MBMB,BCHM, or CHEM 451A
|
|
|
- Earl Rogers
- 6 years ago
- Views:
Transcription
1 MBMB,BCHM, or CHEM 451A This is a team taught course Blaine Bartholomew: 1 st section Joseph Schmit: 2 nd section Peter Hardwicke:3 rd Section Text is Lehninger Principles of Biochemistry 4 th edition Supplementary material found in Genes VIII which is on reserve at Morris Library
2 Grading Each section is worth 100 points The final exam is worth 200 points You can drop one of the other exams for a total number of points possible being 400 points In my section the points are 30 points for homework and 70 point for my exam
3 Notes and other helps Notes will be posted on web at: _Sec1.html Suggested that you print out the lecture outline before class to help you with your in-class note taking Don t forget the suggested readings and problems
4 And other helps Instructor Blaine Bartholomew Office: Neckers Bldg., Rm. 211 Phone: Office Hours: Tues and Thurs 2-3 p.m. Teaching Assistant Mekonnen Dechassa Office: Neckers Bldg., Rm. 207 Phone: Office Hours: By appointment only
5 Science is question driven How does DNA encode for all the characteristics found within an organism?
6 Questions How is DNA read by the cell? What are the distinguishing features of DNA that accounts for its specificity? Are there certain chemical or mechanical properties of DNA that are vital in this process? What are those factors (proteins) that read DNA and how do they work
7 Foundations One must first understand the structural parameters of DNA and its physical properties. Next it is important to know what are the variations that can be found in nature
8 Chemical structure and base composition 1. Numbering system of nucleic acids 2. Phosphate linkages phosphoester bonds 3. nucleotide composition 4. sugar ring - pucker
9 Chemical structure and base composition 1. Numbering system of nucleic acids a. phosphate (alpha, beta, gamma)
10
11 Chemical structure and base composition 1. Numbering system of nucleic acids a. phosphate (alpha, beta, gamma) b. base (1,2,3,...)
12
13 Chemical structure and base composition 1. Numbering system of nucleic acids a. phosphate (alpha, beta, gamma) b. base (1,2,3,...) c. sugar (1', 2', 3',...)
14
15 Chemical structure and base composition 1. Numbering system of nucleic acids a. phosphate (alpha, beta, gamma) b. base (1,2,3,...) c. sugar (1', 2', 3',...) d. shorthand notation
16
17
18 Chemical structure and base composition 2. Phosphate linkages phosphoester bonds a. phosphomonoester bond b. phosphodiester bond c. phosphotriester bond
19
20 Chemical structure and base composition 3. nucleotide a. normal base composition
21
22 Chemical structure and base composition 3. nucleotide a. normal base composition b. modified bases
23 Modified Bases
24 Modified Bases
25 Chemical structure and base composition 3. nucleotide a. normal base composition b. modified bases c. tautomers
26 Tautomers
27 Chemical structure and base composition 4. sugar ring - a. nucleotide vs. nucleoside b. deoxyribose vs. ribose see figure 5-1 c. base-catalyzed hydrolysis of RNA (not DNA) due to 2'-OH of RNA d. ring pucker: endo vs. exo and C-3' vs C-2'
28 Nucleotide versus nucleoside
29 Chemical structure and base composition 4. sugar ring - a. nucleotide vs. nucleoside b. deoxyribose vs. ribose see figure 5-1 c. base-catalyzed hydrolysis of RNA (not DNA) due to 2'-OH of RNA d. ring pucker: endo vs. exo and C-3' vs C-2'
30
31 Chemical structure and base composition 4. sugar ring - a. nucleotide vs. nucleoside b. deoxyribose vs. ribose see figure 5-1 c. base-catalyzed hydrolysis of RNA (not DNA) due to 2'-OH of RNA d. ring pucker: endo vs. exo and C-3' vs C-2'
32 Alkaline Hydrolysis of RNA
33 Chemical structure and base composition 4. sugar ring - a. nucleotide vs. nucleoside b. deoxyribose vs. ribose see figure 5-1 c. base-catalyzed hydrolysis of RNA (not DNA) due to 2'-OH of RNA d. ring pucker: endo vs. exo and C-3' vs C-2'
34 Ring Pucker
35
36 Double Helical Structures 1. Watson Crick Structure: B-DNA a. antiparallel orientation, 3' vs 5' ends b. base pairing interactions i. always a purine-pyrimidine (steric constraints) ii. tautomeric forms of bases c. double helical parameters d. real DNA deviates from the ideal B-DNA form
37
38
39
40
41
