Supporting Information

Size: px
Start display at page:

Download "Supporting Information"

Transcription

1 Supporting Information Agemy et al /pnas SI Methods Cell Lines and Tumors. HUVEC (Lonza) were cultured using EBM- 2 medium with endothelial cell growth supplement (Lonza). Human astrocytoma cell line (U87) was grown in DMEM plus 10% FBS and 1% glutamine pen-strep (Invitrogen). Mouse GBMinitiating 005 cell line was established as previously described (1). The 005 cells were maintained in N2 medium, which contains DMEM/F-12 (Omega Scientific), 1% N2 supplement (Invitrogen), 20 ng/ml human FGF-2 (Peprotech), 20 ng/ml human EGF (Promega), and 40 μg/ml heparin (Sigma-Aldrich). T3 cells were obtained by differentiation induction of 005 cells cultured in EGM-2 (Lonza). Human GBM spheres were obtained and cultured as described previously (2). Mouse GBM-initiating 005 cells were transplanted into brains of nonobese diabetic (NOD)-SCID mice. A total of cells were suspended in 1.5 μl of PBS and injected stereotaxically in the right hippocampus. Human GBM spheres xenografts were created by injecting cells orthotopically into NOD-SCID mice in 1.5 μl of PBS.Animal experimentation was performed according to procedures approved by the Animal Research Committee at the University of California, Santa Barbara, The Sanford-Burnham Medical Research Institute, and The Salk Institute for Biological Research, San Diego, CA. Preparation of NWs. NWs coated with peptides were prepared as previously described (3, 4). Aminated NWs were pegylated with maleimide-5kpeg-nhs (JenKem Technology). Peptides were conjugated to the nanoparticles through a thioether bond between the cysteine thiol from the peptide sequence and the maleimide on the functionalized particles. Regarding quantification peptide on NWs, the aminated NWs were pegylated with OPSS-5KPEG-NHS (JenKem Technology). Peptides were conjugated to the nanoparticles through a disulfide bond between the cysteine thiol from the peptide sequence and the pyridyl sulfenyl protected thiol on the functionalized particles. The CGKRK D [KLAKLAK] 2 -NWs linked covalently through the disulfide linkage were treated with DTT. The concentration of free peptide thus obtained in the solution was estimated using fluorescence spectroscopy with a peptide standard curve. Magnetic Resonance Imaging. Mice bearing orthotopic 005 tumors were i.v. injected with CGKRK D [KLAKLAK] 2 -NW (5 mg iron/ kg). Approximately 5 h after NW injection, the mice were anesthetized with isoflurane and subjected to T2*-weighted MRI using the following parameters: 3D spoiled gradient echo sequence, time to repetition 40 ms, time to echo 18.6 ms, flip angle 15, bandwidth 115 Hz/pixel, 0.16 mm in-plane resolution, and 0.3-mm slice thickness (three slices averaged offline for improved signal/noise ratio). Mice were scanned in a Sigma HDx 3T whole body scanner (GE Healthcare) using a custom-made 3- cm-diameter volume coil. After imaging, tissues of interest were harvested and processed for H&E staining. In Vivo Matrigel Angiogenesis. Two-month-old BALB/c nu/nu mice were s.c. injected bilaterally in the inguinal area with 500 μl of Matrigel (Becton Dickinson) with or without 500 ng of recombinant human bfgf (Becton Dickinson) as an angiogenesis stimulant. The mice were treated every other day with PBS or CGKRK D [KLAKLAK] 2 nanoworms (NWs) (5 mg/kg) for 2 wk. At the end of treatment the mice were killed under anesthesia by perfusion through the heart with far-red fluorescent Alexa Fluor 647 isolectin GS-IB4 conjugate (Molecular Probes), followed by further perfusion with 10 ml of 4% paraformaldehyde. The Matrigel plugs were imaged by the Odyssey Infrared Imaging System (LI-COR Biotechnology), and for histological analyses, 7- to 10-μm sections were cut and viewed under a Fluoview 500 confocal microscope (Olympus America). The treatment and PBS control groups consisted of two mice (four plugs) in each of three independent experiments. Tube Formation Assay. Wells in 24-well plates were coated with 250 μl Matrigel (Becton Dickinson). human umbilical vein endothelial cells (HUVEC) were detached with trypsin (Lonza), washed with PBS, and 10 5 cells in EBM2 media supplemented as mentioned above were subsequently plated on top of the Matrigel in the presence of 5 or 10 μg/ml of NWs. The cells were incubated at 37 C for 24 h and photographed under a brightfield microscope at 40 magnification (Leica Microsystems). NW Toxicity Studies. Serum was collected from mice before treatment, 1 d after treatment ended, and 2 wk after treatment was concluded. L-Alanine-2-oxoglutarate aminotransferase (ALT) levels in serum were determined using Infinity ALT (GPT) Reagent (ThermoScientific) according to the manufacturer s instructions. The same serum samples were used to determine the levels of IL-6 using the Mouse IL-6 ELISA Set (BD OptEIA; BD Biosciences). Isolation of Mitochondria and Peptide/Phage Binding. Mitochondria were isolated from livers of BALB/c mice using differential centrifugation with buffers from a Pierce mitochondrial isolation kit for tissue according to the manufacturer s instruction (Pierce Biotechnology). To test the binding of the CGKRK peptide to mitochondria, purified mitochondria were preincubated with various concentrations of nonlabeled CGKRK or control peptide (CREKA) for 30 min at 4 C. FAM-CGKRK was then added and incubated for an additional 1 h. The binding of the FAM peptide was quantified by fluorescence. In phage binding assays, purified mitochondria were suspended in 10 ml DMEM supplemented with 1% BSA and incubated with pfu of peptide-displaying phage overnight at 4 C. The mitochondria were washed three times with DMEM/BSA, and the phage were collected with lysogeny broth containing 1% Nonidet P-40 and quantified by plaque assay. Immunoblot Analysis of NW-Bound Proteins. HUVEC were incubated 24 and 48 h with 10 mg/ml CGKRK D [KLAKLAK] 2 - NWs or CREKA-NW and lysed with RIPA buffer (Pierce) according to the manufacturer s instructions. The lysates were separated by SDS/PAGE. After transfer of the proteins onto nitrocellulose membranes for 2 h at 200 ma, the membrane was treated for 1 h at room temperature with TBS-0.05% Tween containing 5% milk and incubated with 1 mg/ml anti-caspase 3 (Cell Signaling). Biophotonic Tumor Imaging. Mice bearing luciferase-labeled GBM tumors received injections of 3 mg per mouse of freshly prepared luciferin substrate (Promega) suspended in PBS. The mice were then anesthetized with isofluorane and imaged using the Xenogen IVIS 100 Imaging System (Xenogen, Caliper Life Sciences), 10 min after i.p. injection of luciferin at a 1-min acquisition time in a small binning mode. Cell Proliferation Assay and Imaging. The MTT [3-(4,5-dimethylthazol-2-yl)-2,5-diphenyl tetrazolium-bromide] assay (Mo- 1of6

