Meet the Family: The BioMark HD System. One system. One to 36,000 reactions in a day. No compromises.
|
|
- Erin Palmer
- 6 years ago
- Views:
Transcription
1 Meet the Family: The BioMark HD System One system. One to 36,000 reactions in a day. No compromises.
2 The BioMark HD Family: Scale Your Studies Without Compromising Data Quality Tired of sacrificing data quality, suffering through cumbersome workflows, or even switching PCR blocks to scale your genotyping and gene expression studies? With the BioMark HD System and its family of IFCs (integrated fluidic circuits), you get high sample throughput, ultra-high data quality, assay flexibility, and an easy workflow everything you need in one solution. That s one simple system to develop, validate, and deploy your gene expression or SNP genotyping panel. Go from dozens to thousands of samples and targets per day and skip the re-optimization and other headaches. Target Discovery Target Selection Target Validation Pilot Screening Routine Testing FLEXsix IFC IFC IFC IFC Select targets, then optimize assays with the ultra-configurable FLEXsix IFC and the economical IFC Validate and pilot screen assays through thousands of samples in just days Cost-effectively deploy a gene expression or SNP genotyping panel with minimal labor Number of Samples Increasing 2
3 Ultimate Flexibility The FLEXsix IFC The FLEXsix IFC has six 12-assay-by-12-sample partitions that can each be run separately or together. Run each partition independently as separate experiments or run multiple partitions simultaneously. Run different combinations of 12 to 72 assays or 12 to 72 samples per experiment (See table 2 below.). Use the first partition on day 1 and take up to 90 days to use the other five, with no loss in performance. Run fewer samples more often no more waiting to collect enough samples. Move low-throughput work from plates to the FLEXsix IFC and never have to re-optimize when scaling up. 144 reaction chambers/partition 6 partitions per IFC 12 assay per partition 12 sample per partition Table 1 IFC Type Assay Inlets 6 x 12 Sample Inlets 6 x 12 Reaction Chambers 864 Reaction Volume IFC Controller Compatibility FLEXsix IFC 8.9 nl HX IFC Controller FLEXsix IFC Table 2 FLEXsix IFC Example Sample/Assay Combinations Samples Assays Partitions Used
4 The Workhorses The and IFCs These IFCs allow you to radically reduce hands-on time and total time to results while increasing the data accuracy of your gene expression or SNP genotyping studies. 9,216 total reaction chambers 96 sample 96 assay You get great data reliability and the microfluidic architecture does the heavy lifting, combining samples and assays into 2,304 or 9,216 parallel PCR reactions. That s up to 24 times what you get with a 384-well plate, and it only takes 15 minutes of hands-on time. IFC Type IFC IFC Assay Inlets Sample Inlets Reaction 2,304 9,216 Chambers Reaction Volume 10.1 nl 6.7 nl IFC Controller Compatibility MX IFC Controller HX IFC Controller 2,304 reaction chambers IFC 48 assay 48 sample IFC 4
5 Unmatched Speed and Throughput The IFC The IFC is the easiest and fastest tool for high-throughput routine screening. Stop wasting time (and plastics) and start collecting data. 4,608 reaction chambers Quickly screen more than 2,000 samples per day for any assay panel of up to 24 targets. With a single run, produce 4,608 data points in as little as one hour with only 15 minutes of hands-on time. Generate 50,688 data points the equivalent of well plates in a single 8-hour day without compromising data quality. 24 assay 192 sample IFC Type IFC Assay Inlets 24 Sample Inlets 192 Reaction Chambers 4,608 Reaction Volume 8nl IFC Controller RX IFC Controller Compatibility IFC 5
