Multiplex Assay Design
|
|
- Kelley Kelly
- 6 years ago
- Views:
Transcription
1 Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011
2 Luminex Multiplexed Solutions. For Life. Luminex is the leader in microsphere-based multiplexing Luminex technology is used by researchers and physicians
3 Luminex Multiplex Assay Design Components of an multiplexed assay: Platform Technology Data Analysis Software
4 What is xmap Technology? Combination of multiple proven technologies Color-coded 5.6 micron microspheres 100 different colors, proprietary dyeing process Luminex 100/200 System Advanced optics, lasers, fluidics, DSPs, software The Luminex 100/200 is a class 1 (I) laser product.
5 The Luminex xmap Platform Derived from classical flow cytometry Faster hybridization kinetics due to quasi-solution phase reaction Beads Polystyrene/Magnetic 5.6/6.5 um diameter uniform dyed using a proprietary process Hardware is a simple benchtop flow analyzer fluidics optics digital signal processor Multiplexible from analytes High throughput 96-well microplate format Easily automatable Flexible open platform (array size can vary)
6 How Does xmap Technology Work? Microspheres are dyed to create 100 distinct colors Each microsphere has spectral address based on red/infrared content Microspheres are suspendable Microspheres are coated with capture reagent (oligo or antibody) Sample is added to microspheres Analyte is captured to microspheres Fluorescent reporter tag added
7 How Does xmap Technology Work? Microspheres are dyed to create 100 distinct colors Each microsphere has spectral address based on red/infrared content Microspheres are suspendable Microspheres are coated with capture reagent (oligo or antibody) Sample is added to microspheres Analyte is captured to microspheres Fluorescent reporter tag added
8 How Does xmap Technology Work? Microspheres are dyed to create 100 distinct colors Each microsphere has spectral address based on red/infrared content Microspheres are suspendable Microspheres are coated with capture reagent (oligo or antibody) Sample is added to microspheres Analyte is captured to microspheres Fluorescent reporter tag added
9 How Does xmap Technology Work? Assays are read using a compact microsphere analyzer Analyzer samples well Lasers excite fluorescent dyes- red laser for bead classification and green for assay result Multiple readings for each microsphere set Software reports results in real-time Up to 9600 results read in one hour The Luminex 100/200 is a class 1 (I) laser product.
10 How Does xmap Technology Work? Assays are read using a compact microsphere analyzer Analyzer samples well Lasers excite fluorescent dyes- red laser for bead classification and green for fluorescence detection Multiple readings for each microsphere set Software reports results in real-time Up to 9600 results read in one hour The Luminex 100/200 is a class 1 (I) laser product.
11 How Does xmap Technology Work? Assays are read using a compact microsphere analyzer Analyzer samples well Lasers excite fluorescent dyes- red laser for bead classification and green for assay result Multiple readings for each microsphere set Software reports results in real-time Up to 9600 results read in one hour
12 xmap Technology: Data collection Software sorts data by size scatter Events larger or smaller than microspheres are excluded Microsphere size is set by gate in each experiment Larger
13 Designing a Universal Sequence Set A combinatorial problem in that one must design N DNA tags such that: each tag hybridizes efficiently to its complementary anti-tag but not to any other of the N-1 anti-tags tags have similar melting temperature tags have similar lengths tags are not too similar to actual genes The universal tags have to be different enough to be distinguishable from one another and the genome but similar enough to be able to control their behavior under a single set of conditions. Tag = target; Anti-tag = probe
14 Designing a Universal Sequence Set All sequences will be 24mers Pattern matching/similarity thresholds no common subsequence with melting temp. above some fixed threshold no alignment with score above some fixed threshold Result is sets of minimally cross-hybridizing isothermal sequences