42 Double Helical Structures 1. Watson Crick Structure: B-DNA c. double helical parameters i. helical sense: right vs left ii. major vs minor groove iii. base pairs per helical turn iv. helix rise per base pair or helical pitch distance from one step to the next v. helical twist: angle between two adjacent base pairs =360 deg/base pairs per turn vi. base tilt: slant of the step, not completely planar vii. glycosidic conformation: anti vs syn - figure 29-8 viii. sugar ring pucker: 4 out of 5 ring atoms are nearly planar the 5th atom is usually the C-2 or C-3 atom endo vs exo
43
44 Double Helical Structures 1. Watson Crick Structure: B-DNA d. real DNA deviates from the ideal B-DNA form i. local deviations are common ii. some DNA is naturally bent iii. deviations are sequence dependent
45 Double Helical Structures 1. Watson Crick Structure: B-DNA d. real DNA deviates from the ideal B-DNA form i. local deviations are common ii. some DNA is naturally bent iii. deviations are sequence dependent
46 Double Helical Structures 2. A-DNA a. wider and flatter than B-DNA i. very shallow minor groove ii. deeper major groove b. tilt is 20 deg (most tilted) c. dried out DNA, 75% vs 92% humidity d. flat ribbon wound around a 6 angstrom hole e. found in spores because of close packaging and RNA-RNA/RNA-DNA hybrids assume an A- DNA like structure
47
48
49
50 Double Helical Structures 3. Z-DNA a. Characteristics of i. occurs in alternating purine-pyrimidine tracts ii. favored in high salt;helps eliminate electrostatic repulsion of phosphate groups (8 vs 12 angstrom distance) iii. methylation of deoxycytidine helps formation of Z-DNA iv. phosphate backbone forms a zig-zag conformation
51 Double Helical Structures 3. Z-DNA b. double helical parameters i. syn vs. anti conformation purines flip to assume syn ii. helical sense is left handed iii. deep minor groove, no major groove c. biological role of Z-DNA i. unclear at this point ii. anti Z-DNA antibody detection, artifactual iii. methylation proved to be less artificial
52
53
54
55 Double Helical Structures 3. Z-DNA figure 29-3 a & b b. double helical parameters i. syn vs. anti conformation purines flip to assume syn ii. helical sense is left handed iii. deep minor groove, no major groove c. biological role of Z-DNA i. unclear at this point ii. anti Z-DNA antibody detection, artifactual iii. methylation proved to be less artificial
56 Double Helical Structures 4. Unusual DNA structures a. palindrome vs. mirror repeat i. example - placement of invert repeats ii. hairpin iii. cruciform b. Hoogsteen base pairing i. triplex formation - figure a and b ii. G tetraplex - found at telomeres c. Triple helix
57
58
59
60 Double Helical Structures 4. Unusual DNA structures a. palindrome vs. mirror repeat i. example - placement of invert repeats ii. hairpin iii. cruciform b. Hoogsteen base pairing i. triplex formation ii. G tetraplex - found at telomeres c. Triple helix
61
62
63 Double Helical Structures 4. Unusual DNA structures a. palindrome vs. mirror repeat i. example - placement of invert repeats ii. hairpin iii. cruciform b. Hoogsteen base pairing i. triplex formation - figure a and b ii. G tetraplex - found at telomeres c. Triple helix
64
65
66 Forces that help to form the DNA double helix 1. Rigid phosphate backbone 2. Stacking interactions - electronic interactions between planar bases 3. Hydrophobic interactions - highly negative phosphate backbone vs. nonpolar bases 4. Hydrogen bonding is not the most energetically significant component note: maintenance of distance from the two phosphate backbone requires Pur-Pyr 5. Ionic interactions - salt stabilizes the duplex form of DNA shielding of phosphate backbone
67 Denaturation and Renaturation 1. Tm: (melting temperature) temperature at which half of the DNA is melted Marmur-Doty equation for Tm correlated to G+C percent and salt Tm=41.1 XG+C log[na+] Denaturation is a cooperative process - caused by: heat, change in ph, organic solvents (urea, formamide) 3. Hyperchromic shift - increase of absorbance of DNA when it goes from being double- to single- stranded 40% increase in absorbance 4. Annealing:Hybridization
68
69
70
71
Gene and DNA structure. Dr Saeb Aliwaini
Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,
Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA.
