Differential Gene Expression

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Differential Gene Expression"

Transcription

1 Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006

2 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O ) state of histones controls DNA binding histone acetyltransferases allow transcription histone deacetylases repression 3. Histone methylation (CH 3 ) further repression

3 Chromatin configuration John H. Frenster heterochromatin remains tightly condensed throughout most of the cell cycle replicates later euchromatin active chromatin

4 Anatomy of the Gene core promoter transcription initiation site 5 region transcribed region 3 TATAT +1 upstream downstream

5 Human β globin Gene Sequence

6 Production of β globin 5

7 Promoters and Enhancers RNA polymerase binds to promoter at the TATA box however, Pol II cannot initiate transcription alone various proteins bind to regulatory sequences upstream and downstream of transcription initiation site sequences in the promoter region bind Basal Transcription Factors promoter region 5 3 basal transcription factors facilitate Pol II binding and activity

8 Eukaryotic Transcription Initiation Complex basal transcription factors: sequential binding binding mediated by small proteins TBP associated factors (TAFs) mediator complex 1. TFIID complex binds to the TATA box through its TATA Binding Protein (TBP) subunit 2. TFIID is stabilized by TFIIA 3. TFIIB and TFIIH join the complex on the TATA box; TFIIE and TFIIF associate with RNA polymerase II

9 Eukaryotic Transcription Initiation Complex 2 4. RNA polymerase II is positioned by TFIIB, and its carboxy terminal domain (CTD) is bound by TFIID 5. The CTD is phosphorylated by TFIIH and is released by TFIID; RNA polymerase II can now transcribe mrna

10 Stabilization of Transcriptional Initiation Complex by TAFs TBP TATA binding protein TAF(s) TBP associated factors

11 Enhancers 1 Enhancers are cis acting regulatory elements cis (same or same side); elements that reside on the same DNA stand; DNA sequences trans (other side); elements that originate from another DNA strand, e.g. regulatory proteins DNA sequences that regulate gene expression by affecting the transcription initiation complex on the promoter. Function bind specific regulatory proteins = transcription factors Enhancer locations can be highly variable, with respect to the transcribed portion of the gene. upstream (5 ), downstream (3 ), within transcribed region close proximity or as many as 106 bp away Enhancers are modular; e.g. mouse Pax6 gene expressed in multiple tissues, each under the influence of a different enhancer

12 Enhancers differ from promoters: 1) need a promoter to work 2) can work at a distance 3) can work in reverse orientation Enhancers 2

13 Enhancer Generalizations 1. Most gene transcription requires enhancers. 2. Enhancers are the major determinants of differential transcription in space (cell type) and time (developmental stage). 3. There can be multiple signals (e.g. multiple enhancer sites) for a given gene, and each enhancer can be bound by more than one transcription factor (not at the same time). 4. Transcription is regulated by the interaction of transcription factors bound to enhancers and the transcription initiation complex assembled at the promoter. 5. Enhancers are combinatorial. Various DNA sequences regulate temporal and spatial gene expression; these can be mixed and matched. 6. Enhancers are modular. A gene can have several enhancer elements, each of which may turn it on in different sets of cells. 7. Enhancers generally activate transcription by remodeling chromatin to expose the promoter, or by facilitating the binding of RNA polymerase to the promoter by stabilizing TAFs. 8. Enhancers can also inhibit transcription (aka Silencers).

14 Methods Reporter Genes Reporter gene construct: enhancer elements for Pax6 attached to structural genes for reporter molecules. exons for Pax6 mouse Pax6 LacZ β galactosidase gene for reporter protein, e.g. β galactosidase (blue) luciferase (produces light) green fluorescent protein (GFP) Drosophila

15 Transcription Factors Proteins that bind to enhancer or promoter regions activate or repress transcription Most bind to specific DNA sequences (e.g. enhancers) Transcription factors are grouped together in families, based on structural similarities families share common framework in DNA binding sites slight differences in binding sites cause differences in recognition

16

17 estrogen receptor zinc finger domain

18 Transcription Factor Domains Three major domains: 1. DNA binding recognizes particular DNA sequence transcription factor engrailed

19 Transcription Factor Domains Three major domains: 1. DNA binding recognizes particular DNA sequence 2. trans activation activates or represses transcription often involved with proteins involved in binding RNA polymerase II; e.g. TFIIB, TFIIE often involved with enzymes that modify histones 3. protein protein interaction domain promotes dimerization allows it to be modulated by TAFs or other transcription factors

20 Transcription Factor Domains Transcription factor MITF basic helix loop helix homodimer is the functional protein The trans activating domain is contained in the center of the protein. when bound to a promoter or enhancer, the protein is able to bind a TAF (p300/cbp) TAF p300/cbp is a histone acetyltranferase

21 Enhancer Modules Enhancers are modular: e.g. Pax6 gene expressed in the eye, pancreas, nervous system. also expressed in different genes within these tissues Within these modules, transcription factors work in a combinatorial fashion. Transcription factors operate in cascades: one stimulates the production of several others.

