System Designed novel three-hybrid detection system Recruits E. coli RNAP to a synthetic promoter through a 3-hybrid contact Possibilities for contacts are limitless however they need to be strong

19 Three-Hybrid Versatile System Anti-MUC1 antibody sensor utilizes the MUC1 immunogenic epitope as bait VEGF-A sensor uses a single chain variable fragment as bait VEGF-A is dimeric with two antibodies capable of binding the protein simultaneous (Chen et al 1999) Chen, Y. et al. "Selection and Analysis of an Optimized Anti-VEGF Antibody: Crystal Structure of an Affinity-matured Fab in Complex with Antigen." J. Mol. Biol. (1999) 293,

20 Three-Hybrid Versatile System Anti-MUC1 antibody detection Antibody Input No Input Antibody TP Activation Domain Activation Domain TP TP DBD TP DBD X p3h p3h

21 Three-Hybrid Versatile System Anti-MUC1 antibody detection

22 Amplification T3 RNAP Input NoT3 RNAP Input Signal Amplification X pt3 T3 RNAP T3 RNAP pt3 X T3 RNAP X pt3 pt3

23 Investigative Methodology Optimizing Mechanisms: DNA decoy hairpins bind RNA polymerases, acting as competitive inhibitors and reducing the amount of active polymerases Quenching mechanisms minimize leaky expression

24 Results Majority of the summer was spent cloning the constructs needed for the four subprojects, as well as optimizing the process of creating sensor extracts

25 Sensor extract We created a sensor extract protocol that retains crucial proteins from original cells These extracts can express genes from plasmids in vitro on paper

26 Hairpin Quenching Results

27 Future Project Directions Pitt igem has made sensor extracts for the estrogen and protease projects, and will upload the data to their igem page after the Jamboree Estrogen sensor parts (CMU, BBa_K ) and protease sensor parts (Pitt, BBa_K BBa_K ) available in igem registry for future teams Sensor extract protocol available at 2015.igem.org/Team:Pitt/Protocols

28 Acknowledgements Dr. Jason Lohmueller, who provided the team with project support and advice, helped bring igem to Pitt for the second straight year! Dr. Alex Deiters, who provided advice at all stages of the project and contributed useful feedback and critique of data collection Dr. Hanna Salman, who generously provided lab space, and provided supplies and chemicals Dr. Sanjeev Shroff, who gathered funding from various university sources, and took care of logistics of forming a university team Dr. Cheryl Telmer from CMU s igem team and Keith Pardee from the Collins Lab at MIT, who provided DNA for our project The University of Pittsburgh departments that came together to fund the Pitt 2015 igem team

29 Thank you! Questions?

30 Three-Hybrid Versatile System VEGF-A detection VEGF-A Input No Input VEGF-A Activation Domain Activation Domain VEGF-A DBD DBD X p3h p3h

31 Proteins in Sensor Extract

32 Fluorescence (RFU) Estrogen Sensor Preliminary Results ERT7 Extract + pt7, e, 100 um Estrogen T7 Extract, No DNA T7 Extract + pt7, e, 100 nm Estrogen T7 Extract + pt7, e, 30 um Estrogen ERT7 Extract + pt7, e, 10 nm Estrogen 500 ERT7 Extract + pt7, e, 3 um Estrogen T7 Extract + pt7, e, 1 nm Estrogen T7 Extract + pt7, e, 300 nm Estrogen T7 Extract + pt7, e, 100 um Estrogen ERT7 Extract + pt7, e, 30 nm Estrogen ERT7 Extract + pt7, e, 10 um Estrogen T7 Extract + pt7, e, 3 nm Estrogen 100 T7 Extract + pt7, e, 1 um Estrogen Time (minutes) T7 Extract + pt7, e, 300 um Estrogen ERT7 Extract + pt7, e, 100 nm Estrogen ERT7 Extract + pt7, e, 30 um Estrogen

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Contents 1 The Lactose Intolerance of Bacteria 2 The Lac Operon 3 Lac Operon Simulation 4 LacZ as a reporter gene The Lactose Intolerance of Bacteria The standard growth kinetics

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

7.1 The lac Operon 7-1

7.1 The lac Operon 7-1 7.1 The lac Operon The lac operon was the first operon discovered It contains 3 genes coding for E. coli proteins that permit the bacteria to use the sugar lactose Galactoside permease (lacy) which transports

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design. Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research

More information

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression

More information

Use of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter. Michael Brinton BIOL 230W.

