Meet the Family: The BioMark HD System. One system. One to 36,000 reactions in a day. No compromises.

Size: px
Start display at page:

Download "Meet the Family: The BioMark HD System. One system. One to 36,000 reactions in a day. No compromises."

Transcription

1 Meet the Family: The BioMark HD System One system. One to 36,000 reactions in a day. No compromises.

2 The BioMark HD Family: Scale Your Studies Without Compromising Data Quality Tired of sacrificing data quality, suffering through cumbersome workflows, or even switching PCR blocks to scale your genotyping and gene expression studies? With the BioMark HD System and its family of IFCs (integrated fluidic circuits), you get high sample throughput, ultra-high data quality, assay flexibility, and an easy workflow everything you need in one solution. That s one simple system to develop, validate, and deploy your gene expression or SNP genotyping panel. Go from dozens to thousands of samples and targets per day and skip the re-optimization and other headaches. Target Discovery Target Selection Target Validation Pilot Screening Routine Testing FLEXsix IFC IFC IFC IFC Select targets, then optimize assays with the ultra-configurable FLEXsix IFC and the economical IFC Validate and pilot screen assays through thousands of samples in just days Cost-effectively deploy a gene expression or SNP genotyping panel with minimal labor Number of Samples Increasing 2

3 Ultimate Flexibility The FLEXsix IFC The FLEXsix IFC has six 12-assay-by-12-sample partitions that can each be run separately or together. Run each partition independently as separate experiments or run multiple partitions simultaneously. Run different combinations of 12 to 72 assays or 12 to 72 samples per experiment (See table 2 below.). Use the first partition on day 1 and take up to 90 days to use the other five, with no loss in performance. Run fewer samples more often no more waiting to collect enough samples. Move low-throughput work from plates to the FLEXsix IFC and never have to re-optimize when scaling up. 144 reaction chambers/partition 6 partitions per IFC 12 assay per partition 12 sample per partition Table 1 IFC Type Assay Inlets 6 x 12 Sample Inlets 6 x 12 Reaction Chambers 864 Reaction Volume IFC Controller Compatibility FLEXsix IFC 8.9 nl HX IFC Controller FLEXsix IFC Table 2 FLEXsix IFC Example Sample/Assay Combinations Samples Assays Partitions Used

4 The Workhorses The and IFCs These IFCs allow you to radically reduce hands-on time and total time to results while increasing the data accuracy of your gene expression or SNP genotyping studies. 9,216 total reaction chambers 96 sample 96 assay You get great data reliability and the microfluidic architecture does the heavy lifting, combining samples and assays into 2,304 or 9,216 parallel PCR reactions. That s up to 24 times what you get with a 384-well plate, and it only takes 15 minutes of hands-on time. IFC Type IFC IFC Assay Inlets Sample Inlets Reaction 2,304 9,216 Chambers Reaction Volume 10.1 nl 6.7 nl IFC Controller Compatibility MX IFC Controller HX IFC Controller 2,304 reaction chambers IFC 48 assay 48 sample IFC 4

5 Unmatched Speed and Throughput The IFC The IFC is the easiest and fastest tool for high-throughput routine screening. Stop wasting time (and plastics) and start collecting data. 4,608 reaction chambers Quickly screen more than 2,000 samples per day for any assay panel of up to 24 targets. With a single run, produce 4,608 data points in as little as one hour with only 15 minutes of hands-on time. Generate 50,688 data points the equivalent of well plates in a single 8-hour day without compromising data quality. 24 assay 192 sample IFC Type IFC Assay Inlets 24 Sample Inlets 192 Reaction Chambers 4,608 Reaction Volume 8nl IFC Controller RX IFC Controller Compatibility IFC 5

6 The Complete Family The BioMark HD System The BioMark HD System is the only multi-purpose real-time PCR system that performs genotyping, gene expression profiling, quantitative real-time digital PCR (qdpcr), and single-cell analysis. It includes everything you need to produce high-quality data including the analysis software so you can make sense of your results. Save time and money run more than 9,000 experiments in four hours and generate as many as 36,000 data points with one person in a single day Analyze RNA, mirna, DNA, and proteins Use multiple assay chemistries and different sample/assay configurations Use real-time PCR to qualify and quantitate samples prior to next-generation sequencing Easily manage, annotate, and archive results 6