22 DNA Methylation vertebrates; not Drosophila, nematodes, inverts methylation stabilizes nucleosome; stable nucleosome = transcriptional repression degree of methylation is proportional to degree of transcription absence of methylation correlates with tissue specific expression methylation patterns maintained throughout cell division by DNA (cytosine 5) methyltransferase

23 Genomic Imprinting Special case of DNA methylation Alleles from maternal and paternal genome are differentially methylated. Methylation patterns can be distinguished based on resulting phenotypes.

24 Dosage Compensation Mammals, Drosophila, nematodes XX = female, XY = male; result is too much X product Drosophila transcription rate of male X is doubled C. elegans both Xs partially repressed ( = hermaphrodite) Mammals Inactivation of a single X chromosome in mammalian XX cells XX cell early embryo both active later embryo only one active Barr bodies

25 X Chromosome inactivation Lyon hypothesis: 1. Both X chromosomes active in very early female development. 2. One X is inactivated in each cell 3. Inactivation is random 4. The process is irreversible. All progeny cells will retain the same inactivation pattern calico cat: heterozygous for coat color genes contained on X chromosome early late X chromosome inactivation

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 - Developmental Biology Differential Gene Expression June 18, 2009 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

Differential Gene Expression

Differential Gene Expression IBS 8102 Cell, Molecular, and Developmental Biology Differential Gene Expression January 22, 2008 Differential Gene Expression Chromatin structure Gene anatomy Gene sequences Control of gene transcription

More information

Eukaryotic Transcription

Eukaryotic Transcription Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).

More information

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.

More information

Eukaryotic & Prokaryotic Transcription. RNA polymerases

Eukaryotic & Prokaryotic Transcription. RNA polymerases Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Chapter 24: Promoters and Enhancers

Chapter 24: Promoters and Enhancers Chapter 24: Promoters and Enhancers A typical gene transcribed by RNA polymerase II has a promoter that usually extends upstream from the site where transcription is initiated the (#1) of transcription

More information

32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes

32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes 3 Gene regulation in Eukaryotes Lecture Outline /8/05 Gene regulation in eukaryotes Chromatin remodeling More kinds of control elements Promoters, Enhancers, and Silencers Combinatorial control Cell-specific

More information

Regulation of Gene WORKING WITH THE FIGURES

Regulation of Gene WORKING WITH THE FIGURES 12 Regulation of Gene Expression in Eukaryotes WORKING WITH THE FIGURES 1. In Figure 12-4, certain mutations decrease the relative transcription rate of the b-globin gene. Where are these mutations located,

More information

Epigenetics. Medical studies in English, Lecture # 12,

Epigenetics. Medical studies in English, Lecture # 12, Epigenetics Medical studies in English, 2018. Lecture # 12, Epigenetics Regulation of gene activity in eukaryotes Correlation of chromatin structure with transcription stably heritable phenotype resulting

More information

Chromatographic Separation of the three forms of RNA Polymerase II.

Chromatographic Separation of the three forms of RNA Polymerase II. Chromatographic Separation of the three forms of RNA Polymerase II. α-amanitin α-amanitin bound to Pol II Function of the three enzymes. Yeast Pol II. RNA Polymerase Subunit Structures 10-7 Subunit structure.

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

CHAPTER 13 LECTURE SLIDES

CHAPTER 13 LECTURE SLIDES CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Structure/function relationship in DNA-binding proteins

Structure/function relationship in DNA-binding proteins PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes 12 Regulation of Gene Expression in Eukaryotes WORKING WITH THE FIGURES 1. In Figure 12-4, certain mutations decrease the relative transcription rate of the -globin gene. Where are these mutations located,

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory

Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

EUKARYOTIC GENE CONTROL

EUKARYOTIC GENE CONTROL EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION

More information

Gene Regulation in Eukaryotes

Gene Regulation in Eukaryotes Gene Regulation in Eukaryotes The latest estimates are that a human cell, a eukaryotic cell, contains 20,000 25,000 genes. Some of these are expressed in all cells all the time. These so-called housekeeping