DNA ORIENTATION Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA. Non-standard base pairs Wobble and mismatched base pairs still use
Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel
DNA Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC Canonical B DNA First determined experimentally by fiber
BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 10 Nucleic Acids
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 10 Nucleic Acids 2 3 DNA vs RNA DNA RNA deoxyribose ribose A, C, G, T A, C, G, U 10 3 10 8 nucleotides 10 2 10 4 nucleotides nucleus cytoplasm double-stranded
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur. Lecture - 16 Nucleic Acids - I
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur Lecture - 16 Nucleic Acids - I We start our discussion on Nucleic Acids and their components. Before we
1.1 Chemical structure and conformational flexibility of single-stranded DNA
1 DNA structures 1.1 Chemical structure and conformational flexibility of single-stranded DNA Single-stranded DNA (ssdna) is the building base for the double helix and other DNA structures. All these structures
Nucleotides and Nucleic Acids
ucleotides and ucleic Acids ucleotides: Composed of a sugar; a weak nitrogenous base; at least one phosphoryl group - - P - C 2 Base *ucleoside: sugar + base 2 Classes of ucleotides: Ribonucleotides and
Chapter 5: Nucleic Acids, etc.
Chapter 5: Nucleic Acids, etc. Voet & Voet: Sections 1 & 3 Pages 82-84 & 88-93 Any introductory Biochemistry textbook will have an introductory chapter on nucleic acids Slide 1 Nucleotides and Derivatives
Introduction to molecular. Dr Saeb Aliwaini
Introduction to molecular biology Dr Saeb Aliwaini Course description The principal aim of the course is to equip students with a basic knowledge of the molecular biology of the cells Course description
Nucleic Acids. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1
Nucleic Acids Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1 Topics : 2 hrs - Nucleic acid ----------------------------- Nucleic acid structure
Lecture 16 Nucleic acid polymers
Lecture 16 Nucleic acid polymers Key learning goals: Understand 1 and 2 structure of DNA and RNA chains, and how 3 structures arise Understand why DNA is a good genetic storage medium but RNA is much more
BASIC MOLECULAR GENETIC MECHANISMS Introduction:
BASIC MOLECULAR GENETIC MECHANISMS Introduction: nucleic acids. (1) contain the information for determining the amino acid sequence & the structure and function of proteins (1) part of the cellular structures:
Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No
Nucleotides: structure and functions Prof. Dalė Vieželienė Biochemistry department Room No. 229 Email: daleveze@med.kmu.lt Composition of Nucleic Acids Nucleotide structure Two types of nucleic acids:
BCH302 [Practical] 1
![BCH302 [Practical] 1](/thumbs/88/115407391.jpg "BCH302 [Practical] 1")
BCH302 [Practical] 1 2 DNA is made of 2 polynucleotide chains which run in opposite direction antiparallel. DNA has a double helical structure. Each polynucleotide chain of DNA consists of monomer units
Molecular Biology (1)
Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp. 49-52, 118-119, 130 What is molecular biology? Central dogma
Hmwk 6. Nucleic Acids
The purpose of this homework exercise is Hmwk 6. Nucleic Acids 1). to recognize fundamental features of B-form DNA and A-form RNA 2). to view the folded structure of trna B-FORM DNA In aqueous solutions,
Molecular Biology (1)
Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2018-2019 Resources This lecture Cooper, pp. 49-52, 118-119, 130 Nucleic acids 2 types: Deoxyribonucleic acid
BIOLOGICAL SCIENCE. Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge. FIFTH EDITION Freeman Quillin Allison
BIOLOGICAL SCIENCE FIFTH EDITION Freeman Quillin Allison 4 Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge In this chapter you will learn that Nucleic acids store the
DNA Structures. Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag. The Structural Conformations of DNA
DNA Structures Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag The Structural Conformations of DNA 1. The principle message of this lecture is that the structure of DNA is much more flexible
CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY
Chapter 4 Notes: Part 1 Biochemistry 461 Fall 2010 CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY 1) DNA/RNA structures, nomenclature, shorthand conventions 2) DNA and RNA as genetic
Chapter 02 The Molecular Nature of Genes
Chapter 02 The Molecular Nature of Genes Multiple Choice Questions 1. Experiments conducted by Frederick Griffith laid the foundation for A. elucidation of mrna structure. B. DNA as the genetic material.