2 lecular Probes) was used to quantify cell proliferation. Cells were seeded in complete medium into 96-well plates ( cells per well) and allowed to attach overnight at 37 C in a humidified 5% CO 2 atmosphere. The culture medium was then removed, and various concentrations of peptides or NWs were added. After 48 and 72 h, 10 μl of the MTT reagent (5 mg/ml in PBS) was added to each well. The medium was removed from cells after 3 h, and 100 ml of DMSO:MEOH (1:1 vol/vol) were added to each well. The plates were read at a wavelength of 595 nm. For live cell imaging, cells were seeded on glass-bottom plates (Willco), and 24 h later the cells were washed and incubated with FAM-labeled peptides or NWs for 45 min at 37 C. The cells were then rinsed three times with PBS and incubated for an additional 15 min at 37 C with 500 nm MitoTracker Red (Molecular Probes) followed by nuclear staining with Hoechst DNA dyes (Molecular Probes) for 12 min. The cells were analyzed with Fluoview FV 500 confocal microscopy (Olympus America). 1. Marumoto T, et al. (2009) Development of a novel mouse glioma model using lentiviral vectors. Nat Med 15:110e Soda Y, et al. (2011) Transdifferentiation of glioblastoma cells into vascular endothelial cells. Proc Natl Acad Sci USA 108:4274e Agemy L, et al. (2010) Nanoparticle-induced vascular blockade in human prostate cancer. Blood 116:2847e Park JH, et al. (2009) Systematic surface engineering of magnetic nanoworms for in vivo tumor targeting. Small 5:694e700. Fig. S1. CGKRK peptide in normal organs. Mice bearing 005 tumors in the right hippocampus were i.v. injected with 200 μg of rhodamine-labeled CGKRK peptide. After 3 h the mice were perfused through the heart with PBS, and tissues were collected, sectioned, and analyzed for rhodamine fluorescence. Red, CGKRK peptide; blue, nuclei. n = 3. (Scale bars, 200 μm.) Fig. S2. CGKRK D [KLAKLAK] 2 -NWs in normal tissues of tumor-bearing mice. CGKRK D [KLAKLAK] 2 -NW (red) were injected into mice bearing 005 tumors, and tissues were collected and analyzed by confocal microscopy. Red, CGKRK D [KLAKLAK] 2 -NWs; blue, nuclei stained with DAPI. (Scale bars, 200 μm.) 2of6

