SUPPLEMENTARY INFORMATION

Transcription

1 doi:1.138/nture151 IL-1β (ng/ml) LFn-FlA Lp _WT LFn-FlA Lp _3A b Cell deth (%) LFn-FlA Lp _WT LFn-FlA Lp _3A Supplementry Figure 1. Effects of nthrx lethl fctor N- terminl domin-medited intrcellulr delivery of Legionell flgellin (LFn-FlA Lp ) on NLRC4 inflmmsome ctivtion. LPS-primed bone mrrow mcrophges (BMMs) derived from wild-type (WT, C57BL/6) or indicted d knockoutk mice were stimulted with LFn-FlA Lp in the presence of PA. ELISA ssy of IL-1 relese is shown in () nd percentges of cell deth mesured by LDH relese re show in (b); The 3A mutnt flgellin (L47A/L472A/L473A) is the sme s tht used in Fig. 1. Dt shown re men vlues ± SD (error br) from two (for (o ()) or three (for (b)) independent determintions. 1

2 t doi:1.138/nture151 LFn-FlA Lp +Tlr4 -/- BMM sirna Superntnt b Cell deth (%) LFn-FlA Lp +Tlr4 -/- BMM p1 sirna Supplementry Figure 2. Effects of sirna knockdown of NLRC4 or Nip5 on LFn-FlA Lp -induced inflmmsome ctivtion in Tlr4 -/- BMMs. Immortlized bone mrrow mcrophges (BMMs) derived from TLR4 knockout mice were trnsfected with indicted sirna for 6 h nd then stimulted with LFn-FlA Lp in the presence of PA. Superntnts were nlyzed for the mture form of cspse-1 (p1) by immunoblotting (). Percentges of cell deth mesured by LDH relese re show in (b) s men vlues ± SD (error br) from three independent determintions. The sirna used here is mixture of mnlrc4-w1 nd mnlrc4-w2 for NLRC4 nd Dhrmcon SMARTpool for Nip5 (Supplementry Tble 1). 2

3 1.2 b 1.2 c 1.2 mrna expression Reltive NLRC sirna Control NLRC4 mrna expression Reltive Nip sirna Control Nip5 Reltive Nip5 mrna expression shrna Control Nip5 Supplementry Figure 3. qrt-pcr nlyses of the knockdown efficiency of NLRC4- nd Nip5-trgeting sirnas or shrna. NLRC4- or Nip5- trgeting or control non-trgeting sirna ws trnsfected into immortlized Tlr4 -/- BMMs ( nd b). Shown in (c) re Nip5 stble knockdown immortlized BMMs generted by lentivirl shrna infection. The sirna used in () is mixture of mnlrc4-w1 nd mnlrc4-w2 nd tht in (b) is Dhrmcon SMARTpool for Nip5 (Supplementry Tble 1). Trgeting sequence of Nip5 shrna (c) is lso listed in Supplementry Tble 1. The mrna level of GAPDH ws used for normliztion. Shown re men vlues ± SD (error br) from three independent determintions. 3

4 b p1 Superntnt Lyste Cell deth (%) LFn-FlAFlA Lp Control sirna NLRC4 sirna LFn-FliCFliC st LFn-FliCFliC Ye Supplementry Figure 4. Cspse-1 ctivtion induced by intrcellulr delivery of LFn-tgged flgellin from S. typhimurium (LFn-FliC St )nd Y. enterocolitic (LFn-FliC2 Ye ) nd effects of sirna knockdown of NLRC4. Shown in () re immunoblots of culture superntnts (upper) nd totl cell lystes (lower) (nti-cspse-1 or nti-ctin) ctin) from wild-type primry BMMs. p1 denotes the processed mture form of cspse-1. Immortlized Tlr4 -/- BMMs stimulted with the three flgellins tested in () were used in (b). The sirna used here is mixture of mnlrc4-w1 nd mnlrc4-w2 (Supplementry Tble 1). Percentges of cell deth mesured by the lctte dehydrogense (LDH) relese re shown s men vlues ± SD (error br) from three independent determintions. Legionell flgellin (WT nd the 3A mutnt) ssyed in Fig. 1 ws included s controls. 4