7 Ordering Information Gene Expression Products Product Product Description Part Number IFC Packs Single GE IFC Ten GE IFCs and Ten Control Line Fluid Syringes FLEXsix Gene Expression IFC Dynamic Array Chip for Gene Expression BMK-M Dynamic Array Chip for Gene Expression BMK-M Reagent Kits GE DELTAgene Sample and Assay Reagent Kit 1 IFC GE DELTAgene Sample and Assay Reagent Kit 10 IFCs GE Sample and Assay Reagent Kit 1 IFC GE Sample and Assay Reagent Kit 10 IFCs FLEXsix Gene Expression Reagent Kit 5 IFCs FLEXsix DELTAgene Gene Expression Reagent Kit 5 IFCs GE Dynamic Array Sample & Assay Loading Reagent Kit - 10 Chips GE Dynamic Array Sample & Assay Loading Reagent Kit - 40 Chips GE Dynamic Array DNA Binding Dye Sample & Assay Loading Reagent Kit- 10 chips GE Dynamic Array Sample & Assay Loading Reagent Kit - 10 Chips GE Dynamic Array Sample & Assay Loading Reagent Kit - 40 Chips GE Dynamic Array DNA Binding Dye Sample & Assay Loading Reagent Kit- 10 chips IFC and Reagent Kit Bundles GE DELTAgene Kit - 10 IFC GE Kit - 10 IFC FLEXsix Gene Expression Kit 5 IFCs FLEXsix DELTAgene Gene Expression Kit 5 IFCs Sample/Loading Kit - 10 Chip Package BMK-M DNA Binding Dye Sample/Loading Kit - 10 Chip Package BMK-M EG Sample/Loading Kit - 10 Chip Package BMK-M DNA Binding Dye Sample/Loading Kit - 10 Chip Package BMK-M EG Reagents PreAmp Master Mix - 1 Tube PreAmp Master Mix - 5 Tubes Reverse Transcription Master Mix - 1 Tube Reverse Transcription Master Mix - 5 Tubes Pre Amp and Reverse Transcription Master Mix - 1 Tube each Pre Amp and Reverse Transcription Master Mix - 5 Tubes each Assays DELTAgene Assays (wet tested) ASY-GE-WET DELTAgene Assays Control Line Fluid Control Line Fluid Kit ASY-GE Control Line Fluid Kit Control Line Fluid Kit

8 Ordering Information Genotyping Products Product Product Description Part Number IFC Packs Dynamic Array IFC for SNP Genotyping BMK-M GT FLEXsix Genotyping IFC Dynamic Array Chip for Genotyping BMK-M-48.48GT Dynamic Array Chip for Genotyping BMK-M-96.96GT Dynamic Array Chip for Genotyping Multipack Dynamic Array Chip for Genotyping Multipack High Precision Genotyping IFC High Precision Genotyping IFC Multipack High Precision Genotyping IFC Multipack FR48.48 Dynamic Array IFC BMK-M-FR48.48 Reagent Kits GT Dynamic Array Sample & Assay Loading Reagent Kit - 10 Chips SNPtype Genotyping Reagent Kit (192.24) FLEXsix Fast Genotyping Reagent Kit 5 IFCs FLEXsix Genotyping Reagent Kit 5 IFCs FLEXsix SNPtype Genotyping Reagent Kit 5 IFCs GT Dynamic Array Sample & Assay Loading Reagent Kit - 10 Chips GT Dynamic Array Sample & Assay Loading Reagent Kit - 40 Chips SNPtype Genotyping Reagent Kit (48.48) GT Dynamic Array Sample & Assay Loading Reagent Kit - 10 Chips GT Dynamic Array Sample & Assay Loading Reagent Kit - 40 Chips SNPtype Genotyping Reagent Kit (96.96) FR Sample/Loading Kit - 25 Chip Package FR Sample/Loading Kit - 5 Chip Package BMK-M25-FR48.48 BMK-M5-FR48.48 IFC and Reagent Kit Bundles GT + Sample/Loading Kit - 10 Chip Package BMK-M GT GT + Sample/Loading + SNPtype Reagents Kit - 10 Chip Package FLEXsix Fast Genotyping Kit 5 IFCs FLEXsix SNPtype Genotyping Kit 5 IFCs FLEXsix Genotyping Kit 5 IFCs GT + Sample/Loading Kit - 10 Chip Package BMK-M GT GT + Sample/Loading + SNPtype Reagents Kit - 10 Chip Package GT + Sample/Loading Kit - 10 Chip Package BMK-M GT GT + Sample/Loading + SNPtype Reagents Kit - 10 Chip Package BMK-M GT-SNP Reagents Bulk 20X GT Sample Loading Reagent, 25mL Bulk 2X Assay Loading Reagent, 25mL

