Gene transfer efficiency in gonococcal biofilms: role of. biofilm age, architecture, and pilin antigenic variation

Transcription

1 Supporting information for Gene transfer efficiency in gonococcal biofilms: role of biofilm age, architecture, and pilin antigenic variation Nadzeya Kouzel, Enno R. Oldewurtel, and Berenike Maier* Supporting methods Construction of reporter strains. The promoter region of pile (P pile ) with a SacI restriction site was amplified from chromosomal DNA of gonococcal strain MS11 using primers NK83 and NK135. The sequence of the enhanced version of green fluorescent protein (gfpmut3) with a SacI restriction site was amplified from the pam239 (5) using primers NK134 and NK133. A PCR fusion between P pile and gfpmut3 was generated using NK83 and NK133. The product was inserted into SacI site of p2/16/1 (7), resulting in piga::p pile gfpmut3. This plasmid was used to introduce the gfp ermc alleles into the iga locus of strain MS11, generating strain K-Ng-303. We generated a second integration vector for insertion of alleles between aspc and lctp on the gonococcal chromosome, following a previously reported approach (3). aspc was amplified from chromosomal DNA using NK63 and NK64 introducting a Hind III restriction site at 5 end and an engineered MCS at 3 end. lctp was amplified using NK61 and NK62 introducing an engineered MCS at the 5 end and a Hind III restriction site at 3 end. The fragments were fused with primers NK61 and NK64 and inserted into HindIII site of pup6, resulting in pla. The aminoglycoside- 3 adenyltransferase (aada) gene, encoding for a streptomycin / spectinomycin adenylyltransferase was amplified from R100.1 plasmid with primers NK 59 and NK 60 and

2 cloned into a unique SacI site in the MCS of pla, resulting in plas. P pile was amplified using NK23 and NK46 generating a FseI restriction site. mcherry was amplified from psp64 (Promega) with NK19 and NK51 generating a PacI restriction site. The PCR fusion between P pile and mcherry, amplified with NK46 and NK51, was inserted between FseI and PacI sites of plas resulting in plas::p pile mcherry. This plasmid was used to introduce the mcherry adda alleles into the iga locus of strain MS11, generating strain K-Ng-315. Direct DNA sequencing of PCR products derived from gonococcal transformants was performed by GATC Biotech AG (Konstanz, Germany) to verify the insertions and the absence of any other alterations. To verify that strain 1 and strain 2 grow at comparable rate the optical density of bacterial solutions was measured as a function of time at 37 C by spectrophotometric measurements at 600 nm using a microplate reader (Infinite 200 PRO, Tecan Group Ltd., Switzerland). A suspension of cells from an overnight culture in GC broth supplemented with 1% IsoVitaleX was incubated on 48-wells microtiter plate for 20 h at 37 C in atmosphere, containing 5% CO2 under constant shaking at 250 rpm. The absorbance of suspension at 600 nm was measured every hour in at least three independent experiments. The growth curves of strain 1 and strain 2 were comparable to each other and to the wt (Fig. S1). Since gonococci are prone to form microcolonies that potentially affect the read-out of the photo-spectrometer, an additional control experiment was performed. We inoculated both strains onto agar plates (see Materials & Methods for composition). Single cells founded microcolonies and we measured the radii of the colonies as a function of time (Fig. S1b). After ~ 2.5 h, the microcolonies had a well-defined contour and the radius could be measured. Growth was exponential for ~ 10 h. Fig. S1b shows that the growth rates of strains 1 and 2 are comparable. We assessed the stability of GFP and mcherry fluorescence. Fluorescent strains were inoculated onto agar plates and grown overnight. Piliated colonies were then streaked, resuspended in GC