5 1: FlA_WT (L. pneumophil) 1 m : FlA_3A (L. pneumophil) 2: FliC_WT (S. typhimurium) 2 m : FliC_3A (S. typhimurium) 3: FliC2 (Y. enterocolitic) 4: FliC (EPEC) 5: FliC (EHEC) 6: FliC (S. flexneri) 7: FliD (C. violceum) 8: Flgellin (Photorhbdus luminescens) 9: FliC (B. thilndensis) 1: FliC (type b) (P. eruginos) YC-ULW YC-ULWKH 2 2 m 1 m b Cell deth (%) c IL-1β (ng/ml) m m Supplementry Figure 5. The Nip5-intercting bility of different bcteril flgellins correltes with their ctivity of triggering inflmmsome ctivtion. () Yest two-hybrid interction ssys of Nip5 nd the different bcteril flgellins. Scchromyces cerevisie L4strinws trnsformed with plsmid combintions s illustrted (bit + prey). Activtion of the HIS3 reporter ws ssessed by growth in YC-ULWKH medi. Different bcteril flgellins tested re list on the left. (b nd c) Cell deth nd IL-1 relese ssys of intrcellulr delivery of LFn-tgged different bcteril flgellins into primry BMMs. Number denottion for different bcteril flgellins follows tht in (). Percentges of cell deth mesured by LDH relese in (b) re shown s men vlues ± SD (error br) from three independent determintions. IL-1 relese in culture superntnts shown in (c) were ssessed by ELISA ssy nd men vlues ± SD (error br) from two independent determintions re shown. 5

6 EPEC E2348/69 WT escn flic B. thilndensis E264 WT bipb flic/flic2 p1 Supplementry Figure 6. Flgellin-independent cspse-1 ctivtion in EPEC nd B. thilndensis infection. Immortlized wild-type BMMs nd J774.1 mcrophges were infected with indicted EPEC nd B. thilndensis strins, respectively. escn nd bipb re type III secretion-deficient EPEC E2348/69 nd B. thilndensis E264 strins, respectively. flic is the flgellin deletion EPEC mutnt strin while flic/flic2 is double deletion of flic nd flic2 in B. thilndensis. Shown is nti-cspse-1 immunoblot of culture superntnts. 6

7 b Myc-mNLRC4 + Myc- + Pro-IL-1β Myc-Nip5 + + Myc-NLRC Myc Pro-IL-1β LFn-FlA Lp WT 3A WT 3A WT 3A WT 3A Myc-Nip5 Myc-Nips LFn-FlA FlA Lp WT 3A WT 3A WT 3A WT 3A WT 3A Myc-Nips Myc-NLRC4 Myc-NLRC4 Myc- Myc- (For Fig. 3c) (For Fig. 3d) e Myc-mNLRC4 + Myc- + Pro-IL-1β Myc-Nips LFn-BsK Myc-Nips Myc-NLRC4 Myc- (For Fig. 4c) Supplementry Figure 7. Expression of trnsfected inflmmsome components in 293T/HeL cell reconstitution ssys of NLRC4 inflmmsome ctivtion. Pro-cspse-1, NLRC4 nd Nip proteins were ll tgged with n N-terminl Myc epitope. A replicte trnsfection for ech of the reconstitutions shown in Fig. 3c-d nd Fig. 4c ws subjected to nti-myc immunoprecipittion followed by nti-myc immunoblotting. 7