Use of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter. Michael Brinton BIOL 230W. Use of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter Michael Brinton BIOL 230W.001 28 October 2013 TA: Sashi Gollapudi Introduction Many human

More information

Yeast Two Hybrid Assay: A Fishing Tale

Yeast Two Hybrid Assay: A Fishing Tale KEYWORDS: yeast two hybrid, molecular interactions, galactose metabolism Special section on techniques: Yeast Two Hybrid Assay: A Fishing Tale Solmaz Sobhanifar Pathology, University of British Columbia

More information

A Discovery Laboratory Investigating Bacterial Gene Regulation

A Discovery Laboratory Investigating Bacterial Gene Regulation Chapter 8 A Discovery Laboratory Investigating Bacterial Gene Regulation Robert Moss Wofford College 429 N. Church Street Spartanburg, SC 29307 mosssre@wofford.edu Bob Moss is an Associate Professor of

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

REGULATION OF GENE EXPRESSION

REGULATION OF GENE EXPRESSION REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis pet6xhn Expression Vector Set Contents Product Information... 1 pet6xhn-n, pet6xhn-c, and pet6xhn-gfpuv Vector Information... 2 Location of Features... 4 Additional Information...

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Cell-free synthetic biology provides an experimental

Cell-free synthetic biology provides an experimental pubs.acs.org/synthbio An E. coli Cell-Free Expression Toolbox: Application to Synthetic Gene Circuits and Artificial Cells Jonghyeon Shin and Vincent Noireaux* School of Physics and Astronomy, University

More information

Heterologous protein expression systems

Heterologous protein expression systems IMBB-FORTH Heterologous protein expression systems What are they? Protein expression systems producing desired polypeptides from recombinant genes. Plasmids carry and express the desired recombinant genes

More information

GENE REGULATION IN PROKARYOTES

GENE REGULATION IN PROKARYOTES GENE REGULATION IN PROKARYOTES Prepared by Brenda Leady, University of Toledo Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene regulation refers to

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Chapter 10 Analytical Biotechnology and the Human Genome

Chapter 10 Analytical Biotechnology and the Human Genome Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based

More information

Cell-free TX-TL systems for synthetic biology

Cell-free TX-TL systems for synthetic biology Cell-free TX-TL systems for synthetic biology Vincent Noireaux, University of Minnesota Caltech workshop, August 2013 1 Outline: Introduction - Motivations. Cell-free TX-TL. Synthetic gene circuits and

More information

Strategies for Improving Soluble Protein Production in E. coli

Strategies for Improving Soluble Protein Production in E. coli Strategies for Improving Soluble Protein Production in E. coli Key Learning Objectives Overview of recombinant protein expression in E. coli Challenges in protein expression Solutions Clone quickly Reduce

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Regulation of gene expression. (Lehninger pg )

Regulation of gene expression. (Lehninger pg ) Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Chem 465 Biochemistry II

Chem 465 Biochemistry II Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary

More information

Ag-goat-ination: Combating Antibiotic Resistance through Diagnostic Agglutination Assays. igem 2014 Giant Jamboree 10/31/14

Ag-goat-ination: Combating Antibiotic Resistance through Diagnostic Agglutination Assays. igem 2014 Giant Jamboree 10/31/14 Ag-goat-ination: Combating Antibiotic Resistance through Diagnostic Agglutination Assays igem 2014 Giant Jamboree 10/31/14 Our Team 1 2 Overall Project Goal Design a New Method for Disease Diagnostics

More information

Characterization of Aptamer Binding using SensíQ SPR Platforms

Characterization of Aptamer Binding using SensíQ SPR Platforms Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate

More information

BIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.

BIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY. BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Chemical Peptide Synthesis in the Development of Protein Therapeutics

Chemical Peptide Synthesis in the Development of Protein Therapeutics Chemical Peptide Synthesis in the Development of Protein Therapeutics Stephen Kent Abstract Effective automated SPPS is key to the synthesis of peptide building blocks for chemical protein synthesis, and

More information

Chromatin and Transcription

Chromatin and Transcription Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation

More information

Transcription in Prokaryotes. Jörg Bungert, PhD Phone:

Transcription in Prokaryotes. Jörg Bungert, PhD Phone: Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating

More information

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO

More information

Chapter 31. Transcription and RNA processing

Chapter 31. Transcription and RNA processing Chapter 31 Transcription and RNA processing RNA polymerase (RNAP) E. coli promoters Components of E. coli RNA Polymerase Holoenzyme (α 2 ββ'ωσ) Structure of prokaryotic RNAP The closed and open state of

More information

Practice Test #3. Multiple Choice Identify the choice that best completes the statement or answers the question.