3 Fig. S3. Homing of CGKRK-NWs to GBM tumors. (A) Iron oxide NWs coated with rhodamine-labeled CGKRK or D [KLAKLAK] 2 peptide were i.v. injected (5 mg iron per kg body weight) into mice bearing 005 tumors. Five to six hours after the injection the mice were perfused through the heart with PBS, and tissues were collected. Tumor sections were stained with anti-cd31 and examined by confocal microscopy. The NWs are red, tumor cells green, blood vessels magenta, and nuclei with DAPI blue. Arrows point at a representative tumor blood vessel that has accumulated CGKRK-NWs. (Scale bars, 200 μm.) (B) Quantification of NWs in 005 tumors. Percentage of particle-positive blood vessels was measured by confocal microscopy by analyzing five random areas in each tumor section (n =3). 3of6

4 Fig. S4. CGKRK D [KLAKLAK] 2 -NW conjugates induce cell death by apoptosis. HUVEC cells (A) and T3 cells (B) were left untreated (Control) or treated with 10 μg/ml of NWs coated with CGKRK D [KLAKLAK] 2 -NWs for 48 (A) or72h(b). (C) Cells were incubated with the indicated NWs, and after 30 min the cells were washed to remove excess NWs and then incubated for 72 h. Annexin V staining and analysis by flow cytometry were used to measure apoptosis in the cultures. Representative images indicating the percentage of annexin-positive cells (apoptotic and dead cells). Fig. S5. CGKRK D [KLAKLAK] 2 -NW conjugates inhibit in vitro and in vivo angiogenesis. (A) Tube formation assay using primary HUVEC plated on growth factorreduced Matrigel in 5% FCS medium alone (Control) or containing the indicated NW constructs. The formation of networks of capillary-like structures was viewed by phase-contrast microscopy at 40 magnification 24 h after plating. (B) Inhibition of in vivo Matrigel angiogenesis by CGKRK D [KLAKLAK] 2 -NWs. Matrigel plugs with or without bfgf were s.c. injected into BALB/c nu/nu mice. The mice were treated every other day with i.v. injections of either CGKRK D [KLAKLAK] 2 -NWs (5 mg/kg) or PBS. The mice were killed 14 d later and perfused with 647 Alexa isolectin. The Matrigel plugs were removed from the mice and viewed macroscopically under fluorescent light (Upper) or by confocal microscopy analysis of sections of the plugs (Lower). 4of6

