Structure of nucleic acids II Biochemistry 302. Bob Kelm January 21, 2005
|
|
- Clifton Chad Golden
- 6 years ago
- Views:
Transcription
1 Structure of nucleic acids II Biochemistry 302 Bob Kelm January 21, 2005
2 User: student PW: nucleicacid
3 Secondary structure of RNAs antiparallel A-form Fig High Temp Denaturants In vivo conditions Base stacking w/o base pairing/h-bonds In vivo conditions Intra-strand base pairing
4 Ribose conformation (sugar pucker) differs in double-stranded RNA helices 2 3 H DNA is C2 endo 3 2 OH RNA is C3 endo 2 OH restricts C3 to endo
5 Structure of transfer RNA (trna) and the concept of self-complementarity Self-complementary regions form A-type antiparallel hairpins. Triple-base H-bonding & non-canonical bp Folding of helices produces a tertiary structure necessary for function. Fig Theoretical cloverleaf or cruciform structure Fig Yeast trna Phe 76 bases
6 Summary of secondary structures observed in DNA and RNA Sequence-independent B-form helix (DNA in vivo) A-form helix (DNA but only in vitro or in specific protein- DNA interactions) Stacked base or single-strand helix (RNA) Random coil (no secondary structure) Sequence-dependent A-form helix in dsrna and RNA-DNA hybrids RNA hairpins and cruciforms Z-DNA (5-mCG n repeats) DNA hairpins and cruciforms (rare) Triple helices and H-DNA (rare) G tetraplex
7 Sequences predicted to form hairpins and cruciforms inverted repeat w/ twofold symmetry Intrastrand bp single strand only symmetric sequence in each strand Palindrome = segments of complementary strands that are the reverse of one another Stability of extended DNA vs cruciform? Lehninger Principles of Biochemistry, 4th ed., Ch 24 Intrastrand bp both stands involved
8 Triple helical or H-DNA (regions of high Pur/Pyr asymmetry) N7, O 6, N 6 of purines known as Hoogsteen positions 1 6 C + = protonated C H-DNA formation produces a sharp bend (mutagenic, hotspot for DSBs) Fig Fig RNA can also form triple helices: polyu:polya:polyu This atom should be a purple nitrogen.
9 Concept of DNA stability DNA does not fall apart under physiological conditions of ph and ionic strength. but some inherent instability is built in. Why? Phosphate backbones of opposing DNA strands electrostatically repulsive (an effect reduced by dissolved counterions Na +, K +, Mg 2+ ). Random coil has a entropy. helix random coil G = H T S So, S > 0 & H elrep < 0 favors transition to random coil but H total > 0 because of H- bonding and van der Waals interactions between bps Lehninger Principles of Biochemistry, 4th ed., Ch 8
10 Concept of DNA thermal stability (practical perspective, DNA melting ) Note the sharp T m transition point which is indicative of a highly cooperative transition. Fig Hypochromism: Pur and Pyr rings of stacked bases absorb light less efficiently than unstacked bases or free nucleotides.
11 T m depends on base-pair composition AT-rich regions melt (i.e. denature) more easily than GC-rich regions. Why? At T m, G denat = 0 so 0 = H T m S and T m = H/ S S is the same for most polynucleotides on a per bp basis. H is higher for G C base pairs. Thermal stability of hybrids: RNA-RNA > RNA-DNA > DNA-DNA Fig. 4.32
12 Structural features of DNA molecules in living organisms Single or double-stranded Linear or circular Small or large 5243 bp for SV40 genome (circular, DS) 6407 b for bacteriophage M13 genome (circular, SS) 4.6 x 10 6 for E. coli genome (circular, DS) 6.5 x 10 7 bp for 1 fruit fly chromosome (linear, DS) 3.2 x 10 9 bp for 23 human chromosomes (linear, DS) B-form except where sequence dictates otherwise Relaxed or supercoiled E. coli cell (2 µm) chromosome (1.7 mm) Lehninger Principles of Biochemistry, 4th ed., Ch 24
13 Tertiary structure of DNA (supercoiling of the helix) Higher-order folding of regular secondary structural elements Supercoiling Twist of DNA strands around one another Extra twists in the helix itself Normal state of closed circular DNA molecules (to relieve strain of being underwound) Lehninger Principles of Biochemistry, 4th ed., Ch 24
14 Topological property of dsdna can be described quantitatively as L Twist (T) = # bp/10.5 bp/turn = # of helical turns in DNA of fixed length Writhe (W) = # superhelical turns required to restore original Twist Linking number (L) = # times strands of closed DNA are interlinked L = T + W Topoisomerases change L. Fig Unnatural twist or underwound by one turn to the left Right (-)
15 Utility of superhelical density (σ) G sc, free energy stored in supercoiling is proportional to superhelical density, G sc = Kσ 2 (σ = L/L 0 ) where L = # turns removed or added relative to # in relaxed DNA. When DNA is relaxed..σ = 0 so G sc = 0. Decreasing σ (local unwinding) reduces stored energy G sc. Imposing superhelical stress on DNA may thus promote Localized melting (AT-rich DNA) Formation of short stretches of Z-DNA (alternating CG n tract) Cruciform extension (palindromic sequences) H-DNA formation (asymmetric poly Pur/Pyr tract) Lehninger Principles of Biochemistry, 4th ed., Ch 24
16 Characteristics of naturally occurring circular DNA (e.g. plasmids, mito DNA) Underwound (common) Right-handed superhelical twist, negative supercoiling σ = 0.05 to 0.07 Overwound (rare) Left-handed superhelical twist, positive supercoiling Processive enzyme movement Exist as topoisomers Relaxed Supercoiled Topoisomerases Cut and reseal DNA Some (e.g. E.coli DNA gyrase) require ATP Plasmid DNA treated with type I topoisomerase for different times Lehninger Principles of Biochemistry, 4th ed., Ch 24
17 Tertiary structure of DNA in vitro and in vivo: importance of compaction Plectonemic ( twisted thread ) supercoiling pr otein Solenoidal supercoiling (greater compaction) Lehninger Principles of Biochemistry, 4th ed., Ch 24
18 Metazoans have major size and biological issues to contend with. Super-sized genome Fit 2 meters worth of DNA (~6 x 10 9 bp) into a nucleus ~8 µm in diameter Compaction solenoid Exquisite control of Gene Expression Maintain and regulate genetic programs essential to cell growth and differentiation Structure must accommodate chromosomal organization where only 5-10% of DNA is actually transcribed Lehninger Principles of Biochemistry, 4th ed., Ch 24
19 The Solution. Use special proteins to form chromatin Histones Small (~11-23 kda), basic, & highly conserved Building blocks of chromatin Subject to post-translational modification Five types core & linker Non-histone chromosomal proteins SMC (structural maintenance of chromosomes) proteins Cohesins link sister chromatids after replication Condensins mediate chromosome condensation as cells enter mitosis Polymerases and other nuclear enzymes plus gene regulatory proteins (e.g. transcription & remodeling factors, 1000 different proteins) Lehninger Principles of Biochemistry, 4th ed., Ch 24
20 Structure of the nucleosome core particle (histone octamer plus DNA) H3 H4 H2A H2B Octamer acts like a helical ramp K. Luger et al. (1997) Nature 389:251 Fig bp of DNA/octamer; 1.7 left-hand superhelical turns
21 Other features of nucleosome structure (2 nd level of organization) Histone core-dna binding is not random (positioned near clusters of A=T bp). Nucleosomes separated by 20 to 100 bp (but linker distance varies among organisms and cell types. Linker DNA is occupied by H1-type histones and other non-histone proteins. H1 plays important role in higher order organization (one H1/nucleosome core). Gene-specific nucleosomes occupy defined positions. Subject to remodeling. beads-on-a-string (3 rd level of organization) Lehninger Principles of Biochemistry, 4th ed., Ch 24
22 30 nm fiber ~100-fold DNA compaction (need 10 4 fold) Heterochromatin (condensed) Euchromatin (open) MARs (sites of topoisomerase action and gene activation) Fig Lehninger Principles of Biochemistry, 4th ed., Ch 24
Types of nucleic acid
RNA STRUCTURE 1 Types of nucleic acid DNA Deoxyribonucleic acid RNA ribonucleic acid HOCH 2 O OH HOCH 2 O OH OH OH OH (no O) ribose deoxyribose 2 Nucleic acids consist of repeating nucleotide that have
More informationChapter 5 DNA and Chromosomes
Chapter 5 DNA and Chromosomes DNA as the genetic material Heat-killed bacteria can transform living cells S Smooth R Rough Fred Griffith, 1920 DNA is the genetic material Oswald Avery Colin MacLeod Maclyn
More informationGenes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology
Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may
More informationChromatin. Structure and modification of chromatin. Chromatin domains
Chromatin Structure and modification of chromatin Chromatin domains 2 DNA consensus 5 3 3 DNA DNA 4 RNA 5 ss RNA forms secondary structures with ds hairpins ds forms 6 of nucleic acids Form coiling bp/turn
More informationGene Expression - Transcription
DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making
More informationNUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
More informationNucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.
BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid
More informationBCMB Nucleic Acids - Chapter 33. DNA is the genetic component of life
BCMB 3100 - Nucleic Acids - Chapter 33 Discovery of DNA Nucleotides, nucleosides & bases Polynucleotides DNA as genetic material Structure of double-stranded DNA Chromatin RNA Nucleases 1 DNA is the genetic
More informationChapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning
More informationRNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix
Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure
More informationCHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY
Chapter 4 Notes: Part 1 Biochemistry 461 Fall 2010 CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY 1) DNA/RNA structures, nomenclature, shorthand conventions 2) DNA and RNA as genetic
More informationDNA: The Genetic Material. Chapter 10
DNA: The Genetic Material Chapter 10 DNA as the Genetic Material DNA was first extracted from nuclei in 1870 named nuclein after their source. Chemical analysis determined that DNA was a weak acid rich
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationCanonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel
DNA Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC Canonical B DNA First determined experimentally by fiber
More informationTHE CELLULAR AND MOLECULAR BASIS OF INHERITANCE
Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS
More informationNUCLEUS. Fig. 2. Various stages in the condensation of chromatin
NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationOverview: Life s Operating Instructions Concept 16.1: DNA is the genetic material The Search for the Genetic Material: Scientific Inquiry
Overview: Life s Operating Instructions In 1953, James Watson and Francis Crick introduced an elegant double-helical model for the structure of deoxyribonucleic acid, or DNA DNA, the substance of inheritance,
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationMolecular Biology I. The Chemical Nature of DNA. Dr. Obaidur rahman
Molecular Biology I The Chemical Nature of DNA Dr. Obaidur rahman Characteristics of Genetic Material The coding instructions of all living organisms are written in the same genetic language that of nucleic
More informationChapter 9: DNA: The Molecule of Heredity
Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of
More informationChapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationStructural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
More informationWhat Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
More informationChemical organization of cells
The most frequent chemical elements of living cells are H, C, N, O, P, S that represent 99% of cell mass. This elements form the organic molecules: nucleic s, proteins, carbohydrates, and lipids. Organic
More informationFig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm
Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many
More informationThe DNA Molecule: The Molecular Basis of Inheritance
Slide hapter 6 he DN Molecule: he Molecular Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil ampbell and Jane Reece Lectures by hris Romero, updated by Erin Barley
More informationNucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,
More informationNucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
More information14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION
14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION Chapter Outline 14.1 ESTABLISHING DNA AS THE HEREDITARY MOLECULE Experiments began when Griffith found a substance that could genetically transform pneumonia
More informationDNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.
DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose
More informationThe replication of DNA Kornberg 1957 Meselson and Stahl 1958 Cairns 1963 Okazaki 1968 DNA Replication The driving force for DNA synthesis. The addition of a nucleotide to a growing polynucleotide
More informationThe Molecular Basis of Inheritance
The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;
More information4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.
1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.
More informationGenome Architecture Structural Subdivisons
Lecture 4 Hierarchical Organization of the Genome by John R. Finnerty Genome Architecture Structural Subdivisons 1. Nucleotide : monomer building block of DNA 2. DNA : polymer string of nucleotides 3.
More informationRNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm
RNA synthesis/transcription I Biochemistry 302 February 6, 2004 Bob Kelm Overview of RNA classes Messenger RNA (mrna) Encodes protein Relatively short half-life ( 3 min in E. coli, 30 min in eukaryotic
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationUnderstanding DNA Structure
Understanding DNA Structure I619 Structural Bioinformatics Molecular Biology Basics + Scale total length of DNA in a human cell is about 2m DNA is compacted in length by a factor of 10000 the compaction
More informationGENETICS الفريق الطبي االكاديمي. DNA Genes & Chromosomes. DONE BY : Buthaina Al-masaeed & Yousef Qandeel. Page 0
GENETICS ومن أحياها DNA Genes & Chromosomes الفريق الطبي االكاديمي DNA Genes & Chromosomes DONE BY : Buthaina Al-masaeed & Yousef Qandeel Page 0 T(0:44 min) In the pre lecture we take about the back bone
More information1. Mitosis = growth, repair, asexual reproduc4on
Places Muta4ons get passed on: Cell Reproduc4on: 2 types of cell reproduc4on: 1. Mitosis = growth, repair, asexual reproduc4on Photocopy machine Growth/Repair Passed on in the same body 2. Meiosis = sexual
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationDNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationReplication. Obaidur Rahman
Replication Obaidur Rahman DIRCTION OF DNA SYNTHESIS How many reactions can a DNA polymerase catalyze? So how many reactions can it catalyze? So 4 is one answer, right, 1 for each nucleotide. But what
More informationChapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".
Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationNucleic Acids. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1
Nucleic Acids Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1 Topics : 2 hrs - Nucleic acid ----------------------------- Nucleic acid structure
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationGenetic Information: DNA Structure and Function
Genetic Information: DA tructure and Function Umut Fahrioglu, hd Mc Genetic material There must be information stored in our cells such that when it is passed to new generation it influences the characteristic
More informationDNA Topoisomerases relieve the supercoiling stress ahead of the fork
DNA Topoisomerases relieve the supercoiling stress ahead of the fork Tw 1) T w : # of turns around the central axis 2) W r : # of times the double helix crosses itself 3) Linking Number: L k = T w + W
More informationBiology Lecture 2 Genes
Genes Definitions o Gene: DNA that codes for a single polypeptide/mrna/rrna/trna o Euchromatin: region of DNA containing genes being actively transcribed o Heterochromatin: region of DNA containing genes
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationNUCLEIC ACIDS: DNA AND RNA. HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University
NUCLEIC ACIDS: DNA AND RNA HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1 BUILDING BLOCKS OF NUCLEIC ACIDS 2 Nucleic Acids are important for
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More information5. Structure and Replication of DNA
BIO2310 General and Molecular Genetics 5. Structure and Replication of DNA Key questions: How was DNA shown to be the genetic material? How about RNA? How was the structure of DNA determined to be the
More informationDNA Chapter 12. DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B Griffith s Experiment
DNA Chapter 12 DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B.1.27 To truly understand genetics, biologists after Mendel had to discover the chemical nature of the gene. In 1928, Frederick Griffith was trying
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationThe Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines
DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic
More information* What are the nucleic acids?