9 Ordering Information Genotyping Products (continued) Product Product Description Part Number Reagents (continued) 20X Fast GT Sample Loading Reagent - 5 Tubes X GT Sample Loading Reagent - 5 Tubes X SNPtype Sample Loading Reagent - 5 Tubes X Assay Loading Reagent - 5 Tubes X SNPtype Reagent - 5 Tubes Assays SNPtrace Panel SNPtype Assay (Large) SNPtype Assay (Medium) SNPtype Assay (Small) ASY-GT-L ASY-GT-M ASY-GT-S Control Line Fluid Control Line Fluid Kit Control Line Fluid Kit - dynamic (48.48 only)/digital/access Control Line Fluid Kit

10 2014 Fluidigm Corporation. All rights reserved. Fluidigm, the Fluidigm logo, BioMark, DELTAgene, FLEXsix and SNPtype are trademarks or registered trademarks of Fluidigm Corporation in the U.S. and/or other countries. All other trademarks are the property of their respective owners. Fluidigm recommends that you only purchase licensed PCR assay reagents from authorized sources. For Research Use Only. Not for use in diagnostic procedures. Corporate Headquarters 7000 Shoreline Court, Suite 100 South San Francisco, CA USA Toll-free: FLUIDLINE Fax: Sales North America Europe/EMEA info-europe@fluidigm.com Japan info-japan@fluidigm.com China (including Hong Kong) info-china@fluidigm.com Asia info-asia@fluidigm.com Latin America info-latinamerica@fluidigm.com

11

Gene Expression on the Fluidigm BioMark HD

Gene Expression on the Fluidigm BioMark HD Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental

More information

Real-Time PCR Analysis

Real-Time PCR Analysis PN 68000088 L1 USER GUIDE Real-Time PCR Analysis For Research Use Only. Not for use in diagnostic procedures. Information in this publication is subject to change without notice. It is Fluidigm policy

More information

Using the C 1 Single-Cell Auto Prep System to Capture Cells from Cell Culture and Perform Preamplification Using TaqMan Assays.

Using the C 1 Single-Cell Auto Prep System to Capture Cells from Cell Culture and Perform Preamplification Using TaqMan Assays. Using the C 1 Single-Cell Auto Prep System to Capture Cells from Cell Culture and Perform Preamplification Using TaqMan Assays PN 100-6117 A1 Contents Introduction...........................................................2

More information

PCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System

PCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System PCR SYSTEMS a new era in high-productivity qpcr Applied Biosystems ViiA 7 Real-Time PCR System a new era in high-productivity qpcr The ViiA 7 Real-Time PCR System delivers the proven reliability, sensitivity,

More information

MicroRNA Profiling with TaqMan OpenArray Plates

MicroRNA Profiling with TaqMan OpenArray Plates MicroRNA Profiling with TaqMan OpenArray Plates 1 12/4/2012 Profiling with TaqMan MicroRNA Assays Highly Parallel Assays For mirna Expression Analysis Megaplex Primer Pools TaqMan OpenArray mirna Panel

More information

Same TaqMan Assay quality, new format

Same TaqMan Assay quality, new format Product Bulletin TaqMan Array Plates TaqMan Array Plates TaqMan Gene Expression Assays delivered in ready-to-use 96-well Custom Array Plates or predefined Gene Signature Plates Flexible choose from customizable

More information

scgem Workflow Experimental Design Single cell DNA methylation primer design

scgem Workflow Experimental Design Single cell DNA methylation primer design scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease

More information

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400

More information

Product Catalog # Description List Price (JPY) Primer Assays (desalted)