3 medium, and diluted An aliquot of 10 µl of dilution was spread onto an agar plate and incubated with 5% CO 2 at 37 C. After 24h the number of colonies that expressed GFP or mcherry over non-fluorescent colonies (~200 colonies per each plate) was determined with an inverted epi-fluorescence microscope (Nikon Ti-E, Japan) using a 2x/0.1 air objective (Nikon). After counting, a new plate was inoculated with an aliquot of all previous day's bacteria collected and diluted in GC medium. This procedure was repeated for 2 days. The strains maintained their fluorescence over three passages. None of the > 150 colonies analysed per strain and day was non-fluorescent. As an additional control (and to increase the number of cells analysed) strain 1 and strain 2 were inoculated onto agar plates at low density. After three days of growth, the colonies were imaged. Fig. S2b shows an example of two colonies formed by strain 2. The fluorescence intensity was homogeneous. The increased intensity at the center of the colony can be explained by the fact that gonococci grow vertically at the center. This image shows a rare example of loss of fluorescence. The arrow indicates a black sector. We attribute this sector to a single bacterium that has lost the ability to fluoresce. Its offspring formed a sector while the colony expanded. Importantly, the angle of the sector does not increase as a function of time, indicating that the loss of fluorescence is not associated with a growth advantage. Even if once in a while a bacterium loses fluorescence, it is unlikely to dominate the population. We imaged 17 colonies of strain 2 and for two colonies we found a single black sector. Furthermore, 8 colonies of strain 1 were imaged and no black sector was found. Finally, cells were picked from the edges of 3 days-old colonies. Expression of gfp and mcherry was confirmed at the single cell level by fluorescence microscopy (TE2000, Nikon). We conclude that expression of gfp and mcherry is very stable. MS11 ΔrecA was generated by incubating chromosomal DNA from N400 (6) with MS11 and selecting for tetracycline resistance.

4 The construction of the IPTG-inducible P lac gfp (K-Ng-330) strain is described in the following. The gfp fragment which contained overhangs with restriction sites for PacI and FseI was amplified from the pam239, using primers NK65 and NK66. This fragment was restricted with PacI and FseI and ligated to the PacI/FseI-digested pgcc4 vector behind an IPTG-inducible P lac promoter. gfp-expressing bacteria were selected on GC agar, containing 2.5 µg/ml erythromycin. Biofilm growth under continuous DNase treatment. For DNase I treatment of biofilms, the flow system was constantly supplied by DNase I (Fermentas) in the medium by the peristaltic flow with a concentration of 10 U / ml. DNase I was added to the flow system at the time of biofilm inoculation (0 5h) and between 5-22 h of growth, respectively. Untreated biofilms were used as a control. Microscopy and image analysis. Biofilms were visualized by using a Confocal Laser Scanning Microscope (Nikon Ti-E C1, Japan). Images were obtained using a 60 /1.3 water objective (Nikon) (pinhole size of 60 µm). Dual fluorescence emission was observed using an argon-ion laser with 488 nm for green fluorescent protein and a 543-nm filter of HeNe laser for mcherry and propidium iodide fluorescence. To avoid cross-talk between two color channels, images were acquired sequentially, each with only corresponding laser. From each fluidic channel five to six image stacks were acquired randomly down through the channel. Quantitative analysis of each z series was performed using COMSTAT computer program (Heydorn et al., 2000). Student t tests were used to compare the biomasses and roughness coefficients and determine the statistical significance of these differences which we considered significant if p < D visualisation of image stacks and image merging was done using ImageJ.

5 edna staining of the biofilms. edna staining within biofilms were performed using propidium iodide (Fluka). A 0.1 mm stock solution of propidium iodide in water was diluted to a concentration of 3 µm in GC-medium, diluted 1:10 in phosphate-buffered saline (PBS), ph 7.4 and injected into the flow cell. After 10 min of staining the flow was continued for an additional 15 min before the chambers were viewed using confocal microscopy. Determination of transformation rate in planktonic cells. Strains were grown for h on GC plates, resuspended in GC-medium, diluted 1:10 in phosphate-buffered saline (PBS), and supplemented with 1% IsoVitaleX, 1mM MgCl 2, 5mM sodium bicarbonate. Cells were diluted to an optical density (OD) of 0.1 at 600 nm. 5 μg of chromosomal DNA from strain 1 was added to the 500 μl of the cell suspension of strain 2 and vice versa. The cells with the DNA were incubated in the shaker ( r.p.m.) at 37 C for 1 h. Subsequently, 10U/ml of DNase I (ThermoScientific) were added to the transformation medium and cells were incubated for 15 min. Cell suspension was serially diluted 10-fold in transformation medium and 50 μl of each dilution were plated on non-selective GC agar plates and on GC agar plates, containing 2.5 µg/ml erythromycin and 100 µg/ml spectinomycin. The transformation efficiency was defined as the number of resistant colonies normalized by the number of colonies on non-selective plates. Since the generation time is roughly 1 h, we obtain the transformation rate in units of [events cell -1 generation -1 ]. Determination of gene transfer efficiency in planktonic cells. For determination of the gene transfer efficiency rate in planktonic cells without excess of DNA the cell suspension was pelleted by spinning at 5000g for 2 min and re-suspended with GC-PBS medium three times to remove traces of DNA. An aliquot of two hundred fifty microlitres of each culture (strain 1 and