More information

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a true nucleus. Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope

More information

Nucleotide Entry Port. Scaffold Subunits. Polymerase Activity β Sliding Clamp. Clamp Loader. Promoter Recognition

Nucleotide Entry Port. Scaffold Subunits. Polymerase Activity β Sliding Clamp. Clamp Loader. Promoter Recognition Nucleotide Entry ort α (2) Scaffold Subunits olymerase Activity Sliding Clamp σ Clamp Loader romoter Recognition -35-10 NNAAA AA T A TTTTNNAAAANNN TT T N N17 N6 α α α α α α α α α α α α α α +1 α α α α Subunit

More information

CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS

CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS A. Promoters and Polymerases (RNA pols): 1. General characteristics - Initiation of transcription requires a. Transcription factors

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de

More information

Mechanisms of Transcription. School of Life Science Shandong University

Mechanisms of Transcription. School of Life Science Shandong University Mechanisms of Transcription School of Life Science Shandong University Ch 12: Mechanisms of Transcription 1. RNA polymerase and the transcription cycle 2. The transcription cycle in bacteria 3. Transcription

More information

Exam 1 ID#: June 29, 2009

Exam 1 ID#: June 29, 2009 Biology 4361 Name: KEY Exam 1 ID#: June 29, 2009 Multiple choice (one point each; indicate the best answer) 1. According to von Baer s laws, developing embryos a. pass through the adult stages of lower

More information

Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 11

Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 11 Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Twitter: @PlantDevTUM, #genetiktum FB: Plant Development TUM Prof. Dr. Claus Schwechheimer

More information

SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat

SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat TRANSCRIPTION: AN OVERVIEW Transcription: the synthesis of a single-stranded RNA from a doublestranded DNA template.

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

Chapter 25: Regulating Eukaryotic Transcription The Ligand Responsive Activators

Chapter 25: Regulating Eukaryotic Transcription The Ligand Responsive Activators Chapter 25: Regulating Eukaryotic Transcription The Ligand Responsive Activators At least 5 potential gene expression control points Superfamily of Gene Regulators Activation of gene structure Initiation

More information

DO NOT OPEN UNTIL TOLD TO START

DO NOT OPEN UNTIL TOLD TO START DO NOT OPEN UNTIL TOLD TO START BIO 312, Section 1: Fall 2012 December 4 th, 2012 Exam 3 Name (print neatly) Signature 7 digit student ID INSTRUCTIONS: 1. There are 12 pages to the exam. Make sure you

More information

Chapter 9-II - Transcriptional Control of Gene Expression

Chapter 9-II - Transcriptional Control of Gene Expression Chapter 9-II - Transcriptional Control of Gene Expression Transcriptional Control of Gene Expression 9.3 RNA Polymerase II Promoters and General Transcription Factors Three types of promoter sequences

More information

Chromatin. Structure and modification of chromatin. Chromatin domains

Chromatin. Structure and modification of chromatin. Chromatin domains Chromatin Structure and modification of chromatin Chromatin domains 2 DNA consensus 5 3 3 DNA DNA 4 RNA 5 ss RNA forms secondary structures with ds hairpins ds forms 6 of nucleic acids Form coiling bp/turn

More information

BIOLOGY. Chapter 16 GenesExpression

BIOLOGY. Chapter 16 GenesExpression BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results

More information

Chromatin and Transcription

Chromatin and Transcription Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

Regulation of Gene Expression

Regulation of Gene Expression Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter

Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1 Learning Objectives 1. List and explain how DNA

More information

Chromatin Structure and its Effects on Transcription

Chromatin Structure and its Effects on Transcription Chromatin Structure and its Effects on Transcription Epigenetics 2014 by Nigel Atkinson The University of Texas at Austin From Weaver 4th edition and Armstrong 1st edition What is the point? DNA is not

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Regulation of Gene Expression

Regulation of Gene Expression CAMPBELL BIOLOGY IN FOCUS URRY CAIN WASSERMAN MINORSKY REECE 15 Regulation of Gene Expression Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION

More information

Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above

Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above 1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex

More information

Trasposable elements: Uses of P elements Problem set B at the end

Trasposable elements: Uses of P elements Problem set B at the end Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches

More information

Regulation of gene expression. (Lehninger pg )

Regulation of gene expression. (Lehninger pg ) Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene

More information

Regulatory Dynamics in Engineered Gene Networks

Regulatory Dynamics in Engineered Gene Networks Regulatory Dynamics in Engineered Gene Networks The Physico-chemical Foundation of Transcriptional Regulation with Applications to Systems Biology Mads Kærn Boston University Center for BioDynamics Center