Product Catalog # Description List Price (JPY) Primer Assays (desalted) Assays and Controls Primer Assay Pricing Primer Assays (desalted) 10025636 Primer assay desalted, 200 reactions 16,000 (Wet-lab validated human, mouse, and rat) 10025637 Primer assay desalted, 1,000 reactions

More information

QuantStudio 3D Digital PCR System

QuantStudio 3D Digital PCR System PRODUCT BULLETIN QuantStudio 3D Digital PCR System QuantStudio 3D Digital PCR System Absolutely attainable digital PCR Simple chip-based workflow no emulsion PCR Affordable low total cost of ownership

More information

USER GUIDE. Real-Time PCR

USER GUIDE. Real-Time PCR m ig id Fl u C n. at io or or p Al s ht ig lr. ed rv se re USER GUIDE Real-Time PCR Limited License and Disclaimer for Fluidigm Systems with Fluidigm IFCs Except as expressly set forth herein, no right

More information

Expression Array System

Expression Array System Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

MassARRAY System MASSARRAY SYSTEM ACCELERATING RESEARCH

MassARRAY System MASSARRAY SYSTEM ACCELERATING RESEARCH SENSITIVITY ACCELERATING RESEARCH SPEED SPECIFICITY ACCURACY No compromise MASSARRAY SYSTEM Genotyping Somatic mutation profiling Methylation analysis Quantitative gene expression and copy number variant

More information

Real-Time PCR Validations

Real-Time PCR Validations Real-Time PCR Validations Relative gene expression Example experiment: I have 2 samples: untreated and treated. Question: What happens to the expression of gene X when I treat the cells? Answer: Expressed

More information

TaqMan Advanced mirna Assays

TaqMan Advanced mirna Assays PRODUCT BULLETIN TaqMan Advanced mirna Assays TaqMan Advanced mirna Assays Key features Universal reverse transcription (RT) one RT step for all Applied Biosystems TaqMan Advanced mirna Assays Sensitive

More information

TaqPath ProAmp Master Mixes

TaqPath ProAmp Master Mixes PRODUCT BULLETIN es es Applied Biosystems TaqPath ProAmp Master Mixes are versatile master mixes developed for high-throughput genotyping and copy number variation (CNV) analysis protocols that require

More information

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping

More information

Agilent s Mx3000P and Mx3005P

Agilent s Mx3000P and Mx3005P Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded

More information

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible)

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible) NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents

More information

Relative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)

Relative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA) The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5

More information

Applied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems

Applied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems PRODUCT BROCHURE Real-Time PCR Systems Applied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems Real Fast. Real Versatile. Real Value. Real choices from the leader in real-time PCR. The latest

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell

More information

SmartSpec Plus spectrophotometer

SmartSpec Plus spectrophotometer SmartSpec Plus spectrophotometer Simply Brilliant. The SmartSpec Plus has a more complete range of features and functions than many other benchtop spectrophotometers. It s a complete quantitation package

More information

PERFORMANCE MADE EASY REAL-TIME PCR

PERFORMANCE MADE EASY REAL-TIME PCR PERFORMANCE MADE EASY REAL-TIME PCR The MyGo Pro real-time PCR instrument provides unmatched performance in a convenient format. Novel Full Spectrum Optics deliver 120 optical channels of fluorescence

More information

Introducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Fast Real-Time PCR System

Introducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Fast Real-Time PCR System 7300/7500 Real-Time PCR Systems Introducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Real-Time PCR System Applied Biosystems 7500 Fast Real-Time

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE)

GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) TriMark Publications April 2007 Volume: TMRGER07-0401 GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) Trends, Industry Participants, Product Overviews and Market Drivers TABLE OF CONTENTS

More information

Introduction To Real-Time Quantitative PCR (qpcr)

Introduction To Real-Time Quantitative PCR (qpcr) Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular

More information

Applied Biosystems TaqMan Array Microfluidic Cards

Applied Biosystems TaqMan Array Microfluidic Cards Performing Rapid Cycling Gene Quantitation on TaqMan Array Microfluidic Cards Applied Biosystems TaqMan Array Microfluidic Cards User Bulletin JULY 2010 SUBJECT: In this user bulletin Performing Rapid