6 strain 2) with an optical density at 600 nm (OD 600 ) of 0.1 were mixed and incubated in the shaker ( r.p.m.) at 37 C for 5h. Sequencing of the variable regions of the major pilin pile. We intended to assess whether pilin antigenic variation occurred in biofilms and to verify that antigenic variation is suppressed in the avd background. To this end, bacteria were grown on agar plates overnight. 4 5 colonies of the inoculated population were picked for sequencing of the inoculated population. The biofilm was grown for two days. From this biofilm, bacteria were grown overnight on an agar plate and 29 colonies were picked for sequencing. For sequencing, PILRBS and SP3A primers were used following Criss et al (2). The five clones from the wt (strain 1) inoculate showed no difference in the hypervariable regions and few single amino acid differences in the semivariable region. The clones extracted from the two days old biofilm showed three different variants of the hypervariable loop. Their sequence was in agreement with different silent pilins, confirming that they were caused by antigenic variation. Furthermore, most of the sequenced clones showed variations in the hypervariable tail when compared to the inoculum. All four clones sequenced from the inoculum of the antigenic variation deficient strain (avd) showed the same sequence. The clones picked from the two days old biofilm showed no variations in the hypervariable regions, confirming that antigenic variation was suppressed in the avd background.

7 Supporting tables Strain Relevant genotype Source/Reference MS11 wild type MS11 reca reca6ind(tetm) (6), (4), This study VD300 wild type (opa- selected) VD300 avd Tn5(kan R ); G12A in G4 motive of pile (1) K-Ng-303* iga1::ppile gfpmut3 ermc This study K-Ng-315** aspc:mcherry aada:lctp This study K-Ng-316 reca6ind(tetm); iga1::ppile gfpmut3 ermc This study K-Ng-317 reca6ind(tetm); aspc:mcherry aada:lctp This study K-Ng-326 K-Ng-327 Tn5(kan R ) G12A in G4 motive of pile; iga1::ppile gfpmut3 ermc Tn5(kan R ) G12A in G4 motive of pile; aspc:mcherry aada:lctp This study This study K-Ng-330 reca6ind(tetm); aspc:p lac gfpmut3 laci ermc:lctp This study * strain 1, ** strain 2 Table S1. Bacterial strains used in this study.

8 Primers Sequence 5 3 NK83 NK135 NK134 NK133 NK19 NK23 NK46 NK51 NK60 NK61 NK62 NK63 NK64 NK65 NK66 PILRBS SP3A TTGAGTCTTCCGACCCAATCAACACACCCGATAC AGTTCTTCTCCTTTACGCATAAAATTACTCCTAATTGAAAGGG TTTCAATTAGGAGTAATTTTATGCGTAAAGGAGAAGAACTTTTCAC TTGAGCTCCTATTTGTATAGTTCATCCATGCC TTAGGAGTAATTTTATGGTGAGCAAGGG TCGCCCTTGCTCACCATAAAATTACTC CATTGGCCGGCCTTCCGACCCAATCAACACACC CATTAATTAATTACTTGTACAGCTCGTCCATGCC TTCGGTCTCCACGCATCGTCAG TTTAAGCTTATGGCACTTTTCCTCAGCATATTCCC GAGCTCTTAATTAAATGCATGGCCGGCCCTAGAGGAAGAAAATCATTGCCGCGAC GGCCGGCCATGCATTTAATTAAGAGCTCATGTTCTTCAAGCACATCGAAGCC TTTAAGCTTTTACAAGACTTTCACGATGCTTTCGC TTTTAATTAAATGCGTAAAGGAGAAGAACT TTTCACTGG GTAAGGCCGGCCCTATTTGTATAGTTCATCCATGCCATGTGTAATC GGCATTTCCCCTTTCAATTAGGAG CCGGAACGGACGACCCCG Table S2. Primers used in this study.

9 Supporting figures Fig. S1 Growth rates of strain 1 and strain 2 are equal. a) Optical density of gonococci grown in liquid medium. Black: wt, green: strain 1 (iga1::gfp ermc), red: strain2 (lctp:mcherry aada:aspc). Error bars: standard deviation of 3 independent experiments. b) The radii of microcolonies arising from a single bacterium on an agar plate are shown. Each line represents the growth curve of a single microcolony. Green: strain 1, red: strain 2. (N = 12 for each strain).