15 Benefits of Universal Arrays Single array needs optimized only once for all applications Compatible with multiple genotyping (front-end) chemistries Simplified manufacturing, QC Is a diagnostic industry standard Improved accuracy, S/N ratio Overcome back-end limits of multiplexing Sequences have been DESIGNED to work together Dramatically decreases development time for new products (ie. Lower costs for assay development)
16 The xtag Genotyping Platform BUILD THE REST B Universally-tagged, biotin-labelled representation of sample genomic DNA B Anti-Tag Tag FOUNDATION IS BUILT >
17 The xtag Genotyping Platform 5 Easy Steps I. Multiplex PCR II. Multiplex ASPE B B B B III. Universal Array Sorting B PE B PE IV. xmap Detection V. Data Analysis
18 Multiplex PCR 500 bp 400 bp Ladder 300 bp 250 bp 200 bp 175 bp Sample: Neg Single tube 16-plex PCR
19 Multiplex ASPE Genotyping Allele Specific Primer Extension 3 A PCR-amplified wt DNA 3 A T 3 T 3 3 Tag 1 A T T 3 Denature Anneal allele-specific tagged primers Tagged wt primer Tagged mut primer Tag 2 3 A T 3 Extend with DNA polymerase and biotin-dctp B 3 Tag 1 A T B Tag 2 3 A No extension
20 Universal Array Sorting Tag/Anti-Tag 1 B SA PE B SA PE Tag/Anti-Tag 3 Universal array made up of n different bead populations Tag/Anti-Tag 2
21 xtag Genotype Calling & Allelic Ratios Genotypes based on the allelic ratio (AR) for mutation in question AR is calculated by expressing the net signal from a given allele as a fraction of the total signal (wt and mut) for each mutation analyzed Both wt and mut AR s are calculated by TDAS to make calls AR ranges for genotype calling determined empirically for each mutation wt present AR wt = mut allele present AR mut = homozygous wt AR wt =
22 Allelic Ratios (AR) AR mut = Net MUT Signal Net MUT Signal + Net WT Signal AR mut Values WT Heterozygous MUT
23 Assay Format Summary 5 Steps: I II III IV V Genomic DNA Single tube Single tube xtag Universal Data Acquisition Data Analysis Whole blood Blood spots Mouthwash WGA Multiplex PCR Multiplex ASPE Array Sorting on Luminex xmap TDAS
24 Conclusions The combination of a bead-based platform with the universal array principle provides several benefits: Less development time for new application Higher accuracy (specificity in solution phase) Flexibility in array size High throughput Economical Simplifies array manufacturing and QC Open platform provides labs with an opportunity to build their own assays
25 What is TDAS LSM? Easy-to-use data analysis software for used with assays that are built on xtag technology Provide qualitative calls for samples based on raw signals (MFI median fluorescence intensity) acquired from the Luminex Analyzer. User can customize the analysis for their assays: Organize analytes into targets and panels Specify cut-offs for making calls Define call dependency rules 25
26 TDAS LSM features Load & analyze data file(s) Open detailed views Print / Export analysis result Primary negative control Security Access Control Command Line Custom assay configurations (LDTC) 26
27 TDAS LSM Analysis Module Signal-Based Analysis (SBA) Module Suitable for assays that have independent analytes for each target detection, e.g. infectious diseases, one analyte for each virus or bacteria Analyze sample data based on the analyte (probe) signals for a target Use MFI cutoffs to make calls Support signal-to-noise ratio Target can have one or multiple analytes Calls are made on target only 27
28 TDAS LSM Analysis Module Ratio-Based Analysis (RBA) Module Suitable for human genetics assays that use multiple analytes to detect the presence or absence of the variants, e.g. wild-type and mutant allele Analyze sample data based on the ratio of the analyte signals for a target SAT a Single Analyte Target can have either a wild-type analyte or a variant analyte MAT a Multiple Analyte Target could have at least one wild-type analyte and one variant analyte multiple analytes for variants only (MVT) 28