Nucleic Acids This lecture is meant to be a refreshment, it s a brief introduction to nucleic acids since we ll be given a full course about it next year in molecular biology. One last lecture and you
More informationMCB 102 University of California, Berkeley July 28-30, Problem Set 6
MCB 102 University of California, Berkeley July 28-30, 2009 Isabelle Philipp Handout Problem Set 6 The answer key will be posted by Tuesday July 28. Try to solve the problem sets always first without the
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More information1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationDNA STRUCTURE AND REPLICATION
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 2 Chapter 16 Activity #2 BUILDING BLOCKS OF DNA: Nucleotides: NAME DATE PERIOD DNA STRUCTURE AND REPLICATION 1. 5 carbon sugar (deoxyribose) 2. Nitrogenous
More informationDNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.
DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationDNA Replication II Biochemistry 302. January 25, 2006
DNA Replication II Biochemistry 302 January 25, 2006 Following in Dad s footsteps Original A. Kornberg E. coli DNA Pol I is a lousy replicative enzyme. 400 molecules/cell but ~2 replication forks/cell
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationDNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationChapter 13 Active Reading Guide The Molecular Basis of Inheritance
Name: AP Biology Mr. Croft Chapter 13 Active Reading Guide The Molecular Basis of Inheritance Section 1 1. What are the two chemical components of chromosomes? 2. Why did researchers originally think that
More informationRNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.
The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationNucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
More informationReview of ORGANIC CHEMISTRY
Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large
More informationAnswers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.
Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish
More informationAnswers to the multiple choice questions are at the bottom of the last page of this document.
Review for Unit Test #2: Cell Parts, Functions and Protein Synthesis, Answers Answers to the multiple choice questions are at the bottom of the last page of this document. 1. Know all of the material on
More informationMCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB
MCB 110:Biochemistry of the Central Dogma of MB Part 1. DNA replication, repair and genomics (Prof. Alber) Part 2. RNA & protein synthesis. Prof. Zhou Part 3. Membranes, protein secretion, trafficking
More informationMolecular Genetics I DNA
Molecular Genetics I DNA Deoxyribonucleic acid is the molecule that encodes the characteristics of living things. It is the molecule that is passed from a mother cell to daughter cells, and the molecule
More informationThe structure, type and functions of a cell are all determined by chromosomes:
DNA Basics The structure, type and functions of a cell are all determined by chromosomes: They are found in the nucleus of a cell. These chromosomes are composed of DNA, the acronym for deoxyribonucleic
More informationDNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationDNA Replication I Biochemistry 302. Bob Kelm January 24, 2005
DNA Replication I Biochemistry 302 Bob Kelm January 24, 2005 Watson Crick prediction: Each stand of parent DNA serves as a template for synthesis of a new complementary daughter strand Fig. 4.12 Proof
More informationThe common structure of a DNA nucleotide. Hewitt
GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided
More informationCHAPTER 11 LECTURE SLIDES
CHAPTER 11 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationProblem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
More informationSection DNA: The Molecule of Heredity
Ch 11: DNA and Genes - DNA: The Molecule of Heredity Inside This Section... What is DNA? The Structure of DNA DNA Replication What is DNA? Acid DNA is the blueprint of all living organisms. It controls
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationChapter 8 Nucleotides & Nucleic Acids
Chapter 8 Nucleotides & Nucleic Acids We Need Nucleic Acids! RNA rrna DNA RNA mrna Protein Protein Trait Pol trna DNA contains genes, the information needed to synthesize functional proteins and RNAs DNA
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More information2012 GENERAL [5 points]
GENERAL [5 points] 2012 Mark all processes that are part of the 'standard dogma of molecular' [ ] DNA replication [ ] transcription [ ] translation [ ] reverse transposition [ ] DNA restriction [ ] DNA
More information