Structural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
Structure of nucleic acids II Biochemistry 302. Bob Kelm January 21, 2005
Structure of nucleic acids II Biochemistry 302 Bob Kelm January 21, 2005 http://biochem.uvm.edu/courses/kelm/302 User: student PW: nucleicacid Secondary structure of RNAs antiparallel A-form Fig. 4.19
Structure of nucleic acids II Biochemistry 302. January 20, 2006
Structure of nucleic acids II Biochemistry 302 January 20, 2006 Intrinsic structural flexibility of RNA antiparallel A-form Fig. 4.19 High Temp Denaturants In vivo conditions Base stacking w/o base pairing/h-bonds
Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
(Due Sept 9 th ) Problem Set 2
Problem Set 2 (Due Sept 9 th ) 1. Consider these two polynucleotides: AAGCGT GCACTG a. Draw each molecule in the 2 deoxy form (DNA). SEE BELOW b. What is the sequence of the complementary strand? Write
Nucleic Acids. Information specifying protein structure
Nucleic Acids Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats) Genome - the genetic information of an organism Information
Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids
Chapter 19 Nucleic Acids Information specifying protein structure Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats)
Road to the Double Helix
Road to the Double Helix Watson and Crick Missing layer means alternating pattern (major & minor groove) Hydrogen bonding A pairs with T G pairs with C Double helix fits the data! Franklin and Wilkins
What Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
CHAPTER 8 Nucleotides and Nucleic Acids
CHAPTER 8 Nucleotides and Nucleic Acids Key topics Biological function of nucleotides and nucleic acids Structures of common nucleotides Structure of double-stranded DNA Structures of ribonucleic acids
Structural Bioinformatics GENOME 541 Spring 2018
Molecular composition of a rapidly dividing Escherichia coli cell Structural Bioinformatics GENOME 541 Spring 2018 Lecture 4: Nucleic Acids Frank DiMaio (dimaio@uw.edu) The major biopolymers DNA structure
Chapter 8 Nucleotides & Nucleic Acids
Chapter 8 Nucleotides & Nucleic Acids We Need Nucleic Acids! RNA rrna DNA RNA mrna Protein Protein Trait Pol trna DNA contains genes, the information needed to synthesize functional proteins and RNAs DNA
10BT43 Structural Biology
10BT43 Structural Biology Unit III Structure of Nucleic Acids 1. General characteristics of nucleic acid structures (A, T, G, C, U), Base-pairing 2. Base pairing types, glycosidic bond, Ribose puckering,
Nafith Abu Tarboush DDS, MSc, PhD
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush I. Hierarchical structure of nucleic acids II. Structures of nucleotides A. Purines & pyrimidines B. Nucleosides & nucleotides
Bi 8 Lecture 2. Nucleic acid structures: chemistry, space, time. Ellen Rothenberg 7 January 2016
Bi 8 Lecture 2 Nucleic acid structures: chemistry, space, time (evolution) Ellen Rothenberg 7 January 2016 Reading for 1 st two lectures Alberts, et al. (6 th edition) Ch. 4: pp. 173-186 & 216-236 Ch.
Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3.
Fig. 9-CO, p.215 Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3. What Is the Covalent Structure of Polynucleotides?
4. Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily:
CHEM 4420 Exam I Spring 2012 Page 1 of 5 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
Dina Al-Tamimi. Faisal Nimri. Ma amoun Ahram. 1 P a g e
1 Dina Al-Tamimi Faisal Nimri Ma amoun Ahram 1 P a g e **Difference between Molecular Biology and Genetics: Molecular Biology: is a fancy term of biochemistry. It is the science that deals with DNA, RNA
Assembly and Characteristics of Nucleic Acid Double Helices
Assembly and Characteristics of Nucleic Acid Double Helices Patterns of base-base hydrogen bonds-characteristics of the base pairs Interactions between like and unlike bases have been observed in crystal
Nafith Abu Tarboush DDS, MSc, PhD
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush I. Hierarchical structure of nucleic acids II. Structures of nucleotides A. Purines & pyrimidines B. Nucleosides & nucleotides
}Nucleosides NUCLEIC ACIDS. Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose
DNA STRUCTURE NUCLEIC ACIDS Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose Phosphates +nucleoside=nucleotide }Nucleosides The Sugars The
Nucleic Acids and the RNA World. Pages Chapter 4
Nucleic Acids and the RNA World Pages 74-89 Chapter 4 RNA vs. Protein Chemical Evolution stated that life evolved from a polymer called a protein. HOWEVER, now many scientists question this. There is currently
BCH Graduate Survey of Biochemistry
BCH 5045 Graduate Survey of Biochemistry Instructor: Charles Guy Producer: Ron Thomas Director: Marsha Durosier Lecture 17 Slide sets available at: http://hort.ifas.ufl.edu/teach/guyweb/bch5045/index.html
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning
Introduction to DNA. Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris
Introduction to DNA Lecture notes edited by John Reif from PPT lectures by: Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris Image from
Nucleic Acids. By Sarah, Zach, Joanne, and Dean
Nucleic Acids By Sarah, Zach, Joanne, and Dean Basic Functions Carry genetic information (DNA storing it) Protein synthesis Helps in cell division (DNA replicates itself) RNA- numerous functions during
MOLECULAR STRUCTURE OF DNA
MOLECULAR STRUCTURE OF DNA Characteristics of the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell (generation to generation) 2. Information Storage Biologically
MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB
MCB 110:Biochemistry of the Central Dogma of MB Part 1. DNA replication, repair and genomics (Prof. Alber) Part 2. RNA & protein synthesis. Prof. Zhou Part 3. Membranes, protein secretion, trafficking
GENETICS الفريق الطبي االكاديمي. DNA Genes & Chromosomes. DONE BY : Buthaina Al-masaeed & Yousef Qandeel. Page 0
GENETICS ومن أحياها DNA Genes & Chromosomes الفريق الطبي االكاديمي DNA Genes & Chromosomes DONE BY : Buthaina Al-masaeed & Yousef Qandeel Page 0 T(0:44 min) In the pre lecture we take about the back bone
CHEM 4420 Exam I Spring 2013 Page 1 of 6
CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids
Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA 2. Which two scientists discovered DNA? a. Mendel and Newton b. Bohr and Crick c. Watson and Crick
Syllabus for GUTS Lecture on DNA and Nucleotides
Syllabus for GUTS Lecture on DNA and Nucleotides I. Introduction. DNA is the instruction manual for how to build a living organism here on earth. The instructions in DNA are propagated to future generations
Understanding DNA Structure
Understanding DNA Structure I619 Structural Bioinformatics Molecular Biology Basics + Scale total length of DNA in a human cell is about 2m DNA is compacted in length by a factor of 10000 the compaction
Concept 5.5: Nucleic acids store and transmit hereditary information
Concept 5.5: Nucleic acids store and transmit hereditary information The amino acid sequence of a polypeptide is programmed by a unit of inheritance called a gene Genes are made of DNA, a nucleic acid
DNA and RNA are both made of nucleotides. Proteins are made of amino acids. Transcription can be reversed but translation cannot.