29 Thank You!
LATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationUF Center for Pharmacogenomics. Explanation of Services. UF Center for Pharmacogenomics Services
UF Center for Pharmacogenomics Explanation of Services Services are provided either as a price per sample or price per project, depending on the specific needs of the researcher. Basic a la carte services,
More informationPCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System
PCR SYSTEMS a new era in high-productivity qpcr Applied Biosystems ViiA 7 Real-Time PCR System a new era in high-productivity qpcr The ViiA 7 Real-Time PCR System delivers the proven reliability, sensitivity,
More informationGenPlex HID Training Class I
Rixun Fang GenPlex HID Training Class I Outline of Presentation Introduction GenPlex HID kit Experimental plan Class schedule Forensic SNP Analysis GenPlex HID Training Class I 2 Potential Forensic Applications
More informationQIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material
QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material MDA Technology Protocols Locus Bias Applications Kits & Service Summary QIAGEN REPLI-g WGA
More informationApplied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems
PRODUCT BROCHURE Real-Time PCR Systems Applied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems Real Fast. Real Versatile. Real Value. Real choices from the leader in real-time PCR. The latest
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More informationExpression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
More informationSNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationIntroduction to Luminex xmap Technology and Applications for Biological Analysis in China
Introduction to Luminex xmap Technology and Applications for Biological Analysis in China Sherry A. Dunbar and Dan Li Luminex Corporation develops, manufactures and markets innovative biological testing
More informationNovoCyte Flow Cytometer
NovoCyte Flow Cytometer The Flow Cytometer for Everyone 2 Experience the NovoCyte Advantage Focus on advancing your research. Let the flow cytometer do the rest. NovoCyte Flow Cytometer High Performance
More informationRapid Cycle PCR, Real Time Analysis, and Hi-Res Melting
Rapid Cycle PCR, Real Time Analysis, and Hi-Res Melting Carl Wittwer Department of Pathology University of Utah ARUP Idaho Technology AMP, Oct. 31, 2008 Impatient, Lazy, and Cheap Rapid Cycle PCR Fast
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationUniparental disomy (UPD) analysis of chromosome 15
YOUR INNOVATIVE RESEARCH Analysis of UPD by STR-PCR Uniparental disomy (UPD) analysis of chromosome 15 Applied Biosystems 3500xL Genetic Analyzer Introduction Researchers at the Laboratory of Medical Genetics
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationINFINITI System Assay for Factor II & Factor V Directional Package Insert (DPI)
INFINITI System Assay for Factor II & Factor V Directional Package Insert (DPI) For In Vitro Diagnostic Use Manufactured by AutoGenomics, Inc., 2251 Rutherford Road, Carlsbad CA USA 92008 Doc EM-34003
More informationAmoyDx TM JAK2 V617F Mutation Detection Kit
AmoyDx TM JAK2 V617F Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use Instructions Version: B1.0 Date of Revision: July 2012 Store at -20±2 o C -1/5- Background
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationAll your genetic analyses on a single instrument
GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All your genetic analyses on a single instrument GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All on a single instrument Perform your genetic assays on one instrument A
More informationAmoyDx JAK2 Mutation Detection Kit
AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use For Research Use Only and For Reference Only Instructions Version: B1.2 Date of Revision: June 2016
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationLightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping
LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off
More informationUser Bulletin. Veriti 96-Well Thermal Cycler AmpFlSTR Kit Validation. Overview
User Bulletin Veriti 96-Well Thermal Cycler AmpFlSTR Kit Validation June 2009 SUBJECT: AmpFlSTR PCR Amplification Kit validation on the Veriti 96-Well Thermal Cycler with 0.2 ml sample block format In
More informationNewborn screening for spinal muscular atrophy
Newborn screening for spinal muscular atrophy Kristina Mercer, MPH, PhD ORISE Fellow Newborn Screening Translational Research Initiative Newborn Screening and Molecular Biology Branch APHL Newborn Screening
More informationPERFORMANCE MADE EASY REAL-TIME PCR
PERFORMANCE MADE EASY REAL-TIME PCR The MyGo Pro real-time PCR instrument provides unmatched performance in a convenient format. Novel Full Spectrum Optics deliver 120 optical channels of fluorescence
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationTaqPath ProAmp Master Mixes
PRODUCT BULLETIN es es Applied Biosystems TaqPath ProAmp Master Mixes are versatile master mixes developed for high-throughput genotyping and copy number variation (CNV) analysis protocols that require
More informationdetermine optimum instrument settings for their own instruments and establish their own daily values.
PC7 (770/488) SETUP KIT 6607121 PN 4299504-C FLOW CYTOMETER ALIGNMENT VERIFICATION FLUOROSPHERES FLOW CYTOMETER DETECTOR STANDARDIZATION FLUOROSPHERES INTENDED USE For Research Use Only. Not for use in
More informationQuantStudio 3D Digital PCR System
PRODUCT BULLETIN QuantStudio 3D Digital PCR System QuantStudio 3D Digital PCR System Absolutely attainable digital PCR Simple chip-based workflow no emulsion PCR Affordable low total cost of ownership
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationIntroducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Fast Real-Time PCR System
7300/7500 Real-Time PCR Systems Introducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Real-Time PCR System Applied Biosystems 7500 Fast Real-Time
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationCompleting the performance picture.