Practice Test #3. Multiple Choice Identify the choice that best completes the statement or answers the question. Practice Test #3 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists would be _. a.

More information

MyBioSource.com. Human VEGF ELISA Kit

MyBioSource.com. Human VEGF ELISA Kit Human VEGF ELISA Kit Catalog No.: MBS355343 Size: 96T Range: 31.2 pg/ml-2000 pg/ml (human serum, plasma, body fluids) 15.6 pg/ml-1000 pg/ml (cell culture supernates) Sensitivity < 1 pg/ml Storage and Expiration:

More information

Eukaryotic & Prokaryotic Transcription. RNA polymerases

Eukaryotic & Prokaryotic Transcription. RNA polymerases Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000

More information

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography Green Fluorescent Protein (GFP) Purification Hydrophobic Interaction Chromatography What is the GFP gene? GFP is a green fluorescent protein that is normally found in jellyfish. It has been engineered

More information

BIOLOGY. Chapter 16 GenesExpression

BIOLOGY. Chapter 16 GenesExpression BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results

More information

Systematic Evolution of Ligands by Exponential Enrichment SELEX

Systematic Evolution of Ligands by Exponential Enrichment SELEX Systematic Evolution of Ligands by Exponential Enrichment SELEX SELEX Systematic evolution of ligands by exponential amplification * Isolation of new RNs with novel properties * New therapeutics, New diagnostics

More information

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc. The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration

More information

Protein Expression PURIFICATION & ANALYSIS. be INSPIRED drive DISCOVERY stay GENUINE

Protein Expression PURIFICATION & ANALYSIS. be INSPIRED drive DISCOVERY stay GENUINE Expression PURIFICATION & ANALYSIS be INSPIRED drive DISCOVERY stay GENUINE OVERVIEW Expression & Purification expression can be a very complex, multi-factorial process. Each protein requires a specific

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

Technical tips Session 5

Technical tips Session 5 Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Optimizing Synthetic DNA for Metabolic Engineering Applications. Howard Salis Penn State University

Optimizing Synthetic DNA for Metabolic Engineering Applications. Howard Salis Penn State University Optimizing Synthetic DNA for Metabolic Engineering Applications Howard Salis Penn State University Synthetic Biology Specify a function Build a genetic system (a DNA molecule) Genetic Pseudocode call producequorumsignal(luxi

More information

Peptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST

Peptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Peptide libraries: applications, design options and considerations Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Overview 1 2 3 4 5 Introduction Peptide library basics Peptide library design considerations

More information

Protein-protein interaction analysis

Protein-protein interaction analysis Protein-protein interaction analysis Protein-protein interactions Golemis & Adams CSHL Press, 2005 Review and research papers (referenced on slides) doc. Jan Paleček jpalecek@sci.muni.cz - Matrix/beads-based:

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Synthetic Biology of Genetic Circuit

Synthetic Biology of Genetic Circuit Synthetic Biology of Genetic Circuit 1 Mallar, K. N. and 2 Prasenjit, D. 1 M.Sc. (Agri.), Dept. of Biotechnology, AAU, Jorhat, Assam 2 M.Sc. (Agri.), Dept. of Biotechnology, UAS, Dharwad, Karnataka Correspondence

More information

TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics

TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics INTRODUCTION The development of renewable capture reagents

More information

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

More information

Genetics Lecture Notes Lectures 17 19

Genetics Lecture Notes Lectures 17 19 Genetics Lecture Notes 7.03 2005 Lectures 17 19 Lecture 17 Gene Regulation We are now going to look at ways that genetics can be used to study gene regulation. The issue is how cells adjust the expression

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

DNA Structure and Properties Basic Properties Predicting Melting Temperature. Dinesh Yadav

DNA Structure and Properties Basic Properties Predicting Melting Temperature. Dinesh Yadav DNA Structure and Properties Basic Properties Predicting Melting Temperature Dinesh Yadav Nucleic Acid Structure Question: Is this RNA or DNA? Molecules of Life, pp. 15 2 Nucleic Acid Bases Molecules of

More information

Transcriptional Regulation in Eukaryotes

Transcriptional Regulation in Eukaryotes Transcriptional Regulation in Eukaryotes Concepts, Strategies, and Techniques Michael Carey Stephen T. Smale COLD SPRING HARBOR LABORATORY PRESS NEW YORK 2000 Cold Spring Harbor Laboratory Press, 0-87969-537-4

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Cell Growth and DNA Extraction- Technion igem HS

Cell Growth and DNA Extraction- Technion igem HS Growing Cells and DNA Extraction Goals 1. Become familiar with the process of growing bacteria 2. Get to know the DNA extraction process 3. Perform miniprep in the lab Keywords 1. Growth stages 6. Techniques

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

Supplemental Information. Natural RNA Polymerase Aptamers. Regulate Transcription in E. coli

Supplemental Information. Natural RNA Polymerase Aptamers. Regulate Transcription in E. coli Molecular Cell, Volume 67 Supplemental Information Natural RNA Polymerase Aptamers Regulate Transcription in E. coli Nadezda Sedlyarova, Philipp Rescheneder, Andrés Magán, Niko Popitsch, Natascha Rziha,

More information

The dialkylglycine decarboxylase repressor DgdR. Functional aspects and relation to other LysR proteins

The dialkylglycine decarboxylase repressor DgdR. Functional aspects and relation to other LysR proteins 11/29/2011 1 The dialkylglycine decarboxylase repressor DgdR. Functional aspects and relation to other LysR proteins 1. Dialkylglycine amino acids 2. In vivo and in vitro studies on the DgdR repressor

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

B-cell Epitope Prediction and Cloning monoclonal ADAs

B-cell Epitope Prediction and Cloning monoclonal ADAs B-cell Epitope Prediction and Cloning monoclonal ADAs Stefan Ryser, CEO, Trellis Bioscience 3 rd International Symposium on Higher Order Structure of Protein Therapeutics Arlington, Virginia, February

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.

More information

Affinity Reagents: The Landscape and Affimer Technology Competitive Advantages

Affinity Reagents: The Landscape and Affimer Technology Competitive Advantages Affinity Reagents: The Landscape and Affimer Technology Competitive Advantages Introduction It is well accepted that the limitations of antibodies present valuable commercial opportunities for alternative

More information

Introduction to Protein Purification

Introduction to Protein Purification Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography

More information

GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit

GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit Universal kit for isolation of total DNA from gram positive bacteria and yeast. The kit contains glass beads for mechanical cell disruption. Cat.

More information

Human Cell-Free Protein Expression Maxi System

Human Cell-Free Protein Expression Maxi System Cat. # 3285 For Research Use Human Cell-Free Protein Expression Maxi System Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage...

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction

More information

CHAPTER 13 LECTURE SLIDES

CHAPTER 13 LECTURE SLIDES CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

MOLECULAR RECOGNITION

MOLECULAR RECOGNITION MOLECULAR RECOGNITION Bioanalytical Methods Classification 1. Biassay: molecular recognition, signal generation and detection in solution or on inert solid phase 2. Biosensor: molecular recognition system

More information

Recombinant Antibody Production in Therapeutic Antibody Projects. Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016

Recombinant Antibody Production in Therapeutic Antibody Projects. Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016 Recombinant Antibody Production in Therapeutic Antibody Projects Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016 Presentation Outline 1 2 3 4 5 Introduction Recombinant Ab Production

More information

How Do You Clone a Gene?

How Do You Clone a Gene? S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are

More information

Session 3 Cloning Overview & Polymerase Chain Reaction

Session 3 Cloning Overview & Polymerase Chain Reaction Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful

More information

Student Manual. pglo Transformation

Student Manual. pglo Transformation Student Manual pglo Transformation Lesson 1 Introduction to Transformation In this lab you will perform a procedure known as genetic transformation. Remember that a gene is a piece of DNA which provides

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein? Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA

More information

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss

More information

Genetic Engineering for Biofuels Production

Genetic Engineering for Biofuels Production Genetic Engineering for Biofuels Production WSE 573 Spring 2013 Greeley Beck INTRODUCTION Alternative transportation fuels are needed in the United States because of oil supply insecurity, oil price increases,

More information