INFORMATION TRANSFER Information in cells Properties of information Information must be able to be stored, accessed, retrieved, transferred, read and used. Information is about order, it is basically the
Nucleotides and nucleic acid
Nucleotides and nucleic acid This is the last lecture for this week I wish you a blessed Eid and remarkable marks in the mid exam ;) this lecture is talking about nucleic acids and nucleotides. Dr.Ma'mon
Molecular biology (1)
Molecular biology (1) Color index: Doctors slides Notes and explanations Extra information highlights Objectives Know the central dogma of molecular biology. Understand the composition, types and structure
Sarah AlDosari SPECTRAL CHARACTERIZATION OF DNA
Sarah AlDosari SPECTRAL CHARACTERIZATION OF DNA DNA DEOXY RIBONUCLEIC ACID DEOXY RIBONUCLEIC ACID (DNA) DNA is made of 2 polynucleotide chains which run in opposite direction. DNA has a double helical
Nucleotides & Nucleic Acids. Central Dogma of Biology
Roles: Energy currency (ATP, GTP) Chemical links in response of cells to hormones (camp) Involved in cofactors (NAD, FAD, CoA) Metabolic intermediates (acetyl CoA) Constituents of nucleic acids, DNA and
BCMB Nucleic Acids - Chapter 33. DNA is the genetic component of life
BCMB 3100 - Nucleic Acids - Chapter 33 Discovery of DNA Nucleotides, nucleosides & bases Polynucleotides DNA as genetic material Structure of double-stranded DNA Chromatin RNA Nucleases 1 DNA is the genetic
Nucleic Acids. One-letter abbreviation. 1.1* Base / Nucleotide DNA / RNA / Both. 1.2* Base / Nucleotide DNA / RNA / Both
Chime 11 Name: Chapter 22 (please print) Nucleic Acids Read and answer each question carefully and thoroughly. Please do not crowd your answers. Use scratch paper to work out each problem and write the
Molecular biology (1)
2018/9/24 Molecular biology (1) Important. 436 Notes Original slides. 438 notes Extra information Objectives: Know the central dogma of molecular biology. Understand the composition, types and structure
NUCLEIC ACIDS: DNA AND RNA. HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University
NUCLEIC ACIDS: DNA AND RNA HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1 BUILDING BLOCKS OF NUCLEIC ACIDS 2 Nucleic Acids are important for
The Structure and Func.on of Macromolecules Nucleic Acids
The Structure and Func.on of Macromolecules Nucleic Acids The FOUR Classes of Large Biomolecules All living things are made up of four classes of large biological molecules: Carbohydrates Lipids Protein
8 Nucleotides and Nucleic Acids W. H. Freeman and Company
8 Nucleotides and Nucleic Acids 2013 W. H. Freeman and Company 1 Week 8 Nucleotides and Nucleic Acids 8.1 Some Basics 8.2 Nucleic Acid Structure 8.3 Nucleic Acid Chemistry 8.4 Other Functions of Nucleotides
BCMB Nucleic Acids - Chapter 33. DNA is the genetic component of life
BCMB 3100 - Nucleic Acids - Chapter 33 Discovery of DNA Nucleotides, nucleosides & bases Polynucleotides DNA as genetic material Structure of double-stranded DNA Chromatin RNA Nucleases 1 DNA is the genetic
Purines and Pyrimidines. DNA is the genetic component of life. BCMB Nucleic Acids - Chapter 33. DNA and RNA are made up of nucleotides
BCMB 3100 - Nucleic Acids - Chapter 33 DNA is the genetic component of life Discovery of DNA Nucleotides, nucleosides & bases Polynucleotides DNA as genetic material Structure of double-stranded DNA Chromatin
Chapter 11 Structure of Nucleic Acids
Reginald H. Garrett Charles M. Grisham Chapter 11 Structure of Nucleic Acids 11.1 How Do Scientists Determine the Primary Structure of Nucleic Acids? Two simple tools have made nucleic acid sequencing
The 4 S s Size Solubility Shape Stability
Lecture 24 (11/13/17) Reading: Ch1; 29-34 Ch8; 295-299 Ch9; 319-325, 346 Problems: Ch8 (text); 6,7,8,10 Ch8 (study-guide: applying); 1,3 Ch8 (study-guide: facts); 10,11 Ch9 (text); 1,2,3,4 Ch9 (study-guide:
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
Background: DNA hyperchromic & hypochromic effect: The stability of DNA structure:
Background: DNA is generally stable than RNA, but there are many chemical and physical factors affect the nucleic acids. The chemical factors that affect nucleic acids are such as hydrolysis by acids,
1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl
NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription
NUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl
NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription
UNIT 24: Nucleic Acids Essential Idea(s): The structure of DNA allows efficient storage of genetic information.
UNIT 24: Nucleic Acids Name: Essential Idea(s): The structure of DNA allows efficient storage of genetic information. IB Assessment Statements 2.6.U1 The nucleic acids DNA and RNA are polymers of nucleotides.
BIOCHEM SHEET (8) Made by: rahmeh Alsukkar corrected by: date : 11-10
BIOCHEM SHEET (8) Made by: rahmeh Alsukkar corrected by: date : 11-10 1 Note: Thursday it is a revision lecture slide 3 ( 5:11 min ) *nucleic acid is a monomer of DNA *nucleotide composed of :1-nitroenous
Review of ORGANIC CHEMISTRY
Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large
Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids
Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids Principal Investigator Paper Coordinators Prof. Sunil Kumar Khare, Professor, Department
Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.
BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid
Name: Date: Period:
Name: Date: Period: 1 2 3 4 5 The Structure of DNA Mind Map Using the words from our class brainstorm, categorize these ideas into clusters and create a mind map displaying what you already know about
Introduction to Bioinformatics. Lecture 20: Sequencing genomes
Introduction to Bioinformatics Lecture 20: Sequencing genomes Nucleic Acid Basics Nucleic Acids Are Polymers Each Monomer Consists of Three Moieties: Nucleotide A Base + A Ribose Sugar + A Phosphate Nucleoside
DNA & DNA : Protein Interactions BIBC 100
DNA & DNA : Protein Interactions BIBC 100 Sequence = Information Alphabet = language L,I,F,E LIFE DNA = DNA code A, T, C, G CAC=Histidine CAG=Glutamine GGG=Glycine Protein = Protein code 20 a.a. LIVE EVIL
Genes to Proteins. Nucleic Acid Structure
Genes to Proteins Pratt & Cornely Chapter 3 Nucleobase Nucleoside Nucleotide Nucleic acid Chromatin Chromosome Nucleic Acid Structure 1 Base Structure Purines and pyrimidines Aromatic Tautomers Nucleosides
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
Chapter 8 Nucleotides and Nucleic acids
Chapter 8 Nucleotides and Nucleic acids Start memorizing base structures and how they H-bond to complement There is a short organization homework for this chapter 8.0 Intro Nucleotides have many roles
Four Levels of Protein Structure
Primary structure (1 ) Four Levels of Protein Structure sequence of amino acids Secondary structure (2 ) ini8al folding alpha(α) helices or beta(β) sheets in the polypep8de chain Ter8ary structure (3 )
DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
Reading for lecture 2
Reading for lecture 2 1. Structure of DNA and RNA 2. Information storage by DNA 3. The Central Dogma Voet and Voet, Chapters 28 (29,30) Alberts et al, Chapters 5 (3) 1 5 4 1 3 2 3 3 Structure of DNA and
Chapter 5: The Structure and Function of Large Biological Molecules
Name Chapter 5 Guided Reading Chapter 5: The Structure and Function of Large Biological Molecules Section 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things
DNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
* What are the nucleic acids?
Nucleic Acids This lecture is meant to be a refreshment, it s a brief introduction to nucleic acids since we ll be given a full course about it next year in molecular biology. One last lecture and you
Lecture #17 10/12/01 Dr. Wormington
Lecture #17 10/12/01 Dr. Wormington DNA = Genetic Material & Mechanism of Replication Series of "Classical" Studies in Molecular Biology Avery, MacLeod & McCarty 1944 Griffith's "Transforming Principle"
RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.
The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,
Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids
Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic
The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
Nucleic acids are macromolecules composed of chains of mononucleotides joined by phosphodiester bonds. The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Nucleic acids are universal