5 Fig. S6. Toxicology analyses of mice treated with CGKRK D [KLAKLAK] 2 -NWs. (A) ALT levels measured before (Pre-treatment), after completion of a 3-wk treatment course (After treatment), and after a subsequent 2-wk recovery period (2 weeks after treatment). (B and C) Testing for possible active and innate immune responses against NW by measuring antibody (B) and IL-6 levels (C). The measure was done from serum of mice collected as in A. (D) H&E staining of the kidneys in PBS-treated control mice and mice treated with CGKRK D [KLAKLAK] 2 -NWs at the end of the treatment. Fig. S7. Apoptosis analysis of tumors from mice treated with D [KLAKLAK] 2 -NWs (control) and CGKRK D [KLAKLAK] 2 -NWs. Apoptosis was analyzed by TUNEL staining (magenta); GFP-expressing 005 tumor cells are green. (Scale bars, 50 μm.) 5of6

6 Fig. S8. Treatment of mice bearing intracranial U87 tumors with CGKRK D [KLAKLAK] 2 -NWs. Tumors were induced by injecting GFP-expressing U87 cells into the right hippocampus of mice. Treatment with i.v. injections of CGKRK D [KLAKLAK] 2 -NWs and control NWs was started 10 d after the tumor cell injection and continued every other day for 3 wk (n = 5 per group). Table S1. Quantification of NWs outside tumor vessels Percentage of penetrating NW Variable Excluding CD31 area Excluding twofold CD31 area CGKRK D [KLAKLAK] 2 -NWs + CRGDC 27% ± 10% 17% ± 6% CGKRK D [KLAKLAK] 2 -NWs + irgd 71% ± 4% 57% ± 15% CGKRK D [KLAKLAK] 2 -NWs were injected into mice bearing 005 tumors combined with a conventional RGD peptide (CRGDC; control) or irgd. NWs were detected in tumor sections by rhodamine fluorescence, and blood vessels were stained with anti-cd31. Percentage of penetrating NWs was calculated using the MetaMorph program. 6of6

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

This Document Contains:

This Document Contains: This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular

More information

In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay. Josephine MY Ko and Maria Li Lung *

In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay. Josephine MY Ko and Maria Li Lung * In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay Josephine MY Ko and Maria Li Lung * Clinical Oncology Department, The Univerisity of Hong Kong, Hong Kong, Hong Kong SAR *For

More information

Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis

Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined Hyperthermia for Enhanced Cancer Cell Apoptosis Birju P. Shah a, Nicholas Pasquale a, Gejing De b, Tao Tan b, Jianjie

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

MitoBiogenesis In-Cell ELISA Kit (Colorimetric)

MitoBiogenesis In-Cell ELISA Kit (Colorimetric) PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis

More information

In-Cell Western Assay

In-Cell Western Assay In-Cell Western Assay Complete Sample Protocol for Measuring IC 50 of Inhibitor U0126 in NIH3T3 Responding to Acidic Fibroblast Growth Factor (afgf-1) Developed for: Aerius, Odyssey Classic, Odyssey CLx,

More information

Supporting Information

Supporting Information Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the

More information

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR)

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product

More information

Initial genotyping of all new litters was performed by Transnetyx (Memphis,

Initial genotyping of all new litters was performed by Transnetyx (Memphis, SUPPLEMENTAL INFORMATION MURILLO ET AL. SUPPLEMENTAL EXPERIMENTAL PROCEDURES Mouse Genotyping Initial genotyping of all new litters was performed by Transnetyx (Memphis, USA). Assessment of LoxPpα recombination

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use

More information

Data Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618

Data Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618 Data Sheet Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 6618 Background The Hippo pathway regulates cell proliferation and cell death. It is activated by high cell density and cell stress to stop

More information

MyBioSource.com. Human VEGF ELISA Kit

MyBioSource.com. Human VEGF ELISA Kit Human VEGF ELISA Kit Catalog No.: MBS355343 Size: 96T Range: 31.2 pg/ml-2000 pg/ml (human serum, plasma, body fluids) 15.6 pg/ml-1000 pg/ml (cell culture supernates) Sensitivity < 1 pg/ml Storage and Expiration:

More information

BIO 315 Lab Exam I. Section #: Name:

BIO 315 Lab Exam I. Section #: Name: Section #: Name: Also provide this information on the computer grid sheet given to you. (Section # in special code box) BIO 315 Lab Exam I 1. In labeling the parts of a standard compound light microscope

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

In-Cell Western Kits I and II

In-Cell Western Kits I and II Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp

More information

Mitochondrial DNA Isolation Kit

Mitochondrial DNA Isolation Kit Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)

More information

Protocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation

Protocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation Protocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation In vitro neurological research presents many challenges due to the difficulty in establishing high-yield neuronal

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

Supplementary Figure Legend

Supplementary Figure Legend Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss

More information

Developing a real-time fluorescence cell growth monitoring system

Developing a real-time fluorescence cell growth monitoring system - 65 - Developing a real-time fluorescence cell growth monitoring system Jo-Ting Wang 1, Chun-Han Lu 2, Yao-Nan Wang 2, Ko-Tung Chang 1,* 1 Department of Biological Science and Technology, National Pingtung

More information

In Vitro Angiogenesis Assay Kit

In Vitro Angiogenesis Assay Kit In Vitro Angiogenesis Assay Kit Catalog Number KA1323 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

bfgf Supports Human ES Cell Self- Renewal

bfgf Supports Human ES Cell Self- Renewal APPLICATION NOTE Page 1 bfgf Supports Human ES Cell Self- Renewal Authors: Dongmei Wu, Wen Xiong, Yan Gao, Kristine Guerrero, Yi Chen, Liming Yang, Yang Liu, and Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

*Corresponding author. Tel: ;

*Corresponding author. Tel: ; 1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland

More information

TREVIGEN Instructions For Research Use Only. Not For Use In Diagnostic Procedures.

TREVIGEN Instructions For Research Use Only. Not For Use In Diagnostic Procedures. TREVIGEN Instructions For Research Use Only. Not For Use In Diagnostic Procedures. TACS TM XTT Cell Proliferation Assay Catalog # 4891-025-K, 2500 Tests The product accompanying this document is intended

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5 Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation Application Note Authors Yoonseok Kam 1, Ned Jastromb 1, Joe Clayton, Paul Held, and Brian P. Dranka 1 1 Agilent

More information

Calcein AM Cell Viability Kit

Calcein AM Cell Viability Kit Instructions For Research Use Only. Not For Use In Diagnostic Procedures Calcein AM Cell Viability Kit Catalog# 4892-010-K 1000 Tests* * Calculated based on using 1 μm final concentration of Calcein AM;

More information

PROTOCOL. Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) MS747 Rev.0 DESCRIPTION ADDITIONAL MATERIALS REQUIRED

PROTOCOL. Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) MS747 Rev.0 DESCRIPTION ADDITIONAL MATERIALS REQUIRED PROTOCOL Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS747 Rev.0 DESCRIPTION MAOB Enzyme Specific Activity Assay Kit Sufficient materials

More information

3D Mammary Colony-Forming Cell Assay Giusy Tornillo 1* and Sara Cabodi 2

3D Mammary Colony-Forming Cell Assay Giusy Tornillo 1* and Sara Cabodi 2 3D Mammary Colony-Forming Cell Assay Giusy Tornillo 1* and Sara Cabodi 2 1 Cardiff School of Biosciences, European Cancer Stem Cell Research Institute, Cardiff University, Cardiff, UK; 2 Department of

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Methods Materials Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Bovine fibroblast growth factor (BFGF), thrombin, forskolin, IBMX, H-89, BAPTA-AM and

More information

Human Granulin / GRN / Progranulin ELISA Pair Set

Human Granulin / GRN / Progranulin ELISA Pair Set Human Granulin / GRN / Progranulin ELISA Pair Set Catalog Number : SEKA10826 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized

More information

ab CFSE Fluorescent Cell Labeling Kit

ab CFSE Fluorescent Cell Labeling Kit ab113853 CFSE Fluorescent Cell Labeling Kit Instructions for Use For the durable fluorescent labeling of live cells for fluorescent microscopy and flow cytometry, population growth studies and within sample

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

Total Histone H3 Acetylation Detection Fast Kit (Fluorometric)

Total Histone H3 Acetylation Detection Fast Kit (Fluorometric) Total Histone H3 Acetylation Detection Fast Kit (Fluorometric) Catalog Number KA1539 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...