8 doi:1.138/nture151 mnlrc4++pro-il-1β - N i 5 Nip5 b LFn-FlALp 3A Pro-IL-1β Pro-IL-1β p17 p17 Myc-Nip5 Myc-NLRC4 WT WT WT WT WT WT WT Nip5 & vrints NLRC4 & vrints Myc- Myc- Supplementry Figure 8. Assy of different bcteril flgellins () nd trunction nlyses of NLRC4 nd Nip5 (b) using flgellin-stimulted ctivtion of NLRC4 inflmmsome reconstituted in 293T cells. The three bcteril flgellin proteins nd their functionlity in mcrophges re described in Supplementry Fig. 2. Pro-cspse-1, NLRC4 nd Nip proteins were ll tgged with n N-terminl Myc epitope. A replicte trnsfection for ech of the reconstitutions ws subjected to nti-myc immunoprecipittion followed by ntimyc immunoblotting shown in the lower pnels. 8

9 2 2 m 1: FlA_WT (L. pneumophil) YC-ULWKH YC-ULW 1 m : FlA_3A (L. pneumophil) 2: FliC_WT (S. typhimurium) 2 m : FliC_3A (S. typhimurium) 1 m 3 3: 5: FliC2 (Y. enterocolitic) FliC (EHEC) 4: 6: FliC (EPEC) FliC (S. flexneri) : Flgellin (Photorhbdus luminescens) 8 6 8: FliC (B. thilndensis) 7 9: FliC (type b) (P. eruginos) Supplementry Figure 9. Yest two-hybrid interction ssys of Nip6 nd different bcteril flgellins. Number denottion for different flgellins is listed on the left nd dt were presented similrly s in Fig

10 Supplementry Figure 1. Phylogenetic tree of the Nip fmily. ClustlW multiple sequence lignment of Nip1, Nip2, Nip5 (corresponding to the C57BL/6 llele) nd Nip6 ws crried out to generte the phylogenetic tree using the Neighbor Joining method, both of which were performed in the McVector progrm. The uncorrected ( P ) method ws used to clculte the pirwise distnce. The distnce number listed in the dendrogrm ws generted from the uncorrected ( P ) vlue nd estimtes the proportionl differences between sequences. Nip1, Nip5 nd Nip6 contin 143 mino cids while Nip2 hs 1447 mino cids with 44-residue insertion between the third BIR domin nd the NOD domin. Nip6 nd Nip5 re the most similr with sequence identify of 94.7%. Nip1 nd Nip2 re more distntly relted nd hrbor 87.% nd 8.3% sequence identity, respectively, to Nip5. 1

11 BMM WT Nlrc4 -/- LFn-FlA Lp WT 3A LFn-BsK + + b Cell Vibility (%) LFn-BsK p1 sirna Supplementry Figure 11. Effects of nthrx lethl fctor N- terminl domin-medited intrcellulr delivery of TTSS rod protein BsK (LFn-BsK) on NLRC4 inflmmsome ctivtion. () LPS-primed bone mrrow mcrophges (BMMs) derived from wild-type (WT, C57BL/6) or Nlrc4 -/- mice were used nd culture superntnts were nlyzed for the mture form of cspse-1 (p1) by immunoblotting. LFn-FlA Lp (WT nd the 3A mutnt) estblished in Fig. 1 ws included s controls. (b) Immortlized Tlr4 -/- BMMs with sirna knockdownkd of NLRC4 (W1+W2, Supplementry Tble 1) were ssyed nd ATP-bsed cell vibility ws mesured. Dt shown re men vlues ± SD (error br) from three independent determintions. 11

