Nucleic Acids. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1
|
|
|
- Elfrieda Shaw
- 6 years ago
- Views:
Transcription
1 Nucleic Acids Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1
2 Topics : 2 hrs - Nucleic acid Nucleic acid structure Metabolism (Degradation and Biosynthesis) 1 hr - Gene and Chromosome 2 hrs - DNA Metabolism Replication DNA repair DNA recombination 2 hrs - RNA Metabolism Transcription Post transcriptional Modification 1 hr - Protein Metabolism Translation Post translational modification By Dr. Panida Graduated Biochemistry (4 credit) 16.6 of 100 % 16.6 % Homework and Class Attention (6.6%) + Exam (10%) or Only Exam 2
3 One of the hallmarks of living organism is their ability to reproduce. The information that make each individual life for unique must be preserved and passed on to progeny All life on Earth use Nucleic acids for storage of genetic information True or False? 3
4 Structural components of nucleic acids Nucleic acid Ribonucleic (RNA) and Deoxyribonucleic acid (DNA) Nucleotide Nucleotide Nucleotide Nucleotide Nucleotide Nucleotide Nucleotide (Nucleoside) Phosphate group Pentose -D-Ribose -D-Deoxyribose Nitrogenous base Purine (A,G) Pyrimidine (U, T, C) 4
5 Pentose sugar ( -D-Ribose and -D-Deoxyribose) (RNA Ribonucleic acid) (DNA Deoxyribonucleic acid) True or False? Hydrophilic nature of pentose sugar let allow water solubility for nucleoside, nucleotide and nucleic acid 5
6 Nitrogenous base Purine Pyrimidine 6
7 Purine and Pyrimidine base strongly absorb UV light To apply measurement nucleic acid concentration 7
8 Nucleic acid Ribonucleic (RNA) and Deoxyribonucleic acid (DNA) Nucleotide Nucleotide Nucleotide Nucleotide Nucleotide Nucleotide Nucleotide (Nucleoside) Phosphate group Pentose -D-Ribose -D-Deoxyribose Nitrogenous base Purine (A,G) Pyrimidine (U, T, C) 8
9 (Nucleoside) -D-Ribose -D-Deoxyribose glycosidic linkage Purine Pyrimidine N9 C1 (purine; A and G) (D-ribose and D-deoxyribose) N1 C1 (pyrimidine ; C,T and U) (D-ribose and D-deoxyribose) 9
10 Nucleside nomenclulature Purine ; Adenine, Gaunine and Hypoxanthine Add suffix osine of each bases name Pyrimidine ; Cytosine, Thymine (T), Uracil (U) Add suffix idine of each bases Base Ribonucluoside Deoxyribonucleoside Adenine Guanine Adenosine Guanosinie Deoxyadenosine Deoxyguanosine Cytosine Thymine Uracil Hypoxanthine Cytidine Ribothymidine Uridine Inosine Deoxycytidine Thymidine Deoxyinosine 10
11 (Nucleotide) -D-Ribose -D-Deoxyribose glycosidic linkage Purine Pyrimidine Ester bond Phosphate group Esterification between Phosphoric acid (HPO 4 2- ) and OH group of -D-Ribose and -D-Deoxyribose OH groups of Ribose --- Carbon positions : 2, 3, and 5 OH groups of Deoxyribose --- Carbon positions : 2, and Nucleoside Nucleotide 11
12 12
13 Type of Nucleotide and Nomenclature 1. Mononucleotide = Nucleoside + one phosphate group Nucloside Phosphate position monophosphate (NMP) Ribonucleoside Ribonucleotide (Ester) (Acid) Adenosine Guanosinie Adenosine 5'-monophosphate (AMP) Guanosine 5'-monophosphate (GMP) Adenylic acid Guanylic acid Cytidine Uridine Inosine Cytidine 5'-monophosphate (CMP) Uridine 5'-monophosphate (UMP) Inosine 5'-monophosphate (IMP) Cytidylic acid Uridylic acid Inosinic acid Adenosine 5'-monophosphate (AMP) Deoxyadenosine 5'-monophosphate (damp) 13
14 Type of Nucleotide and Nomenclature 2. Nucleoside Diphosphates and Triphosphates Nucleoside 5'-monophosphate (NMP) Nucleoside 5'-diphosphate (NDP) Nucleoside 5'-triphosphate (NDP) Adding one or two more phosphate groups connecting with Anhydride bond Nucleotide act as High energy compound such as ADP, ATP etc. 14