More information

Pyrosequencing. Alix Groom

Pyrosequencing. Alix Groom Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases

More information

Maxwell RSC System. Next Generation Automated Purification and Quantitation

Maxwell RSC System. Next Generation Automated Purification and Quantitation Maxwell RSC System Next Generation Automated Purification and Quantitation INTRODUCTION/OVERVIEW The Maxwell RSC System Your personal purification assistant. It easily integrates into any laboratory workflow,

More information

Instructions for Use. RealStar Lassa Virus RT-PCR Kit /2017 EN

Instructions for Use. RealStar Lassa Virus RT-PCR Kit /2017 EN Instructions for Use RealStar Lassa Virus RT-PCR Kit 1.0 04/2017 EN RealStar Lassa Virus RT-PCR Kit 1.0 For research use only! (RUO) 641003 INS-641000-EN-S01 96 04 2017 altona Diagnostics GmbH Mörkenstr.

More information

Efficient qpcr Setup Without Cross Contamination Using the epmotion Family of Automated Liquid Handling Systems

Efficient qpcr Setup Without Cross Contamination Using the epmotion Family of Automated Liquid Handling Systems APPLICATION NOTE No. 368 I July 2016 Efficient qpcr Setup Without Cross Contamination Using the epmotion Family of Automated Liquid Handling Systems Eric Gancarek¹, Blandine Vanbellinghen¹, Sandrine Hamels¹,

More information

Precision MULTIPLEX qpcr Master Mix. Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR

Precision MULTIPLEX qpcr Master Mix. Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR Precision MULTIPLEX qpcr Master Mix Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents

More information

LiquidBiopsy LIQUIDBIOPSY. Automated Rare Template Isolation Platform

LiquidBiopsy LIQUIDBIOPSY. Automated Rare Template Isolation Platform LiquidBiopsy LIQUIDBIOPSY Automated Rare Template Isolation Platform Enabling cancer research with highly multiplexed molecular analysis of serially collected blood samples The LiquidBiopsy Platform simplifies

More information

ab Plant Chromatin Extraction Kit

ab Plant Chromatin Extraction Kit ab156906 Plant Chromatin Extraction Kit Instructions for Use For isolating chromatin or DNA-protein complex from plants in a simple and rapid format This product is for research use only and is not intended

More information

Precision PLUS OneStep qrt-pcr Master Mix. Instructions for use of Primerdesign Precision PLUS OneStep Master Mix for real-time RT-PCR

Precision PLUS OneStep qrt-pcr Master Mix. Instructions for use of Primerdesign Precision PLUS OneStep Master Mix for real-time RT-PCR Precision PLUS OneStep qrt-pcr Master Mix Instructions for use of Primerdesign Precision PLUS OneStep Master Mix for real-time RT-PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products

More information

EarlyTox Cell Integrity Kit

EarlyTox Cell Integrity Kit EarlyTox Cell Integrity Kit The EarlyTox Cell Integrity Kit from Molecular Devices is an optimized set of reagents that simplifies the measurement of live and dead cells in a single well. The assay uses

More information

Data Sheet. GeneChip Human Genome U133 Arrays

Data Sheet. GeneChip Human Genome U133 Arrays GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array

More information

NEBNext Multiplex Oligos for Illumina (Index Primers Set 2)

NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) LIBRARY PREPARATION NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) Instruction Manual NEB #E7500S/L 24/96 reactions Version 4.0 1/18 be INSPIRED drive DISCOVERY stay GENUINE This product is

More information

UF Center for Pharmacogenomics. Explanation of Services. UF Center for Pharmacogenomics Services

UF Center for Pharmacogenomics. Explanation of Services. UF Center for Pharmacogenomics Services UF Center for Pharmacogenomics Explanation of Services Services are provided either as a price per sample or price per project, depending on the specific needs of the researcher. Basic a la carte services,

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

All your genetic analyses on a single instrument

All your genetic analyses on a single instrument GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All your genetic analyses on a single instrument GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All on a single instrument Perform your genetic assays on one instrument A