12 Reltive Nip2 mrna shrna Nip2-1 Nip2-2 Nip2-3 Nip2-4 Control b LFn-PrgJ shrna p1 Superntn nt Lyste c Cell deth (%) shrna d Cell vi bility (%) shrna LFn-PrgJ Nip2-1 Nip2-2 Nip2-3 Nip2-4 Control LFn-BsK Nip2-1 Nip2-2 Nip2-3 Nip2-4 Control Supplementry Figure 12. Genertion of Nip2 stble knockdown mcrophges nd the correltion between the knockdown efficiency nd inflmmsome ctivtion in response to the rod protein stimultion. () qrt-pcr nlysis of Nip2 trnscripts in Nip2 stble knockdown mouse mcrophges. Immortlized BMMs were infected with lentivirus expressing ech of the four different Nip2- trgeting shrna (Supplementry Tble 1) or control non-trgeting shrna. Infected cells were sorted out by flow cytometry nd levels of Nip2 mrna were mesured by qrt-pcr nlysis sshown. The trnscript level of GAPDH ws used for normliztion. Shown re men vlues ± SD (error br) from three independent determintions. (b-d) Effects of Nip2 knockdown on TTSS rod protein-triggered NLRC4 inflmmsome ctivtion in mcrophges. In (b) nd (c), S. typhimurium TTSS rod protein (LFn-PrgJ) ws ssyed; cspse-1 ctivtion ws nlyzed by immunoblotting (b) nd percentges of cell deth ssyed by LDH relese were mesured (c). In (d), LFn-BsK ws delivered into the four different Nip2 stble knockdown mcrophges estblished in () nd ATP-bsed cell vibility ws mesured. Shown in (c) nd (d) re men vlues ± SD (error br) from three independent determintions. 12

13 2 b 1.2 Reltive Nip1 mrna Reltive Nip2 mrna shrna Control Nip-2 shrna Control Nip-2 c Reltive Nip5 mrna d Reltive Nip6 mrna shrna Control Nip-2 shrna Control Nip-2 Supplementry Figure 13. qrt-pcr mesurements of the mrna levels of Nip1 (), Nip2 (b), Nip5 (c) nd Nip6 (d) in Nip2 stble knockdown mcrophges (Nip2-2 in Fig. 4d). The mrna level of GAPDH ws used for normliztion. Shown re men vlues ± SD (error br) from three independent determintions. 13

14 - Superntnt p1 Supplementry Figure 14. Humn U937 monocytes do not respond to intrcellulr delivery of flgellin nd the TTSS rod protein. ti PMA-differentited t d U937 cells weremocked kdtreted t (-), or stimulted with purified LFn-BsK or LFn-FlA Lp. Culture superntnts were nlyzed for the mture form of cspse-1 (p1) by immunoblotting. The lower pnel shows the ctin loding. AIM2 inflmmsome-medited cspse-1 ctivtion in response to DNA trnsfection ws included s positive control. 14

15 C. violceum T2 F - b - p1 Superntnt p1 Superntnt Lyste Lyste Supplementry Figure 15. Chromobcterium violceum ctivtes humn NLRC4 inflmmsome nd the ctivtion requires the Cpi-1 type III locus but not the rod protein. PMAdifferentited U937 cells were infected with indicted C. violceum mutnt strin. T2 in () is mutnt strin deficient in TTSS effector secretion nd serves s bckground strin for further gene deletion. F hs dditionl deletions of five possible flgellinencoding genes in C. violceum. F Cpi-1A mens deletion of the entire Cpi-1A locus illustrted in Fig. 5b. F cprk-j hs deletion of the rod protein-encoding cprj nd the djcent cprk. Detiled informtion for ll the mutnt strins re listed in Supplementry Tble 3. Shown re immunoblots of culture superntnts (upper) nd totl cell lystes (lower) (nti-cspse-1 or nti-ctin). p1 denotes the processed mture form of cspse

16 Reltive NLRC4 mrna Primer set 1 Primer set 2 b c shrna C Asc NLRC4 Asc shrna DNA trnsfection Asc NLRC4 C Supernt nt shrna Control NLRC4 Asc p1 Supplementry Figure 16. Genertion of NLRC4 nd Asc stble knockdown U937 cells. () qrt-pcr mesurements of mrna levels of humn NLRC4 in control, NLRC4 nd Asc knockdown U937 cells. The mrna level of ctin ws used for normliztion. Shown re men vlues ± SD (error br) from three independent determintions. (b) Anti-Asc nd nti-ctin immunoblotting of lystes of indicted knockdown U937 cells. (c) Indicted knockdown cells were trnsfected with plsmid DNA to induce AIM2 inflmmsome-medited cspse-1 ctivtion. Culture superntnts were nlyzed for the mture form of cspse-1 (p1) by immunoblotting. The lower pnel shows the ctin loding. As expected, Asc, but not NLRC4 knockdown cells showed defects in DNA-induced cspse-1 ctivtion. 16