Completing the performance picture. AU5800 Clinical Chemistry Systems Blood Banking Centrifugation Chemistry Flow Cytometry Hematology Hemostasis Immunoassay Information Systems Lab Automation Molecular
More informationAmoyDx JAK2 Mutation Detection Kit
AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instruction for Use For Research Use Only Instruction Version: B2.6 Revision Date: October 2013 Store at -20±5 Xiamen,
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationLaboratory Validation. Chapter 16
Laboratory Validation Chapter 16 Importance The DNA profile is used to convict or free a suspect It must be perfect! No mistakes like we have in regular laboratories all the time Also DNA evidence must
More informationMutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
More informationON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS
ON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS David Canter, Di Wu, Tamara Summers, Jeff Rogers, Karen Menge, Ray Radtkey, and Ron Sosnowski Nanogen,
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationSeqStudio Genetic Analyzer
SeqStudio Genetic Analyzer Optimized for Sanger sequencing and fragment analysis Easy to use for all levels of experience From a leader in genetic analysis instrumentation, introducing the new Applied
More informationTypical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides
Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane
More informationTouchscreen (standalone capabilities, PIN-protected user accounts, and dye calibration/rnasep functionality)
QuantStudio 3 & 5 Real-Time PCR Systems: The Basics Touchscreen (standalone capabilities, PIN-protected user accounts, and dye calibration/rnasep functionality) USB ports Overview of the QuantStudio TM
More information3M Food Safety 3M Molecular Detection System. Pathogen testing. Pure and simple.
3M Food Safety 3M Molecular Detection System Pathogen testing. Pure and simple. Food processing is your business. Food safety is ours. Consumers trust companies such as yours to deliver safe, quality foods
More informationImplementation of Automated Sample Quality Control in Whole Exome Sequencing
Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor
More informationMolecular Markers CRITFC Genetics Workshop December 9, 2014
Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationGenetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
More informationGenetic testing of Tay-Sachs disease by PCR and Restriction Digest
Genetic testing of Tay-Sachs disease by PCR and Restriction Digest ESC102-PRA0103 Submitted to: Elizabeth Berndl 18 February, 2009 Submitted by: Laila Hulbert (996625077) Maria Yancheva (996742173) Scientific
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationBST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%
More informationEGFR T790M mutation mutation detection by quantitative allele specific amplification (quasa) EGFR (T790M)
Primerdesign TM Ltd EGFR T790M mutation mutation detection by quantitative allele specific amplification (quasa) EGFR (T790M) 50 tests For general laboratory and research use only 1 Contents Introduction
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationBRAF V600E mutation mutation detection by quantitative allele specific amplification (quasa) BRAF (V600E)
Primerdesign TM Ltd BRAF V600E mutation mutation detection by quantitative allele specific amplification (quasa) BRAF (V600E) 50 tests For general laboratory and research use only 1 Contents Introduction
More informationTarget Enrichment Strategies for Next Generation Sequencing
Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationQuality Control in Flow. Dr David Westerman Head of Haematopathology Peter MacCallum Cancer Centre
Quality Control in Flow Dr David Westerman Head of Haematopathology Peter MacCallum Cancer Centre Aims Quality Assurance Quality Control Literature In house competencies SHOT DATA 1996-2009 Ref: SHOT Annual
More informationHELINI White spot Syndrome virus [WSSV] Real-time PCR Kit
HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit Instruction manual Cat. No: 6001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Roche, Applied Bio systems [ABI], Rotor-gene, Cepheid, Bioer,
More informationPyrosequencing. Alix Groom
Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases
More informationAmplification: MyiQ and iq5 Real-Time PCR Systems. MyiQ and iq 5 Real-Time PCR Detection Systems
Amplification: MyiQ and iq5 Real-Time PCR Systems MyiQ and iq 5 Real-Time PCR Detection Systems Genomic Research Solutions From Bio-Rad Bio-Rad is well known for making advanced genomic technologies accessible
More informationHiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
More informationJAK2 V617F mutation mutation detection by quantitative allele specific amplification (quasa) JAK2(V617F)
Primerdesign TM Ltd JAK2 V617F mutation mutation detection by quantitative allele specific amplification (quasa) JAK2(V617F) 50 tests For general laboratory and research use only 1 Contents Introduction
More informationDevelopment of Multiplex Sensitive Anti-Drug Antibody Assays for CRISPR/Cas9 Gene Therapies
Development of Multiplex Sensitive Anti-Drug Antibody Assays for CRISPR/Cas9 Gene Therapies September 27, 2017 Junxia Wang editasmedicine.com 1 Overview of the presentation Immunogenicity Introduction
More informationSYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
More informationSYBR Premix DimerEraser (Perfect Real Time)
Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.