More information

Transcription Regulation And Gene Expression in Eukaryotes FS 2016 Graduate Course G2 P Matthias and RG Clerc Pharmazentrum Hörsaal 2 16h15-18h00

Transcription Regulation And Gene Expression in Eukaryotes FS 2016 Graduate Course G2 P Matthias and RG Clerc Pharmazentrum Hörsaal 2 16h15-18h00 Transcription Regulation And Gene Expression in Eukaryotes FS 2016 Graduate Course G2 P Matthias and RG Clerc Pharmazentrum Hörsaal 2 16h15-18h00 The general problem RG Clerc March 2, 2016 RNA Transcription

More information

Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics

Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Epigenetics represents the science for the studying heritable

More information

Genetics Biology 331 Exam 3B Spring 2015

Genetics Biology 331 Exam 3B Spring 2015 Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation

More information

DNA Transcription. Visualizing Transcription. The Transcription Process

DNA Transcription. Visualizing Transcription. The Transcription Process DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription

More information

Y1 Biology 131 Syllabus - Academic Year

Y1 Biology 131 Syllabus - Academic Year Y1 Biology 131 Syllabus - Academic Year 2016-2017 Monday 28/11/2016 DNA Packaging Week 11 Tuesday 29/11/2016 Regulation of gene expression Wednesday 22/9/2014 Cell cycle Sunday 4/12/2016 Tutorial Monday

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

Transcriptional Regulation in Eukaryotes

Transcriptional Regulation in Eukaryotes Transcriptional Regulation in Eukaryotes Concepts, Strategies, and Techniques Michael Carey Stephen T. Smale COLD SPRING HARBOR LABORATORY PRESS NEW YORK 2000 Cold Spring Harbor Laboratory Press, 0-87969-537-4

More information

DNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268

DNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268 DNA Binding Domains: Structural Motifs Studies of known transcription factors have found several motifs of protein design to allow sequence-specific binding of DNA. We will cover only three of these motifs:

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Genes found in the genome include protein-coding genes and non-coding RNA genes. Which nucleotide is not normally found in non-coding RNA genes?

Genes found in the genome include protein-coding genes and non-coding RNA genes. Which nucleotide is not normally found in non-coding RNA genes? Midterm Q Genes found in the genome include protein-coding genes and non-coding RNA genes Which nucleotide is not normally found in non-coding RNA genes? G T 3 A 4 C 5 U 00% Midterm Q Which of the following

More information

What is Epigenetics? Watch the video

What is Epigenetics? Watch the video EPIGENETICS What is Epigenetics? The study of environmental factors on gene expression in DNA. The molecule is called methylation controls when genes are turned on. Methylation turns off genes. Acetylation

More information

Lecture 9 Controlling gene expression

Lecture 9 Controlling gene expression Lecture 9 Controlling gene expression BIOLOGY Campbell, Reece and Mitchell Chapter 18 334- (352-356) Every cell in your body contains the same number of genes approximately 35, 000 DNA is wound around

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

EUKARYOTIC REGULATION C H A P T E R 1 3

EUKARYOTIC REGULATION C H A P T E R 1 3 EUKARYOTIC REGULATION C H A P T E R 1 3 EUKARYOTIC REGULATION Every cell in an organism contains a complete set of DNA. But it doesn t use all of the DNA it receives Each cell chooses different DNA sequences

More information

Figure 1: Testing the CIT: T.H. Morgan s Fruit Fly Mating Experiments

Figure 1: Testing the CIT: T.H. Morgan s Fruit Fly Mating Experiments I. Chromosomal Theory of Inheritance As early cytologists worked out the mechanism of cell division in the late 1800 s, they began to notice similarities in the behavior of BOTH chromosomes & Mendel s

More information

GENE REGULATION IN PROKARYOTES

GENE REGULATION IN PROKARYOTES GENE REGULATION IN PROKARYOTES Prepared by Brenda Leady, University of Toledo Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene regulation refers to

More information

Zool 3200: Cell Biology Exam 2 2/20/15

Zool 3200: Cell Biology Exam 2 2/20/15 Name: TRASK Zool 3200: Cell Biology Exam 2 2/20/15 Answer each of the following short and longer answer questions in the space provided; circle the BEST answer or answers for each multiple choice question

More information

Transcription & post transcriptional modification

Transcription & post transcriptional modification Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.