More information

IDEAL TM Spike-In RNA Kit. Individual Assays Principle, Workflow and Protocol

IDEAL TM Spike-In RNA Kit. Individual Assays Principle, Workflow and Protocol IDEAL TM Spike-In RNA Kit Individual Assays Principle, Workflow and Protocol Table of Contents Content Page Working Principle 3 Kit Contents & Storage 4 Additional Equipment and Compatibility 5 Workflow

More information

SPRIworks Systems. Push button. Walk away. Fully automated library construction systems with built-in size selection and cleanup BR-15981B

SPRIworks Systems. Push button. Walk away. Fully automated library construction systems with built-in size selection and cleanup BR-15981B SPRIworks Systems Fully automated library construction systems with built-in size selection and cleanup Push button. Walk away. BR-15981B SPRIworks Technology Fully automated fragment library construction

More information

High-throughput scale. Desktop simplicity.

High-throughput scale. Desktop simplicity. High-throughput scale. Desktop simplicity. NextSeq 500 System. Flexible power. Speed and simplicity for whole-genome, exome, and transcriptome sequencing. Harness the power of next-generation sequencing.

More information

NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module

NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module SAMPLE PREPARATION NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module Instruction Manual NEB #E6111S/L 20/100 reactions Version 2.0 1/17 be INSPIRED drive DISCOVERY stay GENUINE This product

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

HiSeqTM 2000 Sequencing System

HiSeqTM 2000 Sequencing System IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance

More information

Data Quality Worth Sharing

Data Quality Worth Sharing Product Bulletin Human Identification AmpFlSTR NGM and NGM SElect PCR Amplification Kits Next generation amplification chemistries including the 5 new loci from the expanded European Standard Set Enhanced

More information

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay -PLEX Immunogenicity Assay Application Note 1 Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay The use of biotherapeutics, biosimilars, and combination biotherapies

More information

ab Cell Viability Assay Kit Fluorometric Dual Green/Red

ab Cell Viability Assay Kit Fluorometric Dual Green/Red ab112121 Cell Viability Assay Kit Fluorometric Dual Green/Red Instructions for Use For detecting cell viability in suspension and adherent cells by using dual proprietary green and red fluorescence probes.

More information

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane

More information

Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL

Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That

More information

QIAGEN Supplementary Protocol

QIAGEN Supplementary Protocol QIAGEN Supplementary Protocol PCR and data analysis using the cador T. equigenitalis PCR Kit on Rotor-Gene Q instruments This protocol is designed for using the cador T. equigenitalis PCR Kit for detection

More information

Introduction. Lance Martin, BIOFAB Operations

Introduction. Lance Martin, BIOFAB Operations Introduction Lance Martin, BIOFAB Operations Several capacities needed to support EOU engineering Design Libraries Feature 1 Variants Feature 2 Variants Assemble Clone Assay Analyze Feature 1 Feature 2

More information

QIAcube Pure Efficiency

QIAcube Pure Efficiency QIAcube Pure Efficiency Sample & Assay Technologies Walkaway spin-column processing The QIAcube automates your spin preps The revolutionary QIAcube makes automated sample prep available to all labs. The

More information

For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.

For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida. For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and

More information

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating

More information

ab ChIP Kit Magnetic One-Step

ab ChIP Kit Magnetic One-Step ab156907 ChIP Kit Magnetic One-Step Instructions for Use For selective enrichment of a chromatin fraction containing specific DNA sequences in a high throughput format using chromatin isolated from various

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Custom dye calibration for StepOne and StepOnePlus Real-Time PCR Systems

Custom dye calibration for StepOne and StepOnePlus Real-Time PCR Systems USER BULLETIN Custom dye calibration for StepOne and StepOnePlus Real-Time PCR Systems Publication Number MAN0014609 Revision A This user bulletin is for use with the StepOne and StepOnePlus Real-Time

More information

MetaXpress High-Content Image Acquisition and Analysis Software

MetaXpress High-Content Image Acquisition and Analysis Software High-Content Image Acquisition and Analysis Software BENEFITS Meet high throughput requirements with a scalable, streamlined workflow Adapt your analysis tools to tackle your toughest problems, including

More information

TIME IT S PRIME. chemagic TM Prime TM instrument Streamlined Walk-away Automation. For all Human Sample Materials. Primary Sample Handling

TIME IT S PRIME. chemagic TM Prime TM instrument Streamlined Walk-away Automation. For all Human Sample Materials. Primary Sample Handling IT S PRIME TIME chemagic TM Prime TM instrument Streamlined Walk-away Automation. For all Human Sample Materials. Primary Sample Nucleic Acid Isolation Eluate Quantitation of Extracted Samples Assay Setup

More information

NovoCyte Flow Cytometer

NovoCyte Flow Cytometer NovoCyte Flow Cytometer The Flow Cytometer for Everyone 2 Experience the NovoCyte Advantage Focus on advancing your research. Let the flow cytometer do the rest. NovoCyte Flow Cytometer High Performance

More information

Applied Biosystems Informatics Solutions for the Life Sciences. Jason McGlashan Oracle Life Science User Group Meeting

Applied Biosystems Informatics Solutions for the Life Sciences. Jason McGlashan Oracle Life Science User Group Meeting Applied Biosystems Informatics Solutions for the Life Sciences Jason McGlashan Oracle Life Science User Group Meeting Company Overview 20-year history of fueling life science innovation Instruments and

More information

Touchscreen (standalone capabilities, PIN-protected user accounts, and dye calibration/rnasep functionality)

Touchscreen (standalone capabilities, PIN-protected user accounts, and dye calibration/rnasep functionality) QuantStudio 3 & 5 Real-Time PCR Systems: The Basics Touchscreen (standalone capabilities, PIN-protected user accounts, and dye calibration/rnasep functionality) USB ports Overview of the QuantStudio TM

More information

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing

More information

BenchSmart 96. Semi-automated Pipetting Higher Accuracy, Greater Flexibility

BenchSmart 96. Semi-automated Pipetting Higher Accuracy, Greater Flexibility BenchSmart 96 Semi-automated Pipetting Higher Accuracy, Greater Flexibility For scientists looking to maximize their data quality and research productivity, a new semiautomated approach to 96-well pipetting

More information

Exceed the limit. SensiFAST Real-Time PCR Family. Superior Sensitive Quantification

Exceed the limit. SensiFAST Real-Time PCR Family. Superior Sensitive Quantification Exceed the limit SensiFAST Real-Time PCR Family Superior Sensitive Quantification SensiFAST Real-Time PCR Kits Fast - optimized for fast cycling conditions (under 30 minutes), ideal for high-throughput

More information

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation

More information

Multiplex RT for TaqMan Array Human MicroRNA Panel

Multiplex RT for TaqMan Array Human MicroRNA Panel f Multiplex RT for TaqMan Low Density Array Multiplex RT for TaqMan Array Human MicroRNA Panel Quick Reference Card For safety and biohazard guidelines, refer to the Safety section in the Multiplex RT

More information

Protocol. Path-ID Multiplex One-Step RT-PCR Kit Protocol TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets

Protocol. Path-ID Multiplex One-Step RT-PCR Kit Protocol TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Protocol TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets For Research Use Only. Not for use in diagnostic procedures. Information in this document is subject to change without

More information

ID3EAL Spike-in RNA Kit. Principle, Workflow and Protocol

ID3EAL Spike-in RNA Kit. Principle, Workflow and Protocol ID3EAL Spike-in RNA Kit Principle, Workflow and Protocol Table of Contents Content Page Working Principle 3 Kit Contents & Storage 4 Additional Equipment and Compatibility 5 Additional Equipment and Compatibility

More information

ab Fluo-8 No Wash Calcium Assay Kit

ab Fluo-8 No Wash Calcium Assay Kit ab112129 Fluo-8 No Wash Calcium Assay Kit Instructions for Use For detecting calcium in cells by using our proprietary fluorescence probe. This product is for research use only and is not intended for

More information

Precision FAST qpcr Master Mix. Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR

Precision FAST qpcr Master Mix. Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR Precision FAST qpcr Master Mix Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents and Equipment

More information

High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays

High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science

More information

Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems

Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems Sequencing Application Note March 2012 Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems GS GType TET2/CBL/KRAS and RUNX1 Primer Sets for the GS Junior and GS FLX Systems. Introduction

