Multiplex Assay Design

Size: px
Start display at page:

Download "Multiplex Assay Design"

Transcription

1 Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011

2 Luminex Multiplexed Solutions. For Life. Luminex is the leader in microsphere-based multiplexing Luminex technology is used by researchers and physicians

3 Luminex Multiplex Assay Design Components of an multiplexed assay: Platform Technology Data Analysis Software

4 What is xmap Technology? Combination of multiple proven technologies Color-coded 5.6 micron microspheres 100 different colors, proprietary dyeing process Luminex 100/200 System Advanced optics, lasers, fluidics, DSPs, software The Luminex 100/200 is a class 1 (I) laser product.

5 The Luminex xmap Platform Derived from classical flow cytometry Faster hybridization kinetics due to quasi-solution phase reaction Beads Polystyrene/Magnetic 5.6/6.5 um diameter uniform dyed using a proprietary process Hardware is a simple benchtop flow analyzer fluidics optics digital signal processor Multiplexible from analytes High throughput 96-well microplate format Easily automatable Flexible open platform (array size can vary)

6 How Does xmap Technology Work? Microspheres are dyed to create 100 distinct colors Each microsphere has spectral address based on red/infrared content Microspheres are suspendable Microspheres are coated with capture reagent (oligo or antibody) Sample is added to microspheres Analyte is captured to microspheres Fluorescent reporter tag added

7 How Does xmap Technology Work? Microspheres are dyed to create 100 distinct colors Each microsphere has spectral address based on red/infrared content Microspheres are suspendable Microspheres are coated with capture reagent (oligo or antibody) Sample is added to microspheres Analyte is captured to microspheres Fluorescent reporter tag added

8 How Does xmap Technology Work? Microspheres are dyed to create 100 distinct colors Each microsphere has spectral address based on red/infrared content Microspheres are suspendable Microspheres are coated with capture reagent (oligo or antibody) Sample is added to microspheres Analyte is captured to microspheres Fluorescent reporter tag added

9 How Does xmap Technology Work? Assays are read using a compact microsphere analyzer Analyzer samples well Lasers excite fluorescent dyes- red laser for bead classification and green for assay result Multiple readings for each microsphere set Software reports results in real-time Up to 9600 results read in one hour The Luminex 100/200 is a class 1 (I) laser product.

10 How Does xmap Technology Work? Assays are read using a compact microsphere analyzer Analyzer samples well Lasers excite fluorescent dyes- red laser for bead classification and green for fluorescence detection Multiple readings for each microsphere set Software reports results in real-time Up to 9600 results read in one hour The Luminex 100/200 is a class 1 (I) laser product.

11 How Does xmap Technology Work? Assays are read using a compact microsphere analyzer Analyzer samples well Lasers excite fluorescent dyes- red laser for bead classification and green for assay result Multiple readings for each microsphere set Software reports results in real-time Up to 9600 results read in one hour

12 xmap Technology: Data collection Software sorts data by size scatter Events larger or smaller than microspheres are excluded Microsphere size is set by gate in each experiment Larger

13 Designing a Universal Sequence Set A combinatorial problem in that one must design N DNA tags such that: each tag hybridizes efficiently to its complementary anti-tag but not to any other of the N-1 anti-tags tags have similar melting temperature tags have similar lengths tags are not too similar to actual genes The universal tags have to be different enough to be distinguishable from one another and the genome but similar enough to be able to control their behavior under a single set of conditions. Tag = target; Anti-tag = probe

14 Designing a Universal Sequence Set All sequences will be 24mers Pattern matching/similarity thresholds no common subsequence with melting temp. above some fixed threshold no alignment with score above some fixed threshold Result is sets of minimally cross-hybridizing isothermal sequences

15 Benefits of Universal Arrays Single array needs optimized only once for all applications Compatible with multiple genotyping (front-end) chemistries Simplified manufacturing, QC Is a diagnostic industry standard Improved accuracy, S/N ratio Overcome back-end limits of multiplexing Sequences have been DESIGNED to work together Dramatically decreases development time for new products (ie. Lower costs for assay development)

16 The xtag Genotyping Platform BUILD THE REST B Universally-tagged, biotin-labelled representation of sample genomic DNA B Anti-Tag Tag FOUNDATION IS BUILT >