More information

Transcription in Prokaryotes. Jörg Bungert, PhD Phone:

Transcription in Prokaryotes. Jörg Bungert, PhD Phone: Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating

More information

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation

More information

Wednesday, November 22, 17. Exons and Introns

Wednesday, November 22, 17. Exons and Introns Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed

More information

Chapter 11. Gene Expression and Regulation. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc..

Chapter 11. Gene Expression and Regulation. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.. Chapter 11 Gene Expression and Regulation Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc.. 11.1 How Is The Information In DNA Used In A Cell? Most genes contain

More information

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table

More information

Biochemistry Eukaryotic Transcription

Biochemistry Eukaryotic Transcription 1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. Understand and have an overview of eucaryotic transcriptional regulation. 2. Explain

More information

I. Prokaryotic Gene Regulation. Figure 1: Operon. Operon:

I. Prokaryotic Gene Regulation. Figure 1: Operon. Operon: I. Prokaryotic Gene Regulation Figure 1: Operon Operon: a) Regulatory Elements consist of an Operator that serves as the on-off switch for the genes of the operon. Also contains a promoter for the Structural

More information

Chapter 10: Gene Expression and Regulation

Chapter 10: Gene Expression and Regulation Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must

More information

Chapter 2 The Structure of Genes and Genomes. Electron micrograph of a metaphase chromosome

Chapter 2 The Structure of Genes and Genomes. Electron micrograph of a metaphase chromosome Chapter 2 The Structure of Genes and Genomes Electron micrograph of a metaphase chromosome Genetic information is stored in double stranded DNA DNA structure, building blocks: (A) Bases DNA structure,

More information

Chapter 5 DNA and Chromosomes

Chapter 5 DNA and Chromosomes Chapter 5 DNA and Chromosomes DNA as the genetic material Heat-killed bacteria can transform living cells S Smooth R Rough Fred Griffith, 1920 DNA is the genetic material Oswald Avery Colin MacLeod Maclyn

More information

Biological information flow

Biological information flow BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules

More information

Cell Nucleus. Chen Li. Department of Cellular and Genetic Medicine

Cell Nucleus. Chen Li. Department of Cellular and Genetic Medicine Cell Nucleus Chen Li Department of Cellular and Genetic Medicine 13 223 chenli2008@fudan.edu.cn Outline A. Historical background B. Structure of the nucleus: nuclear pore complex (NPC), lamina, nucleolus,

More information

Classes of eukaryotic cellular RNAs

Classes of eukaryotic cellular RNAs Classes of eukaryotic cellular RNAs ribosomal RNA (rrna) 18S (small subunit) 28S (large subunit) 5.8S (large subunit) 5S (large subunit) transfer RNA (trna) messenger RNA (mrna) heterogeneous nuclear RNA

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Developmental Biology BY1101 P. Murphy

Developmental Biology BY1101 P. Murphy Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision

More information

Neurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants

Neurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are

More information

Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license.

Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license. Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license. 2013, Rice University. CHAPTER 16 GENE EXPRESSION 429 16 GENE EXPRESSION

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

Biological information flow

Biological information flow BCMB 3100 Chapters 36-38 Transcription & RNA Processing Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors mrna processing Biological

More information

Exam 2 BIO200, Winter 2012

Exam 2 BIO200, Winter 2012 Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide

More information

DNA, Genes and their Regula4on. Me#e Voldby Larsen PhD, Assistant Professor

DNA, Genes and their Regula4on. Me#e Voldby Larsen PhD, Assistant Professor DNA, Genes and their Regula4on Me#e Voldby Larsen PhD, Assistant Professor Learning Objecer this talk, you should be able to Account for the structure of DNA and RNA including their similari

More information

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may

More information

Functional Antagonism of the RNA Polymerase II Holoenzyme by Negative Regulators. Ellen L. Gadbois. September 1997

Functional Antagonism of the RNA Polymerase II Holoenzyme by Negative Regulators. Ellen L. Gadbois. September 1997 Functional Antagonism of the RNA Polymerase II Holoenzyme by Negative Regulators by Ellen L. Gadbois B.A., Biology College of St. Catherine, 1990 SUBMITTED TO THE DEPARTMENT OF BIOLOGY IN PARTIAL FULFILLMENT

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Overview of Human Genetics

Overview of Human Genetics Overview of Human Genetics 1 Structure and function of nucleic acids. 2 Structure and composition of the human genome. 3 Mendelian genetics. Lander et al. (Nature, 2001) MAT 394 (ASU) Human Genetics Spring

More information