15 Type of Nucleotide and Nomenclature 2. Nucleoside Diphosphates and Triphosphates Adenine nucleotides are components of many enzyme cofactor in redox reaction Nicotinamide adenine dinucleotide phosphate (NADP + ) Nicotinamide adenine dinucleotide (NAD + ) Flavin adenine dinucleotide ( FAD) 15
16 3. Cyclic nucleotide Type of Nucleotide and Nomenclature OH group of C3 Ribose interact with C5 Phosohate group via ester bond Regulator molecule in signal transduction : 3, 5 Cyclic AMP and 3, 5 Cyclic GMP 16
17 Phosphodiester bond link successive nucleotide in Nucleic acid i 3, 5 phosphodiester bond link between the C3 OH of Nucleotide (i) and C5 Phosphate of Nucleotide (i+1) i +1 Stability of Nucleic acids The phosphodiester linkage in DNA is high stability and then make DNA suitable for the long term storage of genetic information Less stability of phosphodiester bond in RNA which more prone to hydrolysis by free C2 OH group 17
18 Shorthand notations for structure of Oligonucleotide ptpdgpdcpdapt = pdtgcat = p TGCAT 18
19 Deoxyribonucleotide ; DNA Genomic DNA (Linear DNA) Mitochondria DNA (Circular DNA) Chromosomal DNA (Circular DNA) Extrachromosomal DNA = Plasmid (Circular DNA) 19
20 DNA structure :
21 Minor groove Major groove 3 end 5 end Watson Crick double helix (Right handed double helix) The intertwinding of two right handed helical polynucleotide strands around a common axis and two strands are aligned in opposite direction or Anti-parallel) Intertwinding of two anti-parallel strands produces a structure that has two distinct helical groove between sugar and phosphate backbone Major groove Minor groove The stands achieve contact through hydrogen bonds formed at hydrophilic edges of the nitrogen bases (N-H) 3 end 5 end Watson-Crick base-pairing Adenine (A) --- Thymine (T) Guanine (G) --- Cytosine (C) 21
22 Tautomerization of nitrogenous base (Spontaneous proton shift between the adjacent C and N molecules) C C A A Keto enol Tautomer form Animo imino Tautomer form 22
23 Formation of hydrogen bonds between complementary bases in double stranded DNA Adenine (A) --- Thymine (T) Two H- bond 6 NH 2 O 4 1 N - NH Guanine (G) --- Cytosine (C) Three H bond 6 O NH NH - N
24 Conformation of Double helical DNA A form B form Z form Direction Right handed Right handed Left handed base pair per turn Base distance Low humidity High salt High Humidity Low salt 24
25 Noncanonical DNA structure Canonical B-DNA is not a straight, and uniform structure. It also forms unusual structures for providing the molecular recognition of DNA by proteins and enzyme Variations in DNA structure or conformation are favored by specific DNA sequence motif Inverted Repeat (Palindromes) : each DNA strand is self complementary within the inverted region that contains the symmetry element Palindromes Cruciforms DNA 25
26 Mirror sequence : Same base sequence when read either direction from the central point AGGCCAGCCGACCGGA AGGCCAGCGGACACAAAACGACCGGA Triple stranded DNA : require one strand that contain a homopurine sequence while the other two strand have homopyrimidine sequences Hoogsteen pairing (Non Watson and Crick Model) C-G-C T-A-T Homopurine sequence Hoogsteen paring (A : T) Hydrogen bond at position N7 and 6-NH 2 for adenine Homopyrimidine sequences 7 6 Hoogsteen paring (G: C) Hydrogen bond at position N7 and O6 for Guanine
27 Denaturation and Renaturation Denaturation : High Temperature / ph / Urea (Hyperchromism) (Hypochromism) Tm GC contents Biochemistry. 5th edition. Berg JM, Tymoczko JL, Stryer L. New York: W H Freeman;
28 Denaturation and Renaturation Different species of DNA show differ in midpoint temperature : Tm. This difference in Tm value is attributed to increase stability of guanine cytosine pair. 28
29 DNA act as Genetic material 29
30 DNA act as Genetic material 1952 Hershey and Chase --- > To prove DNA,is genetic material, store genetic information that can convert this information into protein for. 30