More informationNext Generation Sequencing. Target Enrichment
Next Generation Sequencing Target Enrichment Next Generation Sequencing Your Partner in Every Step from Sample to Data NGS: Revolutionizing Genetic Analysis with Single-Molecule Resolution Next generation
More informationImproving the Limit of Detection of Lateral Flow Assays using 3DNA Technology
Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology Introduction Lateral Flow (LF) and similar assays represent a unique growing class of Point of Care (POC) tests designed to
More informationGetting high-quality cytogenetic data is a SNP.
Getting high-quality cytogenetic data is a SNP. SNP data. Increased insight. Cytogenetics is at the forefront of the study of cancer and congenital disorders. And we put you at the forefront of cytogenetics.
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innumix Standard PCR MasterMix contains all reagents required for routine high throughput PCR amplifications
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationTargeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
More informationPrincipals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
More informationFundamentals of Next-Generation Sequencing: Technologies and Applications
Fundamentals of Next-Generation Sequencing: Technologies and Applications Society for Hematopathology European Association for Haematopathology 2017 Workshop Eric Duncavage, MD Washington University in
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationMutation entries in SMA databases Guidelines for national curators
1 Mutation entries in SMA databases Guidelines for national curators GENERAL CONSIDERATIONS Role of the curator(s) of a national database Molecular data can be collected by many different ways. There are
More informationAntibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene. genesig Advanced Kit. 150 tests.
TM Primerdesign Ltd Antibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Antibiotic
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationNext Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM
Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM Miyono Hendrix Newborn Screening & Genetic Testing Symposium October 27, 2014 National Center for Environmental Health
More informationSYBR Advantage qpcr Premix. User Manual
User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company
More informationPrimer Design Ameer Effat M. Elfarash
Primer Design Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com PCR Cycle Each cycle (Round) of PCR contains 3 steps: 1- Denaturation 2- Primer annealing
More informationInterpretation of Results. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010
Interpretation of Results Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 Instrumentation Cepheid Smartcycler Training Diagnostic testing Equivalency testing for
More informationBoundary-breaking acoustic focusing cytometry
Boundary-breaking acoustic focusing cytometry Introducing the Attune NxT Acoustic Focusing Cytometer a high-performance system that s flexible enough for any lab One of the main projects in my laboratory
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationSus scrofa Pig genesig Advanced Speciation Kit
TM Primerdesign Ltd Pig genesig Advanced Speciation Kit 100 tests For general laboratory and research use only 1 Principles of the test Real-time PCR This kit provides a method for detecting mitochondrial
More informationBio-Rad Laboratories BIOPLEX 2200 SYSTEM. BioPlex 2200 System. Workflow: Redefined
BioPlex 2200 System Workflow: Redefined Workflow: Redefined Leveraging the power of multiplex testing, the BioPlex 2200 system brings flexible workflow solutions to your laboratory. Disease Focused Multiplex
More informationHigh-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours
High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As
More informationRamp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
More informationUsp14 EPD0582_2_G09. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
More informationAriaMx REAL-TIME PCR SYSTEM
AriaMx REAL-TIME PCR SYSTEM TOTAL CONFIDENCE qpcr Built on Stratagene s legacy of enzyme engineering expertise and precision instruments, Agilent Technologies provides a comprehensive approach to real-time
More informationNRAS Codon 61 Mutation Analysis Reagents
NRAS Codon 61 Mutation Analysis Reagents User Manual V1.0 Cat No. GP19 32 reactions 1 CONTENTS Introduction 4 Overview of Mutector TM Assay 5 Materials Provided 6 Materials Required 7 Equipment Required
More informationApplication Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar
September Assay Portability on the BD FACSVerse System Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar Contents Summary Introduction 3 Objective 4 Methods 6 Results Discussion Conclusions
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationPowerPlex. Y System Validation
PowerPlex Y System Validation By Patricia M. Fulmer, Dawn Rabbach, Kimberly Huston, Curtis Knox and Cynthia Sprecher, Promega Corporation Abstract We have improved the manufacturing process for the PowerPlex
More information