17 Cell deth (%) 4 Control shrna 3 35 NLRC4 shrna b Cell deth (%) C. violceum F F Cpi-1A F cprj C. violceum Supplementry Figure 17. Genetic nlysis of C. violceum infection induced pyroptosis in humn monocyte-derived mcrophges. PMA- differentited U937 cells were infected with indicted C. violceum strins for 1.5 h nd shown re percentges of cell deth mesured by LDH relese into culture superntnt. Both control nd NLRC4 stble knockdown cells re ssyed in () nd intct U937 cells re infected in (b). Dt shown re men vlues ± SD (error br) from three independent determintions. 17

18 b c - p1 Superntnt Lyste Cell deth (%) Cell deth (%) Control shrna NLRC4 shrna Asc shrna Supplementry Figure 18. Cspse-1 ctivtion nd cell deth ssys of intrcellulr delivery of C. violceum proteins encoded in the Cpi-1A locus into humn mcrophges nd effects of NLRC4 nd Asc knockdown. PMA-differentited U937 cells or NLRC4/Asc stble tbl knockdownkd U937 cells () (c) were stimulted t with purified LFn-CprI protein ti or other indicted LFn fusion proteins. FlA Lp denotes Legionell flgellin. CprI_2A is double mutnt of CprI (V69A/I79A). Shown in () re cspse-1 immunoblots of culture superntnts. Percentges of cell deth re mesured by LDH relese into culture superntnt in (b) nd (c) nd men vlues ± SD (error br) from three independent determintions re shown. 18

19 LFn- Pro-IL-1β NLRC4++Pro-IL-1β hnaip Nip5 Nip2 - CprI FlA BsK - FlA CprI - BsK CprI p17 Supplementry Figure 19. Specific responses of different Nip-reconstituted NLRC4 inflmmsome to flgellin, the type III rod protein nd needle protein. 293T cells were trnsfected with hnaip or mouse Nip5/2, NLRC4, procspse-1 nd pro-il-1β expression plsmids s indicted, nd trnsfected cells were stimulted with purified LFn-tgged CprI, BsK or Legionell flgellin (FlA). Totl cell lystes were nlyzed for the mture form of IL-1β (p17) (upper pnels). Anti-ctin immunoblots (lower pnels) shows the mount of loding in ech ssy. 19

20 LFn- - NLRC4 shrna p1 C C C + C + C + C + C + C + C + C + Superntnt Lyst te Supplementry Figure 2. Cspse-1 ctivtion ssy of intrcellulr delivery of LFn-tgged different type III needle proteins into humn monocyte-derived mcrophges. Control (C) or NLRC4 stble knockdown U937 cells were stimulted with LFn-fused type III needle proteins from different bcteri. CprI, C. violceum; EprI, EHEC; PrgI, S. typhimurium; MxiH,S. flexneri; BsL,B. thilndensis; EscF, EPEC; PscF, P. eruginos; YscF, Vibrio prphemolyticus. Culture superntnts were nlyzed for the mture form of cspse-1 (p1) by immunoblotting. The lower pnel shows the ctin nd pro-cspse-1 in totl cell lystes. Different from other needle proteins tht stimulted robust NLRC4-dependent cspse-1 ctivtion, EscF nd YscF showed negligible ctivities. 2