6 The Complete Family The BioMark HD System The BioMark HD System is the only multi-purpose real-time PCR system that performs genotyping, gene expression profiling, quantitative real-time digital PCR (qdpcr), and single-cell analysis. It includes everything you need to produce high-quality data including the analysis software so you can make sense of your results. Save time and money run more than 9,000 experiments in four hours and generate as many as 36,000 data points with one person in a single day Analyze RNA, mirna, DNA, and proteins Use multiple assay chemistries and different sample/assay configurations Use real-time PCR to qualify and quantitate samples prior to next-generation sequencing Easily manage, annotate, and archive results 6
7 Ordering Information Gene Expression Products Product Product Description Part Number IFC Packs Single GE IFC Ten GE IFCs and Ten Control Line Fluid Syringes FLEXsix Gene Expression IFC Dynamic Array Chip for Gene Expression BMK-M Dynamic Array Chip for Gene Expression BMK-M Reagent Kits GE DELTAgene Sample and Assay Reagent Kit 1 IFC GE DELTAgene Sample and Assay Reagent Kit 10 IFCs GE Sample and Assay Reagent Kit 1 IFC GE Sample and Assay Reagent Kit 10 IFCs FLEXsix Gene Expression Reagent Kit 5 IFCs FLEXsix DELTAgene Gene Expression Reagent Kit 5 IFCs GE Dynamic Array Sample & Assay Loading Reagent Kit - 10 Chips GE Dynamic Array Sample & Assay Loading Reagent Kit - 40 Chips GE Dynamic Array DNA Binding Dye Sample & Assay Loading Reagent Kit- 10 chips GE Dynamic Array Sample & Assay Loading Reagent Kit - 10 Chips GE Dynamic Array Sample & Assay Loading Reagent Kit - 40 Chips GE Dynamic Array DNA Binding Dye Sample & Assay Loading Reagent Kit- 10 chips IFC and Reagent Kit Bundles GE DELTAgene Kit - 10 IFC GE Kit - 10 IFC FLEXsix Gene Expression Kit 5 IFCs FLEXsix DELTAgene Gene Expression Kit 5 IFCs Sample/Loading Kit - 10 Chip Package BMK-M DNA Binding Dye Sample/Loading Kit - 10 Chip Package BMK-M EG Sample/Loading Kit - 10 Chip Package BMK-M DNA Binding Dye Sample/Loading Kit - 10 Chip Package BMK-M EG Reagents PreAmp Master Mix - 1 Tube PreAmp Master Mix - 5 Tubes Reverse Transcription Master Mix - 1 Tube Reverse Transcription Master Mix - 5 Tubes Pre Amp and Reverse Transcription Master Mix - 1 Tube each Pre Amp and Reverse Transcription Master Mix - 5 Tubes each Assays DELTAgene Assays (wet tested) ASY-GE-WET DELTAgene Assays Control Line Fluid Control Line Fluid Kit ASY-GE Control Line Fluid Kit Control Line Fluid Kit
8 Ordering Information Genotyping Products Product Product Description Part Number IFC Packs Dynamic Array IFC for SNP Genotyping BMK-M GT FLEXsix Genotyping IFC Dynamic Array Chip for Genotyping BMK-M-48.48GT Dynamic Array Chip for Genotyping BMK-M-96.96GT Dynamic Array Chip for Genotyping Multipack Dynamic Array Chip for Genotyping Multipack High Precision Genotyping IFC High Precision Genotyping IFC Multipack High Precision Genotyping IFC Multipack FR48.48 Dynamic Array IFC BMK-M-FR48.48 Reagent Kits GT Dynamic Array Sample & Assay Loading Reagent Kit - 10 Chips SNPtype Genotyping Reagent Kit (192.24) FLEXsix Fast Genotyping Reagent Kit 5 IFCs FLEXsix Genotyping Reagent Kit 5 IFCs FLEXsix SNPtype Genotyping Reagent Kit 5 IFCs GT Dynamic Array Sample & Assay Loading Reagent Kit - 10 Chips GT Dynamic Array Sample & Assay Loading Reagent Kit - 40 Chips SNPtype Genotyping Reagent Kit (48.48) GT Dynamic Array Sample & Assay Loading Reagent Kit - 10 Chips GT Dynamic Array Sample & Assay Loading Reagent Kit - 40 Chips SNPtype Genotyping Reagent Kit (96.96) FR Sample/Loading Kit - 25 Chip Package FR Sample/Loading Kit - 5 Chip Package BMK-M25-FR48.48 BMK-M5-FR48.48 IFC and Reagent Kit Bundles GT + Sample/Loading Kit - 10 Chip Package BMK-M GT GT + Sample/Loading + SNPtype Reagents Kit - 10 Chip Package FLEXsix Fast Genotyping Kit 5 IFCs FLEXsix SNPtype Genotyping Kit 5 IFCs FLEXsix Genotyping Kit 5 IFCs GT + Sample/Loading Kit - 10 Chip Package BMK-M GT GT + Sample/Loading + SNPtype Reagents Kit - 10 Chip Package GT + Sample/Loading Kit - 10 Chip Package BMK-M GT GT + Sample/Loading + SNPtype Reagents Kit - 10 Chip Package BMK-M GT-SNP Reagents Bulk 20X GT Sample Loading Reagent, 25mL Bulk 2X Assay Loading Reagent, 25mL
9 Ordering Information Genotyping Products (continued) Product Product Description Part Number Reagents (continued) 20X Fast GT Sample Loading Reagent - 5 Tubes X GT Sample Loading Reagent - 5 Tubes X SNPtype Sample Loading Reagent - 5 Tubes X Assay Loading Reagent - 5 Tubes X SNPtype Reagent - 5 Tubes Assays SNPtrace Panel SNPtype Assay (Large) SNPtype Assay (Medium) SNPtype Assay (Small) ASY-GT-L ASY-GT-M ASY-GT-S Control Line Fluid Control Line Fluid Kit Control Line Fluid Kit - dynamic (48.48 only)/digital/access Control Line Fluid Kit
10 2014 Fluidigm Corporation. All rights reserved. Fluidigm, the Fluidigm logo, BioMark, DELTAgene, FLEXsix and SNPtype are trademarks or registered trademarks of Fluidigm Corporation in the U.S. and/or other countries. All other trademarks are the property of their respective owners. Fluidigm recommends that you only purchase licensed PCR assay reagents from authorized sources. For Research Use Only. Not for use in diagnostic procedures. Corporate Headquarters 7000 Shoreline Court, Suite 100 South San Francisco, CA USA Toll-free: FLUIDLINE Fax: Sales North America Europe/EMEA info-europe@fluidigm.com Japan info-japan@fluidigm.com China (including Hong Kong) info-china@fluidigm.com Asia info-asia@fluidigm.com Latin America info-latinamerica@fluidigm.com
11
Gene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
More informationReal-Time PCR Analysis
PN 68000088 L1 USER GUIDE Real-Time PCR Analysis For Research Use Only. Not for use in diagnostic procedures. Information in this publication is subject to change without notice. It is Fluidigm policy
More informationUsing the C 1 Single-Cell Auto Prep System to Capture Cells from Cell Culture and Perform Preamplification Using TaqMan Assays.
Using the C 1 Single-Cell Auto Prep System to Capture Cells from Cell Culture and Perform Preamplification Using TaqMan Assays PN 100-6117 A1 Contents Introduction...........................................................2
More informationPCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System
PCR SYSTEMS a new era in high-productivity qpcr Applied Biosystems ViiA 7 Real-Time PCR System a new era in high-productivity qpcr The ViiA 7 Real-Time PCR System delivers the proven reliability, sensitivity,
More informationMicroRNA Profiling with TaqMan OpenArray Plates
MicroRNA Profiling with TaqMan OpenArray Plates 1 12/4/2012 Profiling with TaqMan MicroRNA Assays Highly Parallel Assays For mirna Expression Analysis Megaplex Primer Pools TaqMan OpenArray mirna Panel
More informationSame TaqMan Assay quality, new format
Product Bulletin TaqMan Array Plates TaqMan Array Plates TaqMan Gene Expression Assays delivered in ready-to-use 96-well Custom Array Plates or predefined Gene Signature Plates Flexible choose from customizable
More informationscgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
More informationSNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
More informationProduct Catalog # Description List Price (JPY) Primer Assays (desalted)
Assays and Controls Primer Assay Pricing Primer Assays (desalted) 10025636 Primer assay desalted, 200 reactions 16,000 (Wet-lab validated human, mouse, and rat) 10025637 Primer assay desalted, 1,000 reactions
More informationQuantStudio 3D Digital PCR System
PRODUCT BULLETIN QuantStudio 3D Digital PCR System QuantStudio 3D Digital PCR System Absolutely attainable digital PCR Simple chip-based workflow no emulsion PCR Affordable low total cost of ownership
More informationUSER GUIDE. Real-Time PCR
m ig id Fl u C n. at io or or p Al s ht ig lr. ed rv se re USER GUIDE Real-Time PCR Limited License and Disclaimer for Fluidigm Systems with Fluidigm IFCs Except as expressly set forth herein, no right
More informationExpression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
More informationQuantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
More informationMassARRAY System MASSARRAY SYSTEM ACCELERATING RESEARCH
SENSITIVITY ACCELERATING RESEARCH SPEED SPECIFICITY ACCURACY No compromise MASSARRAY SYSTEM Genotyping Somatic mutation profiling Methylation analysis Quantitative gene expression and copy number variant
More informationReal-Time PCR Validations
Real-Time PCR Validations Relative gene expression Example experiment: I have 2 samples: untreated and treated. Question: What happens to the expression of gene X when I treat the cells? Answer: Expressed
More informationTaqMan Advanced mirna Assays
PRODUCT BULLETIN TaqMan Advanced mirna Assays TaqMan Advanced mirna Assays Key features Universal reverse transcription (RT) one RT step for all Applied Biosystems TaqMan Advanced mirna Assays Sensitive
More informationTaqPath ProAmp Master Mixes
PRODUCT BULLETIN es es Applied Biosystems TaqPath ProAmp Master Mixes are versatile master mixes developed for high-throughput genotyping and copy number variation (CNV) analysis protocols that require
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationUser Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
More informationRelative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)
The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationApplied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems
PRODUCT BROCHURE Real-Time PCR Systems Applied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems Real Fast. Real Versatile. Real Value. Real choices from the leader in real-time PCR. The latest
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More informationSmartSpec Plus spectrophotometer
SmartSpec Plus spectrophotometer Simply Brilliant. The SmartSpec Plus has a more complete range of features and functions than many other benchtop spectrophotometers. It s a complete quantitation package
More informationPERFORMANCE MADE EASY REAL-TIME PCR
PERFORMANCE MADE EASY REAL-TIME PCR The MyGo Pro real-time PCR instrument provides unmatched performance in a convenient format. Novel Full Spectrum Optics deliver 120 optical channels of fluorescence
More informationIntroducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Fast Real-Time PCR System
7300/7500 Real-Time PCR Systems Introducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Real-Time PCR System Applied Biosystems 7500 Fast Real-Time
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationGENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE)
TriMark Publications April 2007 Volume: TMRGER07-0401 GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) Trends, Industry Participants, Product Overviews and Market Drivers TABLE OF CONTENTS
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationApplied Biosystems TaqMan Array Microfluidic Cards
Performing Rapid Cycling Gene Quantitation on TaqMan Array Microfluidic Cards Applied Biosystems TaqMan Array Microfluidic Cards User Bulletin JULY 2010 SUBJECT: In this user bulletin Performing Rapid
More informationPyrosequencing. Alix Groom
Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases
More informationMaxwell RSC System. Next Generation Automated Purification and Quantitation
Maxwell RSC System Next Generation Automated Purification and Quantitation INTRODUCTION/OVERVIEW The Maxwell RSC System Your personal purification assistant. It easily integrates into any laboratory workflow,
More informationInstructions for Use. RealStar Lassa Virus RT-PCR Kit /2017 EN
Instructions for Use RealStar Lassa Virus RT-PCR Kit 1.0 04/2017 EN RealStar Lassa Virus RT-PCR Kit 1.0 For research use only! (RUO) 641003 INS-641000-EN-S01 96 04 2017 altona Diagnostics GmbH Mörkenstr.