More information

Mouse ICAM-1 / CD54 ELISA Pair Set

Mouse ICAM-1 / CD54 ELISA Pair Set Mouse ICAM-1 / CD54 ELISA Pair Set Catalog Number : SEK50440 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Use of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity

Use of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity A p p l i c a t i o n N o t e Use of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity Brad Larson and Peter Banks, Applications Department, BioTek Instruments, Inc.,

More information

HiPer Sandwich ELISA Teaching Kit

HiPer Sandwich ELISA Teaching Kit HiPer Sandwich ELISA Teaching Kit Product Code: HTI014 Number of experiments that can be performed: 4 Duration of Experiment: 2 days Day1-Coating of wells: 15 minutes Day2- protocol, observation and result:

More information

RayBio Human bfgf ELISA Kit

RayBio Human bfgf ELISA Kit RayBio Human bfgf ELISA Kit User Manual (for Cell Lysate and Tissue Lysate) (Revised Mar 1, 2012) RayBio Human bfgf ELISA Kit Protocol (Cat#: ELH-bFGF-001C) RayBiotech, Inc. We Provide You With Excellent

More information

GFP Quantitation Kit, Fluorometric

GFP Quantitation Kit, Fluorometric Product Manual GFP Quantitation Kit, Fluorometric Catalog Number AKR- 12 1 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Green Fluorescent Protein (GFP) is a spontaneously

More information

Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent

Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent APPLICATION NOTE Page 1 Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent Authors: Amelia L. Cianci 1, Xun Cheng 1 and Kerry P. Mahon 1,2 1 Stemgent Inc.,

More information

Please read manual carefully before starting experiment

Please read manual carefully before starting experiment RayBio Cell-Based Phosphorylation ELISA Kit - Preliminary For the semi-quantitative detection of both phosphorylated and pan human, mouse or rat proteins in adherent whole cell lines. User Manual (Revised

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

Supporting Information

Supporting Information Supporting Information Groschwitz et al. 10.1073/pnas.0906372106 SI Methods In vitro permeability. Caco2-bbe human intestinal adenocarcinoma cells (ATCC) were maintained in DMEM supplemented with 10% FCS,

More information

Supporting information. Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo

Supporting information. Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo Supporting information Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo Greg Thurber 1, Katy Yang 1, Thomas Reiner 1, Rainer Kohler 1, Peter Sorger 2, Tim Mitchison

More information

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and

More information

ab Ran Activation Assay Kit

ab Ran Activation Assay Kit ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Supporting information

Supporting information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting information Near Infrared Light-responsive and Injectable Supramolecular Hydrogels for

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

EdU Flow Cytometry Kit. User Manual

EdU Flow Cytometry Kit. User Manual User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg

More information

Supplementary Table I: List of primers used for qpcr

Supplementary Table I: List of primers used for qpcr Supplementary Table I: List of primers used for qpcr Primer ABCG2 F ABCG2 R β Actin F β Actin R ALDH1A1 F ALDH1A1 R ALDH1A1 promoter F ALDH1A1 promoter R CD24 F CD24 R CD44 F CD44 R CXCR1 F CXCR1 R CXCR4

More information

Rat IGF-1 ELISA Kit (rigf-1-elisa)

Rat IGF-1 ELISA Kit (rigf-1-elisa) Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar

More information

Data Sheet. PD-1[Biotinylated]:PD-L2 Inhibitor Screening Assay Kit Catalog # Size: 96 reactions

Data Sheet. PD-1[Biotinylated]:PD-L2 Inhibitor Screening Assay Kit Catalog # Size: 96 reactions Data Sheet PD-1[Biotinylated]:PD-L2 Inhibitor Screening Assay Kit Catalog # Size: 96 reactions DESCRIPTION: Cell signaling through the PD-1 receptor upon binding the PD-L2 ligand attenuates immune responses

More information

TECHNICAL BULLETIN NUCLEI EZ PREP NUCLEI ISOLATION KIT. Product Number NUC-101 Store at 2-8 C

TECHNICAL BULLETIN NUCLEI EZ PREP NUCLEI ISOLATION KIT. Product Number NUC-101 Store at 2-8 C NUCLEI EZ PREP NUCLEI ISOLATION KIT Product Number NUC-101 Store at 2-8 C TECHNICAL BULLETIN Product Description Sigma s Nuclei EZ Prep Kit is designed for the rapid isolation of nuclei from mammalian

More information

Mitochondria/Cytosol Fractionation Kit

Mitochondria/Cytosol Fractionation Kit Mitochondria/Cytosol Fractionation Kit Sufficient for analysis of 50 samples Cat. No. MIT1000 FOR RESEARCH USE ONLY Not for use in diagnostic procedures. USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951)

More information

Endothelial Tube Formation Assay (In Vitro Angiogenesis)

Endothelial Tube Formation Assay (In Vitro Angiogenesis) Product Manual Endothelial Tube Formation Assay (In Vitro Angiogenesis) Catalog Number CBA-200 50 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Angiogenesis, or neovascularization,

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description

More information

Amaxa Basic Neuron SCN Nucleofector Kit

Amaxa Basic Neuron SCN Nucleofector Kit Amaxa Basic Neuron SCN Nucleofector Kit For Primary Neural Cells (Small Cell Number) SCN Nucleofector Kits are compatible with Nucleofector ll Devices of serial version S with software version S4 4 or

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

ips Cell Induction from Human Non-T, B Cells from Peripheral Blood Keisuke Okita *

ips Cell Induction from Human Non-T, B Cells from Peripheral Blood Keisuke Okita * ips Cell Induction from Human Non-T, B Cells from Peripheral Blood Keisuke Okita * Department of Reprogramming Science, Center for ips Cell Research and Application (CiRA), Kyoto University, Kyoto, Japan

More information

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION

More information

Cellular viability - WST-1 assay in NR8383 macrophages

Cellular viability - WST-1 assay in NR8383 macrophages Standard Operation Procedure (SOP): WP 4-Number 2 Date 07/01/2015 Version 1.0 Drafted within the project Oxidant generating capacity as a metric to allow grouping of nanomaterials and prediction of human

More information

Multiplexed volumetric bar-chart chip for point-of-care diagnostics

Multiplexed volumetric bar-chart chip for point-of-care diagnostics Supplementary Information Multiplexed volumetric bar-chart chip for point-of-care diagnostics Yujun Song 1, Yuanqing Zhang 1, Paul E. Bernard 1, James M. Reuben 2, 3, 4, Naoto T. Ueno 2, 3, Ralph B. Arlinghaus

More information

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means

More information

ingenio electroporation kits & solution

ingenio electroporation kits & solution ingenio electroporation kits & solution Electroporation x DEFINITION and OPTIMIZATION What is ELECTROPORATION? Electroporation is a physical method of nucleic acid transfer wherein the cells and nucleic

More information

Chapter - 9 IN VITRO CYTOTOXICITY ASSAY OF ZERUMBONE AND MDM3:1

Chapter - 9 IN VITRO CYTOTOXICITY ASSAY OF ZERUMBONE AND MDM3:1 Chapter - 9 IN VITRO CYTOTOXICITY ASSAY OF ZERUMBONE AND MDM3:1 9.1 INTRODUCTION 9.2 CHAPTER OBJECTIVE 9.3 MATERIALS AND METHODS 9.4 RESULT 9.5 DISCUSSION In Vitro Cytotoxicity Assay of Zerumbone and MDM

More information

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,

More information

Contents. The Right Surface for Every Cell Extracellular Matrices and Biologically Coated Surfaces ECM Mimetic and Advanced Surfaces...