31 Ribonucleotide ; RNA RNA is a linear polymer of ribonucleotide monophosphate purine base in RNA are Adenine (A) and Guanine (G) pyrimidine bases are Cytosine (C) and Uracil (U) Many RNA contained modified nucleotide which are characteristic of stable RNA species (trna or rrna) Chemical difference between RNA and DNA are largely due to two factors Deoxyribose > Ribose Double stranded > Single stranded RNA acts as intermediary by using the information encoded in DNA to specific the amino acid sequence of a functional protein 31
32 Secondary Structure of RNA involves intramolecular Base paring Three Dimension Structure of RNA is Typical right-handed stacking pattern of single stranded RNA Self-complementary sequences in the molecule produce more complex structure.and lead to stability of RNA RNA can base pair with complementary region either RNA or DNA 32
33 Base pairing for RNA match the pattern for DNA But one difference in base pairing between G and U residue. The potential for base-paired helical structures in many RNA is extensive and the resulting hairpin are the most common type of secondary structure in RNA Base pairing helical structure in an RNA 33
34 RNA have Tertiary Structures Tertiary structure result form base stacking and hydrogen bonding between different part of the molecule. trna is folded into a compact L-shape conformation or cloverleaf stabilized by Watson and Crick base pairing and interaction involving more thank two nucleotides. 34
35 Types of RNAs RNA locate at Nucleus and Cytoplasm in Eukaryotic cells Type of RNA bases on their usual functions in a cells Type Sedimentation Coefficient Molecular Weight Number of Nucleotide Residues Percentage of Total Cell RNA mrna ,000 1,000, ~2 trna ~4 23,000 30, rrna , ,000 1,100, ,500 3,
36 Messenger RNA (mrna) mrna carry the genetic information for building primary structure of Proteins. mrna have relatively short life span Eukaryotic mrna have unique structural features. 5 Cap terminus, followed by a non-translated l reader containing a promoter sequence Coding (AUG-----UAA, UGA, UAG) Nontranslated trailer and poly A tail on the 3 end 36
37 Ribosomal RNA (rrna) Molecular component of the ribosome rrna provides a mechanism for decoding mrna into amino acids and interacts with trnas during translation by providing peptidyl transferase activity 37
38 Transfer RNA (trna) trna has two roles : Activating amino acid ; Enzyme catalyzed formation of aminoacyl trna activates amino acid for protein synthesis trna recognizes nucleotide sequence (codon) in mrna to ensure that the correct amino acid is incorporated into the growing peptide chain. 38
Structure and Function of Nucleic Acids
Structure and Function of Nucleic Acids E T Nyahangare Class Assignment 1. Write notes and outline the role of the following in protein biosynthesis a. DNA replication b. Transcription c. Genetic code
The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
Nucleic acids are macromolecules composed of chains of mononucleotides joined by phosphodiester bonds. The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Nucleic acids are universal
Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
NUCLEIC ACID METABOLISM. Omidiwura, B.R.O
NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid
What Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith
CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:
Lecture 8. Chromosome. The Nuclei. Two Types of Nucleic Acids. Genes. Information Contained Within Each Cell
Information Contained Within Each Cell Lecture 8 Nucleic Acids and Protein Synthesis Chapter 23: Section 1-5 Most higher organisms reproduce sexually! Sperm cell + Egg cell! Fertilized egg The wondrous