17 The xtag Genotyping Platform 5 Easy Steps I. Multiplex PCR II. Multiplex ASPE B B B B III. Universal Array Sorting B PE B PE IV. xmap Detection V. Data Analysis

18 Multiplex PCR 500 bp 400 bp Ladder 300 bp 250 bp 200 bp 175 bp Sample: Neg Single tube 16-plex PCR

19 Multiplex ASPE Genotyping Allele Specific Primer Extension 3 A PCR-amplified wt DNA 3 A T 3 T 3 3 Tag 1 A T T 3 Denature Anneal allele-specific tagged primers Tagged wt primer Tagged mut primer Tag 2 3 A T 3 Extend with DNA polymerase and biotin-dctp B 3 Tag 1 A T B Tag 2 3 A No extension

20 Universal Array Sorting Tag/Anti-Tag 1 B SA PE B SA PE Tag/Anti-Tag 3 Universal array made up of n different bead populations Tag/Anti-Tag 2

21 xtag Genotype Calling & Allelic Ratios Genotypes based on the allelic ratio (AR) for mutation in question AR is calculated by expressing the net signal from a given allele as a fraction of the total signal (wt and mut) for each mutation analyzed Both wt and mut AR s are calculated by TDAS to make calls AR ranges for genotype calling determined empirically for each mutation wt present AR wt = mut allele present AR mut = homozygous wt AR wt =

22 Allelic Ratios (AR) AR mut = Net MUT Signal Net MUT Signal + Net WT Signal AR mut Values WT Heterozygous MUT

23 Assay Format Summary 5 Steps: I II III IV V Genomic DNA Single tube Single tube xtag Universal Data Acquisition Data Analysis Whole blood Blood spots Mouthwash WGA Multiplex PCR Multiplex ASPE Array Sorting on Luminex xmap TDAS

24 Conclusions The combination of a bead-based platform with the universal array principle provides several benefits: Less development time for new application Higher accuracy (specificity in solution phase) Flexibility in array size High throughput Economical Simplifies array manufacturing and QC Open platform provides labs with an opportunity to build their own assays

25 What is TDAS LSM? Easy-to-use data analysis software for used with assays that are built on xtag technology Provide qualitative calls for samples based on raw signals (MFI median fluorescence intensity) acquired from the Luminex Analyzer. User can customize the analysis for their assays: Organize analytes into targets and panels Specify cut-offs for making calls Define call dependency rules 25

26 TDAS LSM features Load & analyze data file(s) Open detailed views Print / Export analysis result Primary negative control Security Access Control Command Line Custom assay configurations (LDTC) 26

27 TDAS LSM Analysis Module Signal-Based Analysis (SBA) Module Suitable for assays that have independent analytes for each target detection, e.g. infectious diseases, one analyte for each virus or bacteria Analyze sample data based on the analyte (probe) signals for a target Use MFI cutoffs to make calls Support signal-to-noise ratio Target can have one or multiple analytes Calls are made on target only 27

28 TDAS LSM Analysis Module Ratio-Based Analysis (RBA) Module Suitable for human genetics assays that use multiple analytes to detect the presence or absence of the variants, e.g. wild-type and mutant allele Analyze sample data based on the ratio of the analyte signals for a target SAT a Single Analyte Target can have either a wild-type analyte or a variant analyte MAT a Multiple Analyte Target could have at least one wild-type analyte and one variant analyte multiple analytes for variants only (MVT) 28

29 Thank You!

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

UF Center for Pharmacogenomics. Explanation of Services. UF Center for Pharmacogenomics Services

UF Center for Pharmacogenomics. Explanation of Services. UF Center for Pharmacogenomics Services UF Center for Pharmacogenomics Explanation of Services Services are provided either as a price per sample or price per project, depending on the specific needs of the researcher. Basic a la carte services,

More information

PCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System

PCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System PCR SYSTEMS a new era in high-productivity qpcr Applied Biosystems ViiA 7 Real-Time PCR System a new era in high-productivity qpcr The ViiA 7 Real-Time PCR System delivers the proven reliability, sensitivity,

More information

GenPlex HID Training Class I

GenPlex HID Training Class I Rixun Fang GenPlex HID Training Class I Outline of Presentation Introduction GenPlex HID kit Experimental plan Class schedule Forensic SNP Analysis GenPlex HID Training Class I 2 Potential Forensic Applications