Contents. The Right Surface for Every Cell Extracellular Matrices and Biologically Coated Surfaces ECM Mimetic and Advanced Surfaces... Contents The Right Surface for Every Cell... 1 Extracellular Matrices and Biologically Coated Surfaces... 2 Corning Matrigel Matrix... 2 Corning BioCoat Cultureware... 3 ECM Mimetic and Advanced Surfaces...

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences)

Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences) Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences) ANTI-FLAG High Sensitivity, M2 coated 96-well plate P 2983 Automation

More information

The preparation of native chromatin from cultured human cells.

The preparation of native chromatin from cultured human cells. Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the

More information

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham

More information

Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture. Catalog Number Guidelines for Use

Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture. Catalog Number Guidelines for Use Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture Catalog Number 354671 Guidelines for Use Discovery Labware, Inc., Two Oak Park, Bedford, MA 01730, Tel: 1.978.442.2200

More information

ab Ubiquitylation Assay Kit

ab Ubiquitylation Assay Kit ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.

More information

Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW)

Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Growth and Harvest Modifications Addendum to: Propagation of H7 hesc from UW

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

Human Pluripotent Stem Cell Functional Identification Kit

Human Pluripotent Stem Cell Functional Identification Kit Human Pluripotent Stem Cell Functional Identification Kit Catalog Number SC027B Reagents for the identification of human pluripotent stem cells by in vitro functional differentiation. This package insert

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1

More information

MEK1/2 (MAPK Kinase) Activity Assay Kit

MEK1/2 (MAPK Kinase) Activity Assay Kit MEK1/2 (MAPK Kinase) Activity Assay Kit For 96 tests Cat. No. SGT440 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0)

More information

Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis

Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis A p p l i c a t i o n N o t e Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis Brad Larson, BioTek Instruments, Inc., Winooski, VT USA Asha Sinha

More information

xcelligence Immunotherapy Kit - B Cell Killing Assay ASSAY MANUAL

xcelligence Immunotherapy Kit - B Cell Killing Assay ASSAY MANUAL xcelligence Immunotherapy Kit - B Cell Killing Assay ASSAY MANUAL Table of Contents I. List of Kit Components 2 II. Storage Conditions 3 III. Additional Materials & Reagents Required 3 IV. Introduction

More information

TACS MTT Assays. Cell Proliferation and Viability Assays. Catalog Number: TA tests. Catalog Number: TA tests

TACS MTT Assays. Cell Proliferation and Viability Assays. Catalog Number: TA tests. Catalog Number: TA tests TACS MTT Assays Cell Proliferation and Viability Assays Catalog Number: TA5355-2500 tests Catalog Number: TA5412-5000 tests This package insert must be read in its entirety before using this product. FOR

More information

Immunofluorescence of organoids embedded in Basement Membrane Matrix

Immunofluorescence of organoids embedded in Basement Membrane Matrix Immunofluorescence of organoids embedded in Basement Membrane Matrix Sol Degese 1, Gabe Benton 1 1 Organoid Resource Lab (ORL), Trevigen, Inc., 8405 Helgerman Court, Gaithersburg, MD 20877 Introduction

More information

LDH-Cytotoxicity Assay Kit II

LDH-Cytotoxicity Assay Kit II LDH-Cytotoxicity Assay Kit II Catalog Number KA0786 500 assays Version: 08 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

OxiSelect ROS Assay Kit

OxiSelect ROS Assay Kit Product Manual OxiSelect ROS Assay Kit Catalog Number STA-342 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Accumulation of reactive oxygen species (ROS) coupled with

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

Data Sheet. PD-1:PD-L1[Biotinylated] Inhibitor Screening Assay Kit Catalog # Size: 96 reactions

Data Sheet. PD-1:PD-L1[Biotinylated] Inhibitor Screening Assay Kit Catalog # Size: 96 reactions Data Sheet PD-1:PD-L1[Biotinylated] Inhibitor Screening Assay Kit Catalog # 72003 Size: 96 reactions DESCRIPTION: Cell signaling through the PD-1 receptor upon binding the PD-L1 ligand attenuates immune

More information

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry

More information