21 Supplementry Tble 1 RNAi Trget sequence (5 3 ) sirna mnlrc4-w1 mnlrc4-w2 Nip5-1 Nip5-2 Nip5-3 Nip5-4 TCGAAACACTGTACGATCA GAACATCCCTGACTATTTA CAAGAAATTACGTCCGGAA GAGCATAAAGAACGGATGA GCTTGATCCTCTTTGGTAA GGTGAGACTTGGCGTTCAG shrna (in plko.1-gfp) Nip5 Nip2-1 Nip2-2 Nip2-3 Nip2-4 hnlrc4 hasc CGCTTGATTATCTTCTGGAAA CCATCCAGAAACCTTGTTGTT GCCATTGCCTTTCAACCTATA CTTTCAGTCTTGAAGAGACAA GCTTAAGAGCACCGTGATCTT GGTTCAAGCCAAAGTATAA GCCAGGCCTGCACTTTATA Trget sequences for sirnas nd shrnas used in this study. The two sirnas for mnlrc4 re picked from the Dhrmcon librry fter vlidtion. The four sirnas for Nip5 knockdown re Dhrmcon SMARTpool products. The four shrnas for Nip2 stble knockdown re from the Open Biosystems TRC librry (Clone number: TRCN114751, TRCN114752, TRCN114753, TRCN114755). Trgeting sequences for humn NLRC4 nd Asc were dopted from published litertures (J Immunol., v18, p nd J Immunol., v181, p17 21). 21

22 Supplementry Tble 2 Primers Sense (5 3 ) Antisense (5 3 ) Nip1 TGCCCAGTATATCCAAGGC TAT AGACGCTGTCGTTGCAGTAA G Nip2 AGGCTATGAGCATCTACCA CA AAGACACTCAATCCACAGCA AA Nip5 TGCCAAACCTACAAGAGC TGA CAAGCGTTTAGACTGGGGAT G Nip6 GTTTCTCTGAAGATACTGA GTCTTAAAGGT TGGGAACAAGCAGTTCCTCT AA mnlrc4 GCGGAGGTGGGAGATATG CGTAGAAGGTTTGGAACAGC hnlrc4 GTGTTCTCCCACAAGTTTG AGTAACCATTCCCCTTGGTC (Set 1) A hnlrc4 (Set 2) AAGATGAATGAAGAAGAT GCTATAA ATCAAGAATGCTCAGTTTGA CC h CATGTACGTTGCTATCCAG GC CTCCTTAATGTCACGCACGAT Primers used in quntittive Rel-Time PCR (qrt-pcr) experiments. 22

23 Supplementry Tble 3 Strins Bckground strin ( T2) F (flgellin-less) F Cpi-1A F cora-c F cprk-j F cpri F cprh Genes (ORFs) deleted civc (CV_2628), csn (CV_263) civc (CV_2628), csn (CV_263), flic2 (CV_2495), flid (CV_311), flic1 (CV_3879), flic3 (CV_3878), flg (CV_3877) civc (CV_2628), csn (CV_263), flic2 (CV_2495), flid (CV_311), flic1 (CV_3879), flic3 (CV_3878), flg (CV_3877), Cpi-1A locus (CV_2417-CV_2423) civc (CV_2628), csn (CV_263), flic2 (CV_2495), flid (CV_311), flic1 (CV_3879), flic3 (CV_3878), flg (CV_3877), corc (CV_2417), corb (CV_2418), cora (CV_2419) civc (CV_2628), csn (CV_263), flic2 (CV_2495), flid (CV_311), flic1 (CV_3879), flic3 (CV_3878), flg (CV_3877), cprk (CV_242), cprj (CV_2421) civc (CV_2628), csn (CV_263), flic2 (CV_2495), flid (CV_311), flic1 (CV_3879), flic3 (CV_3878), flg (CV_3877), cpri (CV_2422) civc (CV_2628), csn (CV_263), flic2 (CV_2495), flid (CV_311), flic1 (CV_3879), flic3 (CV_3878), flg (CV_3877), cprh (CV_2423) C. violceum strins generted in this study nd the prentl strins is C. violceum CVN, spontneous nlidixic cid-resistnt strin of ATCC