10 Fig. S2 Stability of gfp and mcherry expression. a) Number of colony forming units after 1-3 passages. Green: green fluorescent colonies of strain 1, black: non-fluorescent colonies of strain 1, red: red fluorescent colonies of strain 2, grey: non-fluorescent colonies of strain 2. b) Single non-piliated gonococci were inoculated onto an agar plate and grown for three days. Subsequently, colonies were imaged. Since the colony has the highest vertical extension at the center, the central fluorescence intensity is higher than at the front of an expanding colony. The arrow indicates a sector formed by gonococci that do not fluoresce. Scale bar: 100 µm.

11 Fig. S3 Transformation rates of planktonic cells. Cells were incubated with gdna from the complementary strain for 1h, treated with DNase, and plated on double-selective plates. Strain 1 (iga1::gfp ermc), strain2 (lctp:mcherry aada:aspc), avd: antigenic variation deficient. Antibiotics: 2.5 µg/ml erythromycin and 100 µg/ml spectinomycin. Fig. S4 Early biofilm formation. Strain 1 and strain 2 were inoculated at equal density. Scale bar 10 µm. t = 20 min

12 Fig. S5 DNase treatment inhibits gene transfer in biofilm. a) Biomass and b) roughness coefficient of a gonococcal biofilm with and without continuous DNase treatment.

13 Fig. S6 Sequences of variable regions of pile. Individual clones from the inoculated gonococci (1in 5in, blue letters) and from the 46 h biofilm (1-29) were picked and pile was sequenced. Only variable regions of pile are shown. a) Strain 1 (iga1::ppile gfp ermc) and b) avd strain

14 (Tn5(kan R ) G12A in G4 motive of pile; iga1::ppile gfp ermc). Amino acid changes are indicated in red letters. (*) conserved sequence, (:) conservative mutations, (.) semi-conservative mutations, () non-conservative mutations. SV: semi-variable region, HV L : hypervariable loop, HV T : hypervariable tail. Fig. S7 Mixed biofilms of strain 1 (green) and strain 2 (red) were grown for 24h. Subsequently, erythromycin and spectinomycin were applied. Confocal stacks were acquired 68h after application of antibiotics (92h total) was started. Transformants iga::gfp ermc lctp:mcherry aada:aspc have yellow appearance on the images. Merged green and red channel of a) wt and b) non-transformable reca ind.

15 Fig. S8 Control for induction with IPTG using a P lac gfp (K-Ng-330) strain. Biofilm growth for 5 h in the a) absence and b) presence of IPTG. Upper lanes: brightfield image, lower lanes: fluorescence images. Contrast settings are equal for a) and b). Scale bar: 20 µm.

16 Fig. S9 Pattern of induction of gfp expression by the P lac gfp (K-Ng-330) strain in late biofilms. a) Continuous induction with IPTG for 44 h. b) 22 h of growth in the absence of IPTG and subsequent induction for 22 h with IPTG. Contrast settings are equal for a) and b). Scale bar: 20 µm. 1. Cahoon, L. A., and H. S. Seifert An alternative DNA structure is necessary for pilin antigenic variation in Neisseria gonorrhoeae. Science 325: Criss, A. K., K. A. Kline, and H. S. Seifert The frequency and rate of pilin antigenic variation in Neisseria gonorrhoeae. Mol Microbiol 58: Mehr, I. J., and H. S. Seifert Random shuttle mutagenesis: gonococcal mutants deficient in pilin antigenic variation. Molecular microbiology 23: Seifert, H. S Insertionally inactivated and inducible reca alleles for use in Neisseria. Gene 188: Solomon, J. M., A. Rupper, J. A. Cardelli, and R. R. Isberg Intracellular growth of Legionella pneumophila in Dictyostelium discoideum, a system for genetic analysis of host-pathogen interactions. Infection and immunity 68: Tonjum, T., N. E. Freitag, E. Namork, and M. Koomey Identification and characterization of pilg, a highly conserved pilus-assembly gene in pathogenic Neisseria. Molecular microbiology 16: Wolfgang, M., J. P. van Putten, S. F. Hayes, D. Dorward, and M. Koomey Components and dynamics of fiber formation define a ubiquitous biogenesis pathway for bacterial pili. Embo J 19:

17