More informationEfficient qpcr Setup Without Cross Contamination Using the epmotion Family of Automated Liquid Handling Systems
APPLICATION NOTE No. 368 I July 2016 Efficient qpcr Setup Without Cross Contamination Using the epmotion Family of Automated Liquid Handling Systems Eric Gancarek¹, Blandine Vanbellinghen¹, Sandrine Hamels¹,
More informationPrecision MULTIPLEX qpcr Master Mix. Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR
Precision MULTIPLEX qpcr Master Mix Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents
More informationLiquidBiopsy LIQUIDBIOPSY. Automated Rare Template Isolation Platform
LiquidBiopsy LIQUIDBIOPSY Automated Rare Template Isolation Platform Enabling cancer research with highly multiplexed molecular analysis of serially collected blood samples The LiquidBiopsy Platform simplifies
More informationab Plant Chromatin Extraction Kit
ab156906 Plant Chromatin Extraction Kit Instructions for Use For isolating chromatin or DNA-protein complex from plants in a simple and rapid format This product is for research use only and is not intended
More informationPrecision PLUS OneStep qrt-pcr Master Mix. Instructions for use of Primerdesign Precision PLUS OneStep Master Mix for real-time RT-PCR
Precision PLUS OneStep qrt-pcr Master Mix Instructions for use of Primerdesign Precision PLUS OneStep Master Mix for real-time RT-PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products
More informationEarlyTox Cell Integrity Kit
EarlyTox Cell Integrity Kit The EarlyTox Cell Integrity Kit from Molecular Devices is an optimized set of reagents that simplifies the measurement of live and dead cells in a single well. The assay uses
More informationData Sheet. GeneChip Human Genome U133 Arrays
GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array
More informationNEBNext Multiplex Oligos for Illumina (Index Primers Set 2)
LIBRARY PREPARATION NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) Instruction Manual NEB #E7500S/L 24/96 reactions Version 4.0 1/18 be INSPIRED drive DISCOVERY stay GENUINE This product is
More informationUF Center for Pharmacogenomics. Explanation of Services. UF Center for Pharmacogenomics Services
UF Center for Pharmacogenomics Explanation of Services Services are provided either as a price per sample or price per project, depending on the specific needs of the researcher. Basic a la carte services,
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationAll your genetic analyses on a single instrument
GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All your genetic analyses on a single instrument GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All on a single instrument Perform your genetic assays on one instrument A
More informationIDEAL TM Spike-In RNA Kit. Individual Assays Principle, Workflow and Protocol
IDEAL TM Spike-In RNA Kit Individual Assays Principle, Workflow and Protocol Table of Contents Content Page Working Principle 3 Kit Contents & Storage 4 Additional Equipment and Compatibility 5 Workflow
More informationSPRIworks Systems. Push button. Walk away. Fully automated library construction systems with built-in size selection and cleanup BR-15981B
SPRIworks Systems Fully automated library construction systems with built-in size selection and cleanup Push button. Walk away. BR-15981B SPRIworks Technology Fully automated fragment library construction
More informationHigh-throughput scale. Desktop simplicity.
High-throughput scale. Desktop simplicity. NextSeq 500 System. Flexible power. Speed and simplicity for whole-genome, exome, and transcriptome sequencing. Harness the power of next-generation sequencing.
More informationNEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module
SAMPLE PREPARATION NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module Instruction Manual NEB #E6111S/L 20/100 reactions Version 2.0 1/17 be INSPIRED drive DISCOVERY stay GENUINE This product
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationHiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
More informationData Quality Worth Sharing
Product Bulletin Human Identification AmpFlSTR NGM and NGM SElect PCR Amplification Kits Next generation amplification chemistries including the 5 new loci from the expanded European Standard Set Enhanced
More information-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay
-PLEX Immunogenicity Assay Application Note 1 Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay The use of biotherapeutics, biosimilars, and combination biotherapies
More informationab Cell Viability Assay Kit Fluorometric Dual Green/Red
ab112121 Cell Viability Assay Kit Fluorometric Dual Green/Red Instructions for Use For detecting cell viability in suspension and adherent cells by using dual proprietary green and red fluorescence probes.