A. Incorrect! A sugar residue is only part of a nucleotide. Go back and review the structure of nucleotides.
Organic Chemistry - Problem Drill 24: ucleic Acids o. 1 of 10 1. What are the components of a nucleotide? (A) A sugar residue (B) A sugar residue + a nitrogenous base (C) A sugar residue + a nitrogenous
Dina Al-Tamimi. Faisal Nimri. Ma amoun Ahram. 1 P a g e
1 Dina Al-Tamimi Faisal Nimri Ma amoun Ahram 1 P a g e **Difference between Molecular Biology and Genetics: Molecular Biology: is a fancy term of biochemistry. It is the science that deals with DNA, RNA
Nucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
Chemistry of Heterocyclic Compounds. Porphyrins Purines and pyrimidines Nucleosides and nucleotides
Chemistry of Heterocyclic Compounds Porphyrins Purines and pyrimidines Nucleosides and nucleotides Introduction to Heterocyclic Compounds Cyclic compounds with one or more other elements along with carbon
Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
CHAPTER 8 Nucleotides and Nucleic Acids
CHAPTER 8 Nucleotides and Nucleic Acids Key topics Biological function of nucleotides and nucleic acids Structures of common nucleotides Structure of double-stranded DNA Structures of ribonucleic acids
8 Nucleotides and Nucleic Acids W. H. Freeman and Company
8 Nucleotides and Nucleic Acids 2013 W. H. Freeman and Company 1 Week 8 Nucleotides and Nucleic Acids 8.1 Some Basics 8.2 Nucleic Acid Structure 8.3 Nucleic Acid Chemistry 8.4 Other Functions of Nucleotides
Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No
Nucleotides: structure and functions Prof. Dalė Vieželienė Biochemistry department Room No. 229 Email: daleveze@med.kmu.lt Composition of Nucleic Acids Nucleotide structure Two types of nucleic acids:
Chemistry of Heterocyclic Compounds
Chemistry of Heterocyclic Compounds Porphyrins Purines and pyrimidines Nucleosides and nucleotides Introduction to Heterocyclic Compounds Cyclic compounds with one or more other elements along with carbon
Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids
Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic
From Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
Nucleic Acids. OpenStax College. 1 DNA and RNA
OpenStax-CNX module: m44403 1 Nucleic Acids OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 4.0 By the end of this section, you will be
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning
Chapter 17 Nucleic Acids and Protein Synthesis
Chapter 17 Nucleic Acids and Protein Synthesis Nucleic Acids Nucleic acids are the components that make up the genetic material DNA (deoxyribonucleic acid). DNA is a macromolecule which contains all the
Chapter 11. Nucleic Acids. Nucleotides. BCH 4053 Spring 2001 Chapter 11 Lecture Notes. Slide 1. Slide 2. Slide 3. Chapter 11, page 1
BC 4053 Spring 2001 Chapter 11 Lecture otes 1 Chapter 11 ucleotides and ucleic Acids 2 ucleic Acids Two classes DA (Deoxyribonucleic Acid) RA (Ribonucleic Acid) Polymers of nucleotides DA carries genetic
DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids
Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids Principal Investigator Paper Coordinators Prof. Sunil Kumar Khare, Professor, Department
Chapter 8 Nucleotides & Nucleic Acids
Chapter 8 Nucleotides & Nucleic Acids We Need Nucleic Acids! RNA rrna DNA RNA mrna Protein Protein Trait Pol trna DNA contains genes, the information needed to synthesize functional proteins and RNAs DNA
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
Nafith Abu Tarboush DDS, MSc, PhD
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush I. Hierarchical structure of nucleic acids II. Structures of nucleotides A. Purines & pyrimidines B. Nucleosides & nucleotides
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur. Lecture - 16 Nucleic Acids - I
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur Lecture - 16 Nucleic Acids - I We start our discussion on Nucleic Acids and their components. Before we
Part IV => DNA and RNA. 4.1 Nucleotide Properties 4.1a Nucleotide Nomenclature 4.1b DNA Sequencing
Part IV => DNA and RNA 4.1 Nucleotide Properties 4.1a Nucleotide Nomenclature 4.1b DNA Sequencing The Molecular Dogma of Life DNA carries genetic information in the form of its sequence of nucleotides
DNA and RNA Structure. Unit 7 Lesson 1
Unit 7 Lesson 1 Students will be able to: Explain the structure and function of the DNA and RNA. Illustrate the structure of nucleotide. Summarize the differences between DNA and RNA. Identify the different
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
The Structure and Func.on of Macromolecules Nucleic Acids
The Structure and Func.on of Macromolecules Nucleic Acids The FOUR Classes of Large Biomolecules All living things are made up of four classes of large biological molecules: Carbohydrates Lipids Protein
Concept 5.5: Nucleic acids store and transmit hereditary information
Concept 5.5: Nucleic acids store and transmit hereditary information The amino acid sequence of a polypeptide is programmed by a unit of inheritance called a gene Genes are made of DNA, a nucleic acid