More information

QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material

QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material MDA Technology Protocols Locus Bias Applications Kits & Service Summary QIAGEN REPLI-g WGA

More information

Applied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems

Applied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems PRODUCT BROCHURE Real-Time PCR Systems Applied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems Real Fast. Real Versatile. Real Value. Real choices from the leader in real-time PCR. The latest

More information

Introduction to Real-Time PCR: Basic Principles and Chemistries

Introduction to Real-Time PCR: Basic Principles and Chemistries Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the

More information

Expression Array System

Expression Array System Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The

More information

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Introductory Next Gen Workshop

Introductory Next Gen Workshop Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

Introduction to Luminex xmap Technology and Applications for Biological Analysis in China

Introduction to Luminex xmap Technology and Applications for Biological Analysis in China Introduction to Luminex xmap Technology and Applications for Biological Analysis in China Sherry A. Dunbar and Dan Li Luminex Corporation develops, manufactures and markets innovative biological testing

More information

NovoCyte Flow Cytometer

NovoCyte Flow Cytometer NovoCyte Flow Cytometer The Flow Cytometer for Everyone 2 Experience the NovoCyte Advantage Focus on advancing your research. Let the flow cytometer do the rest. NovoCyte Flow Cytometer High Performance

More information

Rapid Cycle PCR, Real Time Analysis, and Hi-Res Melting

Rapid Cycle PCR, Real Time Analysis, and Hi-Res Melting Rapid Cycle PCR, Real Time Analysis, and Hi-Res Melting Carl Wittwer Department of Pathology University of Utah ARUP Idaho Technology AMP, Oct. 31, 2008 Impatient, Lazy, and Cheap Rapid Cycle PCR Fast

More information

Agilent s Mx3000P and Mx3005P

Agilent s Mx3000P and Mx3005P Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Uniparental disomy (UPD) analysis of chromosome 15

Uniparental disomy (UPD) analysis of chromosome 15 YOUR INNOVATIVE RESEARCH Analysis of UPD by STR-PCR Uniparental disomy (UPD) analysis of chromosome 15 Applied Biosystems 3500xL Genetic Analyzer Introduction Researchers at the Laboratory of Medical Genetics

More information

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

INFINITI System Assay for Factor II & Factor V Directional Package Insert (DPI)

INFINITI System Assay for Factor II & Factor V Directional Package Insert (DPI) INFINITI System Assay for Factor II & Factor V Directional Package Insert (DPI) For In Vitro Diagnostic Use Manufactured by AutoGenomics, Inc., 2251 Rutherford Road, Carlsbad CA USA 92008 Doc EM-34003

More information

AmoyDx TM JAK2 V617F Mutation Detection Kit

AmoyDx TM JAK2 V617F Mutation Detection Kit AmoyDx TM JAK2 V617F Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use Instructions Version: B1.0 Date of Revision: July 2012 Store at -20±2 o C -1/5- Background

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

All your genetic analyses on a single instrument

All your genetic analyses on a single instrument GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All your genetic analyses on a single instrument GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All on a single instrument Perform your genetic assays on one instrument A

More information

AmoyDx JAK2 Mutation Detection Kit

AmoyDx JAK2 Mutation Detection Kit AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use For Research Use Only and For Reference Only Instructions Version: B1.2 Date of Revision: June 2016

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping

LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off

More information

User Bulletin. Veriti 96-Well Thermal Cycler AmpFlSTR Kit Validation. Overview

User Bulletin. Veriti 96-Well Thermal Cycler AmpFlSTR Kit Validation. Overview User Bulletin Veriti 96-Well Thermal Cycler AmpFlSTR Kit Validation June 2009 SUBJECT: AmpFlSTR PCR Amplification Kit validation on the Veriti 96-Well Thermal Cycler with 0.2 ml sample block format In

More information

Newborn screening for spinal muscular atrophy

Newborn screening for spinal muscular atrophy Newborn screening for spinal muscular atrophy Kristina Mercer, MPH, PhD ORISE Fellow Newborn Screening Translational Research Initiative Newborn Screening and Molecular Biology Branch APHL Newborn Screening

More information

PERFORMANCE MADE EASY REAL-TIME PCR

PERFORMANCE MADE EASY REAL-TIME PCR PERFORMANCE MADE EASY REAL-TIME PCR The MyGo Pro real-time PCR instrument provides unmatched performance in a convenient format. Novel Full Spectrum Optics deliver 120 optical channels of fluorescence

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

TaqPath ProAmp Master Mixes

TaqPath ProAmp Master Mixes PRODUCT BULLETIN es es Applied Biosystems TaqPath ProAmp Master Mixes are versatile master mixes developed for high-throughput genotyping and copy number variation (CNV) analysis protocols that require

More information

determine optimum instrument settings for their own instruments and establish their own daily values.

determine optimum instrument settings for their own instruments and establish their own daily values. PC7 (770/488) SETUP KIT 6607121 PN 4299504-C FLOW CYTOMETER ALIGNMENT VERIFICATION FLUOROSPHERES FLOW CYTOMETER DETECTOR STANDARDIZATION FLUOROSPHERES INTENDED USE For Research Use Only. Not for use in

More information

QuantStudio 3D Digital PCR System

QuantStudio 3D Digital PCR System PRODUCT BULLETIN QuantStudio 3D Digital PCR System QuantStudio 3D Digital PCR System Absolutely attainable digital PCR Simple chip-based workflow no emulsion PCR Affordable low total cost of ownership

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Introducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Fast Real-Time PCR System

Introducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Fast Real-Time PCR System 7300/7500 Real-Time PCR Systems Introducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Real-Time PCR System Applied Biosystems 7500 Fast Real-Time

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Completing the performance picture.

Completing the performance picture. Completing the performance picture. AU5800 Clinical Chemistry Systems Blood Banking Centrifugation Chemistry Flow Cytometry Hematology Hemostasis Immunoassay Information Systems Lab Automation Molecular

More information

AmoyDx JAK2 Mutation Detection Kit

AmoyDx JAK2 Mutation Detection Kit AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instruction for Use For Research Use Only Instruction Version: B2.6 Revision Date: October 2013 Store at -20±5 Xiamen,

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Laboratory Validation. Chapter 16

Laboratory Validation. Chapter 16 Laboratory Validation Chapter 16 Importance The DNA profile is used to convict or free a suspect It must be perfect! No mistakes like we have in regular laboratories all the time Also DNA evidence must

More information

Mutations during meiosis and germ line division lead to genetic variation between individuals

Mutations during meiosis and germ line division lead to genetic variation between individuals Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements

More information

ON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS

ON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS ON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS David Canter, Di Wu, Tamara Summers, Jeff Rogers, Karen Menge, Ray Radtkey, and Ron Sosnowski Nanogen,

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

SeqStudio Genetic Analyzer

SeqStudio Genetic Analyzer SeqStudio Genetic Analyzer Optimized for Sanger sequencing and fragment analysis Easy to use for all levels of experience From a leader in genetic analysis instrumentation, introducing the new Applied

More information

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane

More information

Touchscreen (standalone capabilities, PIN-protected user accounts, and dye calibration/rnasep functionality)

Touchscreen (standalone capabilities, PIN-protected user accounts, and dye calibration/rnasep functionality) QuantStudio 3 & 5 Real-Time PCR Systems: The Basics Touchscreen (standalone capabilities, PIN-protected user accounts, and dye calibration/rnasep functionality) USB ports Overview of the QuantStudio TM

More information

3M Food Safety 3M Molecular Detection System. Pathogen testing. Pure and simple.

3M Food Safety 3M Molecular Detection System. Pathogen testing. Pure and simple. 3M Food Safety 3M Molecular Detection System Pathogen testing. Pure and simple. Food processing is your business. Food safety is ours. Consumers trust companies such as yours to deliver safe, quality foods

More information

Implementation of Automated Sample Quality Control in Whole Exome Sequencing

Implementation of Automated Sample Quality Control in Whole Exome Sequencing Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor

More information

Molecular Markers CRITFC Genetics Workshop December 9, 2014

Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating

More information

Introduction To Real-Time Quantitative PCR (qpcr)

Introduction To Real-Time Quantitative PCR (qpcr) Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular

More information

Genetic Fingerprinting

Genetic Fingerprinting Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.

More information

Genetic testing of Tay-Sachs disease by PCR and Restriction Digest

Genetic testing of Tay-Sachs disease by PCR and Restriction Digest Genetic testing of Tay-Sachs disease by PCR and Restriction Digest ESC102-PRA0103 Submitted to: Elizabeth Berndl 18 February, 2009 Submitted by: Laila Hulbert (996625077) Maria Yancheva (996742173) Scientific

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

BST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data

BST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%

More information

EGFR T790M mutation mutation detection by quantitative allele specific amplification (quasa) EGFR (T790M)

EGFR T790M mutation mutation detection by quantitative allele specific amplification (quasa) EGFR (T790M) Primerdesign TM Ltd EGFR T790M mutation mutation detection by quantitative allele specific amplification (quasa) EGFR (T790M) 50 tests For general laboratory and research use only 1 Contents Introduction

More information

RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)

RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information

More information

BRAF V600E mutation mutation detection by quantitative allele specific amplification (quasa) BRAF (V600E)

BRAF V600E mutation mutation detection by quantitative allele specific amplification (quasa) BRAF (V600E) Primerdesign TM Ltd BRAF V600E mutation mutation detection by quantitative allele specific amplification (quasa) BRAF (V600E) 50 tests For general laboratory and research use only 1 Contents Introduction

More information

Target Enrichment Strategies for Next Generation Sequencing

Target Enrichment Strategies for Next Generation Sequencing Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced

More information

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality

More information

Quality Control in Flow. Dr David Westerman Head of Haematopathology Peter MacCallum Cancer Centre

Quality Control in Flow. Dr David Westerman Head of Haematopathology Peter MacCallum Cancer Centre Quality Control in Flow Dr David Westerman Head of Haematopathology Peter MacCallum Cancer Centre Aims Quality Assurance Quality Control Literature In house competencies SHOT DATA 1996-2009 Ref: SHOT Annual

More information

HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit

HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit Instruction manual Cat. No: 6001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Roche, Applied Bio systems [ABI], Rotor-gene, Cepheid, Bioer,

More information

Pyrosequencing. Alix Groom

Pyrosequencing. Alix Groom Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases

More information

Amplification: MyiQ and iq5 Real-Time PCR Systems. MyiQ and iq 5 Real-Time PCR Detection Systems

Amplification: MyiQ and iq5 Real-Time PCR Systems. MyiQ and iq 5 Real-Time PCR Detection Systems Amplification: MyiQ and iq5 Real-Time PCR Systems MyiQ and iq 5 Real-Time PCR Detection Systems Genomic Research Solutions From Bio-Rad Bio-Rad is well known for making advanced genomic technologies accessible

More information

HiSeqTM 2000 Sequencing System

HiSeqTM 2000 Sequencing System IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance

More information

JAK2 V617F mutation mutation detection by quantitative allele specific amplification (quasa) JAK2(V617F)

JAK2 V617F mutation mutation detection by quantitative allele specific amplification (quasa) JAK2(V617F) Primerdesign TM Ltd JAK2 V617F mutation mutation detection by quantitative allele specific amplification (quasa) JAK2(V617F) 50 tests For general laboratory and research use only 1 Contents Introduction

More information

Development of Multiplex Sensitive Anti-Drug Antibody Assays for CRISPR/Cas9 Gene Therapies

Development of Multiplex Sensitive Anti-Drug Antibody Assays for CRISPR/Cas9 Gene Therapies Development of Multiplex Sensitive Anti-Drug Antibody Assays for CRISPR/Cas9 Gene Therapies September 27, 2017 Junxia Wang editasmedicine.com 1 Overview of the presentation Immunogenicity Introduction

More information

SYBR Green Realtime PCR Master Mix

SYBR Green Realtime PCR Master Mix Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection

More information

SYBR Premix DimerEraser (Perfect Real Time)

SYBR Premix DimerEraser (Perfect Real Time) Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.

More information

Next Generation Sequencing. Target Enrichment

Next Generation Sequencing. Target Enrichment Next Generation Sequencing Target Enrichment Next Generation Sequencing Your Partner in Every Step from Sample to Data NGS: Revolutionizing Genetic Analysis with Single-Molecule Resolution Next generation

More information

Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology

Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology Introduction Lateral Flow (LF) and similar assays represent a unique growing class of Point of Care (POC) tests designed to

More information

Getting high-quality cytogenetic data is a SNP.

Getting high-quality cytogenetic data is a SNP. Getting high-quality cytogenetic data is a SNP. SNP data. Increased insight. Cytogenetics is at the forefront of the study of cancer and congenital disorders. And we put you at the forefront of cytogenetics.

More information

Instructions for Use Life Science Kits & Assays

Instructions for Use Life Science Kits & Assays Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innumix Standard PCR MasterMix contains all reagents required for routine high throughput PCR amplifications

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Targeted Sequencing in the NBS Laboratory

Targeted Sequencing in the NBS Laboratory Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February

More information

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection

More information

Fundamentals of Next-Generation Sequencing: Technologies and Applications

Fundamentals of Next-Generation Sequencing: Technologies and Applications Fundamentals of Next-Generation Sequencing: Technologies and Applications Society for Hematopathology European Association for Haematopathology 2017 Workshop Eric Duncavage, MD Washington University in

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Mutation entries in SMA databases Guidelines for national curators

Mutation entries in SMA databases Guidelines for national curators 1 Mutation entries in SMA databases Guidelines for national curators GENERAL CONSIDERATIONS Role of the curator(s) of a national database Molecular data can be collected by many different ways. There are

More information

Antibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene. genesig Advanced Kit. 150 tests.

Antibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene. genesig Advanced Kit. 150 tests. TM Primerdesign Ltd Antibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Antibiotic

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM

Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM Miyono Hendrix Newborn Screening & Genetic Testing Symposium October 27, 2014 National Center for Environmental Health

More information

SYBR Advantage qpcr Premix. User Manual

SYBR Advantage qpcr Premix. User Manual User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company

More information

Primer Design Ameer Effat M. Elfarash

Primer Design Ameer Effat M. Elfarash Primer Design Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com PCR Cycle Each cycle (Round) of PCR contains 3 steps: 1- Denaturation 2- Primer annealing

More information

Interpretation of Results. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010

Interpretation of Results. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 Interpretation of Results Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 Instrumentation Cepheid Smartcycler Training Diagnostic testing Equivalency testing for

More information

Boundary-breaking acoustic focusing cytometry

Boundary-breaking acoustic focusing cytometry Boundary-breaking acoustic focusing cytometry Introducing the Attune NxT Acoustic Focusing Cytometer a high-performance system that s flexible enough for any lab One of the main projects in my laboratory

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Sus scrofa Pig genesig Advanced Speciation Kit

Sus scrofa Pig genesig Advanced Speciation Kit TM Primerdesign Ltd Pig genesig Advanced Speciation Kit 100 tests For general laboratory and research use only 1 Principles of the test Real-time PCR This kit provides a method for detecting mitochondrial

More information

Bio-Rad Laboratories BIOPLEX 2200 SYSTEM. BioPlex 2200 System. Workflow: Redefined

Bio-Rad Laboratories BIOPLEX 2200 SYSTEM. BioPlex 2200 System. Workflow: Redefined BioPlex 2200 System Workflow: Redefined Workflow: Redefined Leveraging the power of multiplex testing, the BioPlex 2200 system brings flexible workflow solutions to your laboratory. Disease Focused Multiplex

More information

High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours

High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As

More information

Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping

Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as

More information

Usp14 EPD0582_2_G09. EUCOMM/KOMP-CSD Knockout-First Genotyping

Usp14 EPD0582_2_G09. EUCOMM/KOMP-CSD Knockout-First Genotyping EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as

More information

AriaMx REAL-TIME PCR SYSTEM

AriaMx REAL-TIME PCR SYSTEM AriaMx REAL-TIME PCR SYSTEM TOTAL CONFIDENCE qpcr Built on Stratagene s legacy of enzyme engineering expertise and precision instruments, Agilent Technologies provides a comprehensive approach to real-time

More information

NRAS Codon 61 Mutation Analysis Reagents

NRAS Codon 61 Mutation Analysis Reagents NRAS Codon 61 Mutation Analysis Reagents User Manual V1.0 Cat No. GP19 32 reactions 1 CONTENTS Introduction 4 Overview of Mutector TM Assay 5 Materials Provided 6 Materials Required 7 Equipment Required

More information

Application Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar

Application Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar September Assay Portability on the BD FACSVerse System Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar Contents Summary Introduction 3 Objective 4 Methods 6 Results Discussion Conclusions

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

PowerPlex. Y System Validation

PowerPlex. Y System Validation PowerPlex Y System Validation By Patricia M. Fulmer, Dawn Rabbach, Kimberly Huston, Curtis Knox and Cynthia Sprecher, Promega Corporation Abstract We have improved the manufacturing process for the PowerPlex

More information