More informationTypical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides
Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane
More informationDeveloping an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That
More informationQIAGEN Supplementary Protocol
QIAGEN Supplementary Protocol PCR and data analysis using the cador T. equigenitalis PCR Kit on Rotor-Gene Q instruments This protocol is designed for using the cador T. equigenitalis PCR Kit for detection
More informationIntroduction. Lance Martin, BIOFAB Operations
Introduction Lance Martin, BIOFAB Operations Several capacities needed to support EOU engineering Design Libraries Feature 1 Variants Feature 2 Variants Assemble Clone Assay Analyze Feature 1 Feature 2
More informationQIAcube Pure Efficiency
QIAcube Pure Efficiency Sample & Assay Technologies Walkaway spin-column processing The QIAcube automates your spin preps The revolutionary QIAcube makes automated sample prep available to all labs. The
More informationFor in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.
For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and
More informationElectrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008
Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating
More informationab ChIP Kit Magnetic One-Step
ab156907 ChIP Kit Magnetic One-Step Instructions for Use For selective enrichment of a chromatin fraction containing specific DNA sequences in a high throughput format using chromatin isolated from various
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationCustom dye calibration for StepOne and StepOnePlus Real-Time PCR Systems
USER BULLETIN Custom dye calibration for StepOne and StepOnePlus Real-Time PCR Systems Publication Number MAN0014609 Revision A This user bulletin is for use with the StepOne and StepOnePlus Real-Time
More informationMetaXpress High-Content Image Acquisition and Analysis Software
High-Content Image Acquisition and Analysis Software BENEFITS Meet high throughput requirements with a scalable, streamlined workflow Adapt your analysis tools to tackle your toughest problems, including
More informationTIME IT S PRIME. chemagic TM Prime TM instrument Streamlined Walk-away Automation. For all Human Sample Materials. Primary Sample Handling
IT S PRIME TIME chemagic TM Prime TM instrument Streamlined Walk-away Automation. For all Human Sample Materials. Primary Sample Nucleic Acid Isolation Eluate Quantitation of Extracted Samples Assay Setup
More informationNovoCyte Flow Cytometer
NovoCyte Flow Cytometer The Flow Cytometer for Everyone 2 Experience the NovoCyte Advantage Focus on advancing your research. Let the flow cytometer do the rest. NovoCyte Flow Cytometer High Performance
More informationApplied Biosystems Informatics Solutions for the Life Sciences. Jason McGlashan Oracle Life Science User Group Meeting
Applied Biosystems Informatics Solutions for the Life Sciences Jason McGlashan Oracle Life Science User Group Meeting Company Overview 20-year history of fueling life science innovation Instruments and
More informationTouchscreen (standalone capabilities, PIN-protected user accounts, and dye calibration/rnasep functionality)
QuantStudio 3 & 5 Real-Time PCR Systems: The Basics Touchscreen (standalone capabilities, PIN-protected user accounts, and dye calibration/rnasep functionality) USB ports Overview of the QuantStudio TM
More informationLightCycler 480 qpcr Tools. Meeting the Challenge of Your Research
LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing
More informationBenchSmart 96. Semi-automated Pipetting Higher Accuracy, Greater Flexibility
BenchSmart 96 Semi-automated Pipetting Higher Accuracy, Greater Flexibility For scientists looking to maximize their data quality and research productivity, a new semiautomated approach to 96-well pipetting
More informationExceed the limit. SensiFAST Real-Time PCR Family. Superior Sensitive Quantification
Exceed the limit SensiFAST Real-Time PCR Family Superior Sensitive Quantification SensiFAST Real-Time PCR Kits Fast - optimized for fast cycling conditions (under 30 minutes), ideal for high-throughput
More informationReal-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation
Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation
More informationMultiplex RT for TaqMan Array Human MicroRNA Panel
f Multiplex RT for TaqMan Low Density Array Multiplex RT for TaqMan Array Human MicroRNA Panel Quick Reference Card For safety and biohazard guidelines, refer to the Safety section in the Multiplex RT
More informationProtocol. Path-ID Multiplex One-Step RT-PCR Kit Protocol TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets
Protocol TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets For Research Use Only. Not for use in diagnostic procedures. Information in this document is subject to change without
More informationID3EAL Spike-in RNA Kit. Principle, Workflow and Protocol
ID3EAL Spike-in RNA Kit Principle, Workflow and Protocol Table of Contents Content Page Working Principle 3 Kit Contents & Storage 4 Additional Equipment and Compatibility 5 Additional Equipment and Compatibility
More informationab Fluo-8 No Wash Calcium Assay Kit
ab112129 Fluo-8 No Wash Calcium Assay Kit Instructions for Use For detecting calcium in cells by using our proprietary fluorescence probe. This product is for research use only and is not intended for
More informationPrecision FAST qpcr Master Mix. Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR
Precision FAST qpcr Master Mix Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents and Equipment
More informationHigh Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays
High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science
More informationTargeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems
Sequencing Application Note March 2012 Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems GS GType TET2/CBL/KRAS and RUNX1 Primer Sets for the GS Junior and GS FLX Systems. Introduction
More informationBacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,
More informationUser Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR
User Manual VisiBlue qpcr mix colorant Version 1.3 September 2012 For use in quantitative real-time PCR VisiBlue qpcr mix colorant Table of contents Background 4 Contents 4 Storage 4 Fluorescence data
More informationBEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION
BEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION The lab mouse is the most commonly used mammalian model system for genetic research. Scientists from a wide
More informationProtocol. High-throughput Transfection Protocol for GoClone Reporter Assays. Tech support: Luciferase Assay System
Luciferase Assay System Protocol High-throughput Transfection Protocol for GoClone Reporter Assays LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow promoter luciferase Step 1: Simultaneously
More informationMultiplex Assay Design
Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011 Luminex Multiplexed Solutions. For Life. Luminex
More informationcobas p 612 pre-analytical system Adapting to today s needs. Flexible for tomorrow s demand.
cobas p 612 pre-analytical system Adapting to today s needs. Flexible for tomorrow s demand. Personalized Lab Automation Maximizing Testing Efficiency and Medical Value At Roche, laboratory automated solutions
More informationab MDR Assay Kit (Fluorometric)
ab112142 MDR Assay Kit (Fluorometric) Instructions for Use For detecting MDR pump activities in cells using our proprietary fluorescence probe. This product is for research use only and is not intended
More informationPrimerdesign Ltd. High risk Human Papillomavirus. Multiplex screening kit. genesig kit. 100 tests. For general laboratory and research use only
Primerdesign Ltd High risk Human Papillomavirus Multiplex screening kit genesig kit 100 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus Papillomaviruses are a
More informationGenPlex HID Training Class I
Rixun Fang GenPlex HID Training Class I Outline of Presentation Introduction GenPlex HID kit Experimental plan Class schedule Forensic SNP Analysis GenPlex HID Training Class I 2 Potential Forensic Applications
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationLabel-free interaction analysis in realtime using surface plasmon resonance
GE Healthcare Technology Note 23 Biacore systems Label-free interaction analysis in realtime using surface plasmon resonance Providing quantitative data on: report point Specificity sensorgram To what
More informationExperion Automated Electrophoresis System
Experion Automated Electrophoresis System Focus on the results, not the method. Experion Automated Electrophoresis System Experience Meets Innovation The Experion automated electrophoresis system is a
More informationDNA Genotyping from Human FFPE Samples Reliable and Reproducible
DNA Genotyping from Human FFPE Samples Reliable and Reproducible Use this optimized protocol to obtain reliable and reproducible SNP Genotyping data from those difficult human FFPE samples. 1 FFPE DNA Isolation
More informationFor in vitro Veterinary Diagnostics only. Real-Time PCR Detection Kit for detection of Histomonas meleagridis.
For in vitro Veterinary Diagnostics only. Real-Time PCR Detection Kit for detection of Histomonas meleagridis www.kylt.eu DIRECTION FOR USE Art. No. 31416/31417 Kylt Histomonas meleagridis Real-Time PCR
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationSurface Plasmon Resonance Systems
Innovative precision instruments for over a century Surface Plasmon Resonance Systems Label-free Molecular Interaction Analysis ReichertSPR Answers: Is there an interaction? How fast? How strong? How long?
More informationFast decisions instead of delays Quality Control through outstanding design
Fast decisions instead of delays Quality Control through outstanding design We are CustomBiotech from Roche In your operations, behind your decisions, powering your products You are driving a paradigm
More information