BIOCHEM SHEET (8) Made by: rahmeh Alsukkar corrected by: date : 11-10
BIOCHEM SHEET (8) Made by: rahmeh Alsukkar corrected by: date : 11-10 1 Note: Thursday it is a revision lecture slide 3 ( 5:11 min ) *nucleic acid is a monomer of DNA *nucleotide composed of :1-nitroenous
BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 10 Nucleic Acids
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 10 Nucleic Acids 2 3 DNA vs RNA DNA RNA deoxyribose ribose A, C, G, T A, C, G, U 10 3 10 8 nucleotides 10 2 10 4 nucleotides nucleus cytoplasm double-stranded
DNA and RNA Structure Guided Notes
Nucleic acids, especially DNA, are considered as the key biomolecules that guarantee the continuity of life. DNA is the prime genetic molecule which carry all the hereditary information that's passed from
REVISION: DNA, RNA & MEIOSIS 13 MARCH 2013
REVISION: DNA, RNA & MEIOSIS 13 MARCH 2013 Lesson Description In this lesson we revise The structure and functions of DNA The structure of RNA and its role in protein synthesis The process of cell division
}Nucleosides NUCLEIC ACIDS. Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose
DNA STRUCTURE NUCLEIC ACIDS Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose Phosphates +nucleoside=nucleotide }Nucleosides The Sugars The
Nucleotides and Nucleic Acids
ucleotides and ucleic Acids ucleotides: Composed of a sugar; a weak nitrogenous base; at least one phosphoryl group - - P - C 2 Base *ucleoside: sugar + base 2 Classes of ucleotides: Ribonucleotides and
Paper 4: Biomolecules and Their Interactions Module 12: Bases, Sugars, Nucleosides and Nucleotides Introduction Nucleic acids are involved in storage
Paper 4: Biomolecules and Their Interactions Module 12: Bases, Sugars, Nucleosides and Nucleotides Introduction Nucleic acids are involved in storage and transfer of genetic information. The double helical
DNA Structure, Function, and Engineering Page /14/2018 Dr. Amjid Iqbal 1
DNA Structure, Function, and Engineering Page 40-51 2/14/2018 Dr. Amjid Iqbal 1 Background Organisms exhibit striking similarity at the molecular level. The structures and metabolic activities of all cells
Biomolecules: nucleotides
Biomolecules: nucleotides Nucleotides and nucleic acids Nucleic acids are linear hetero-polymers adapted to maintain and transmit the genetic information Depending on their sugar moiety they can be classified
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
Molecular biology (1)
Molecular biology (1) Color index: Doctors slides Notes and explanations Extra information highlights Objectives Know the central dogma of molecular biology. Understand the composition, types and structure
Nafith Abu Tarboush DDS, MSc, PhD
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush I. Hierarchical structure of nucleic acids II. Structures of nucleotides A. Purines & pyrimidines B. Nucleosides & nucleotides
Gene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
Chapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
* What are the nucleic acids?
Nucleic Acids This lecture is meant to be a refreshment, it s a brief introduction to nucleic acids since we ll be given a full course about it next year in molecular biology. One last lecture and you
Lecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6
Visual Anatomy & Physiology First Edition Martini & Ober Chapter 3 DNA & RNA Lecture 6 Lecture Overview What is the cell s genetic information? How/where is the genetic information stored in eukaryotic
DNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
Nucleic Acid Structure:
Nucleic Acid Structure: Purine and Pyrimidine nucleotides can be combined to form nucleic acids: 1. Deoxyribonucliec acid (DNA) is composed of deoxyribonucleosides of! Adenine! Guanine! Cytosine! Thymine
II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
BIOCHEMISTRY Nucleic Acids
BIOCHEMISTRY Nucleic Acids BIOB111 CHEMISTRY & BIOCHEMISTRY Session 17 Session Plan Types of Nucleic Acids Nucleosides Nucleotides Primary Structure of Nucleic Acids DNA Double Helix DNA Replication Types
C. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology
Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated
Molecular biology (1)
2018/9/24 Molecular biology (1) Important. 436 Notes Original slides. 438 notes Extra information Objectives: Know the central dogma of molecular biology. Understand the composition, types and structure
Nucleic Acid Structure:
Genetic Information In Microbes: The genetic material of bacteria and plasmids is DNA. Bacterial viruses (bacteriophages or phages) have DNA or RNA as genetic material. The two essential functions of genetic
RNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
Chemistry of Heterocyclic Compounds. Porphyrins Purines and pyrimidines Nucleosides and nucleotides
Chemistry of Heterocyclic Compounds Porphyrins Purines and pyrimidines Nucleosides and nucleotides Introduction to Heterocyclic Compounds. Cyclic compounds with one or more other elements along with carbon
Components of DNA. Components of DNA. Aim: What is the structure of DNA? February 15, DNA_Structure_2011.notebook. Do Now.