More information

Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only

Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,

More information

User Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR

User Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR User Manual VisiBlue qpcr mix colorant Version 1.3 September 2012 For use in quantitative real-time PCR VisiBlue qpcr mix colorant Table of contents Background 4 Contents 4 Storage 4 Fluorescence data

More information

BEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION

BEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION BEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION The lab mouse is the most commonly used mammalian model system for genetic research. Scientists from a wide

More information

Protocol. High-throughput Transfection Protocol for GoClone Reporter Assays. Tech support: Luciferase Assay System

Protocol. High-throughput Transfection Protocol for GoClone Reporter Assays. Tech support: Luciferase Assay System Luciferase Assay System Protocol High-throughput Transfection Protocol for GoClone Reporter Assays LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow promoter luciferase Step 1: Simultaneously

More information

Multiplex Assay Design

Multiplex Assay Design Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011 Luminex Multiplexed Solutions. For Life. Luminex

More information

cobas p 612 pre-analytical system Adapting to today s needs. Flexible for tomorrow s demand.

cobas p 612 pre-analytical system Adapting to today s needs. Flexible for tomorrow s demand. cobas p 612 pre-analytical system Adapting to today s needs. Flexible for tomorrow s demand. Personalized Lab Automation Maximizing Testing Efficiency and Medical Value At Roche, laboratory automated solutions

More information

ab MDR Assay Kit (Fluorometric)

ab MDR Assay Kit (Fluorometric) ab112142 MDR Assay Kit (Fluorometric) Instructions for Use For detecting MDR pump activities in cells using our proprietary fluorescence probe. This product is for research use only and is not intended

More information

Primerdesign Ltd. High risk Human Papillomavirus. Multiplex screening kit. genesig kit. 100 tests. For general laboratory and research use only

Primerdesign Ltd. High risk Human Papillomavirus. Multiplex screening kit. genesig kit. 100 tests. For general laboratory and research use only Primerdesign Ltd High risk Human Papillomavirus Multiplex screening kit genesig kit 100 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus Papillomaviruses are a

More information

GenPlex HID Training Class I

GenPlex HID Training Class I Rixun Fang GenPlex HID Training Class I Outline of Presentation Introduction GenPlex HID kit Experimental plan Class schedule Forensic SNP Analysis GenPlex HID Training Class I 2 Potential Forensic Applications

More information

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

Label-free interaction analysis in realtime using surface plasmon resonance

Label-free interaction analysis in realtime using surface plasmon resonance GE Healthcare Technology Note 23 Biacore systems Label-free interaction analysis in realtime using surface plasmon resonance Providing quantitative data on: report point Specificity sensorgram To what

More information

Experion Automated Electrophoresis System

Experion Automated Electrophoresis System Experion Automated Electrophoresis System Focus on the results, not the method. Experion Automated Electrophoresis System Experience Meets Innovation The Experion automated electrophoresis system is a

More information

DNA Genotyping from Human FFPE Samples Reliable and Reproducible

DNA Genotyping from Human FFPE Samples Reliable and Reproducible DNA Genotyping from Human FFPE Samples Reliable and Reproducible Use this optimized protocol to obtain reliable and reproducible SNP Genotyping data from those difficult human FFPE samples. 1 FFPE DNA Isolation

More information

For in vitro Veterinary Diagnostics only. Real-Time PCR Detection Kit for detection of Histomonas meleagridis.

For in vitro Veterinary Diagnostics only. Real-Time PCR Detection Kit for detection of Histomonas meleagridis. For in vitro Veterinary Diagnostics only. Real-Time PCR Detection Kit for detection of Histomonas meleagridis www.kylt.eu DIRECTION FOR USE Art. No. 31416/31417 Kylt Histomonas meleagridis Real-Time PCR

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

Surface Plasmon Resonance Systems

Surface Plasmon Resonance Systems Innovative precision instruments for over a century Surface Plasmon Resonance Systems Label-free Molecular Interaction Analysis ReichertSPR Answers: Is there an interaction? How fast? How strong? How long?

More information

Fast decisions instead of delays Quality Control through outstanding design

Fast decisions instead of delays Quality Control through outstanding design Fast decisions instead of delays Quality Control through outstanding design We are CustomBiotech from Roche In your operations, behind your decisions, powering your products You are driving a paradigm

More information