Aim: What is the structure of DNA? Do Now: Explain the Hershey Chase experiment and what was its conclusion? Homework Read pp. 298 299 P.299 3,4,6.7 Do Now Paperclip Combos Material: 8 paperclips, 2 each
How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
I. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
Nucleotides & Nucleic Acids. Central Dogma of Biology
Roles: Energy currency (ATP, GTP) Chemical links in response of cells to hormones (camp) Involved in cofactors (NAD, FAD, CoA) Metabolic intermediates (acetyl CoA) Constituents of nucleic acids, DNA and
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
3.1.5 Nucleic Acids Structure of DNA and RNA
alevelbiology.co.uk 3.1.5 Nucleic Acids 3.1.5.1 Structure of DNA and RNA SPECIFICATION Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are important information-carrying molecules. In all living
Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3.
Fig. 9-CO, p.215 Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3. What Is the Covalent Structure of Polynucleotides?
MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization
Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences
Gene and DNA structure. Dr Saeb Aliwaini
Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,
Nucleotide Metabolism Biochemistry by Lippincott pp
Nucleotide Metabolism Biochemistry by Lippincott pp 291-306 Metabolism: CONCEPT Ø Metabolism is the totality of an organism s chemical reactions. Ø A metabolic pathway begins with a specific molecule and
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
Unit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
Nucleic Acids. Information specifying protein structure
Nucleic Acids Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats) Genome - the genetic information of an organism Information
A nucleotide consists of: an inorganic phosphate group (attached to carbon 5 of the sugar) a 5C sugar (pentose) a Nitrogenous (N containing) base
Nucleic Acids! Nucleic acids are found in all living cells and viruses and the two main types are DNA and RNA. They are macromolecules made of chains of nucleotides bonded together. They carry genetic
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA 2. Which two scientists discovered DNA? a. Mendel and Newton b. Bohr and Crick c. Watson and Crick
Chapters 7 & 19 - Nucleosides, Nucleotides and Nucleic Acids
hapters 7 & 19 - ucleosides, ucleotides and ucleic Acids ucleosides, nucleotides and nucleic acids function as vitamins and coenzymes, energy carriers, second messengers, catalysts, and as genetic information
RNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids
Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic
Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids
Chapter 19 Nucleic Acids Information specifying protein structure Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats)
DNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
BASIC MOLECULAR GENETIC MECHANISMS Introduction:
BASIC MOLECULAR GENETIC MECHANISMS Introduction: nucleic acids. (1) contain the information for determining the amino acid sequence & the structure and function of proteins (1) part of the cellular structures:
Nucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,
NUCLEIC ACID. Subtitle
NUCLEIC ACID Subtitle NUCLEIC ACID Building blocks of living organisms One of the four important biomolecule 1 st isolated from the nuclei of white blood cells by Friedrich Miescher (1860) Came from the
MBMB,BCHM, or CHEM 451A
MBMB,BCHM, or CHEM 451A This is a team taught course Blaine Bartholomew: 1 st section Joseph Schmit: 2 nd section Peter Hardwicke:3 rd Section Text is Lehninger Principles of Biochemistry 4 th edition
Chapter 5: Nucleic Acids, etc.
Chapter 5: Nucleic Acids, etc. Voet & Voet: Sections 1 & 3 Pages 82-84 & 88-93 Any introductory Biochemistry textbook will have an introductory chapter on nucleic acids Slide 1 Nucleotides and Derivatives
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
MOLECULAR STRUCTURE OF DNA
MOLECULAR STRUCTURE OF DNA Characteristics of the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell (generation to generation) 2. Information Storage Biologically
X-Sheet 1 The Nucleus and DNA
X-Sheet 1 The Nucleus and DNA 1 Key Concepts: In this session we will focus on summarising what you need to know about: the Nucleus, genes, nucleic acids, RNA, DNA Terminology & definitions: Chromatin
The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
BIOLOGICAL SCIENCE. Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge. FIFTH EDITION Freeman Quillin Allison
BIOLOGICAL SCIENCE FIFTH EDITION Freeman Quillin Allison 4 Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge In this chapter you will learn that Nucleic acids store the
Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012
Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation
Chapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery