Characterization of Xanthomonas oryzae- Responsive cis-acting Element in the Promoter of Rice Race-Specific Susceptibility Gene Xa13
|
|
- Thomasine Blair
- 6 years ago
- Views:
Transcription
1 Moleculr Plnt Volume 4 Number 2 Pges Mrch 2011 RESEARCH ARTICLE Chrcteriztion of Xnthomons oryze- Responsive cis-acting Element in the Promoter of Rice Rce-Specific Susceptibility Gene X13 Ting Yun, Xinghu Li, Jinghu Xio nd Shiping Wng 1 Ntionl Key Lbortory of Crop Genetic Improvement, Ntionl Center of Plnt Gene Reserch (Wuhn), Huzhong Agriculturl University, Wuhn , Chin ABSTRACT The rice X13 gene, whose promoter hrbors UPT (up-regulted by trnscription ctivtor-like [TAL] effector) box, UPT PthXo1, plys pivotl role in the rce-specific pthogenicity cused by Xnthomons oryze pv. oryze (Xoo) strin PXO99. PXO99 cuses rice disese by inducing X13. It is unknown, however, whether the UPT PthXo1 box is the only PXO99-responsive cis-regulting elements in the ctivtion of X13 expression. We nlyzed the expression of series of end- nd site-truncted nd site-mutted X13 promoters in rice nd the binding of PXO99 protein to the intct, prtil, or site-mutted UPT PthXo1 boxes. In the X13 promoter, UPT PthXo1 box is the only Xoo-responsive cis-cting element tht results in PXO99-induced X13 expression. The 5 -terminl second, third, nd fourth nucleotides of the box re importnt for bcteril protein binding nd gene ctivtion; muttion of ny one of these sites bolished PXO99-induced gene expression. Furthermore, the 3 -hlf of the UPT PthXo1 box is lso required for protein binding nd gene ctivtion. These findings will enhnce our understnding of the moleculr mechnism of the interction of rice nd Xoo vi UPT boxes nd TAL effectors. Key words: Bcteril blight; disese; Oryz stiv; UPT box; Xnthomons oryze. INTRODUCTION Bcteri blight, which is cused by Xnthomons oryze pv. oryze (Xoo), is one of the most devstting diseses restricting rice production. More thn 30 disese resistnce (R) genes tht medite rce-specific resistnce to Xoo hve been identified, nd six of them hve been chrcterized (Chu nd Wng, 2007). The recessive x13 is new type of R gene tht confers resistnce to Philippine Xoo strin PXO99 (Chu et l., 2006). PXO99 infection does not influence the expression of recessive x13, but it induces the expression of its dominnt (susceptible) llele X13; suppressing the expression of X13 cn result in the sme level of resistnce to PXO99 s conferred by x13 in rice (Chu et l., 2006). Sequence nlysis of series of rice lines crrying either dominnt X13 or recessive x13 reveled set of recessive lleles of x13, whose encoding proteins re different from or identicl to tht encoded by dominnt X13. However, ll the recessive lleles hd nucleotide substitutions, deletions, or insertions in promoter region corresponding to the 86 to 69 region of the promoter of dominnt X13, suggesting tht promoter muttions my result in x13-medited disese resistnce (Chu et l., 2006). Promoter swp nlyses further confirmed tht the expressionl non-rection to PXO99 infection cused by promoter muttion, not its protein composition, is the key fctor for x13-medited resistnce (Yun et l., 2009). Thus, the dominnt X13 is rce-specific susceptibility gene. Activtion of X13 is required for the development of disese cused by PXO99. A recent study hs reveled tht PXO99 is sensitive to copper (Yun et l., 2010), which is n essentil micronutrient of plnts nd n importnt element for number of pesticides in griculture. PXO99 overcomes rice defense by regulting X13, 1 To whom correspondence should be ddressed. E-mil swng@mil. hzu.edu.cn, fx , tel ª The Author Published by the Moleculr Plnt Shnghi Editoril Office in ssocition with Oxford University Press on behlf of CSPP nd IPPE, SIBS, CAS. This is n Open Access rticle distributed under the terms of the Cretive Commons Attribution Non-Commercil License ( org/licenses/by-nc/2.5), which permits unrestricted non-commercil use, distribution, nd reproduction in ny medium, provided the originl work is properly cited. doi: /mp/ssq076, Advnce Access publiction 5 Jnury 2011 Received 19 September 2010; ccepted 18 November 2010
2 Yun et l. d Rice Pthogen-Responsive cis-element 301 which incorportes with nother two genes to remove copper from the xylem vessels, where Xoo multiplies nd spreds to cuse disese. The dominnt X13 is lso known s Os8N3, whose expression cn be induced by trnscription ctivtor-like (TAL) effector PthXo1 injected into rice through the type III secretion system of Xoo strin PXO99 (Yng et l., 2006). Effectors secreted by pthogenic bcteri ply n essentil role in promoting diseses in plnts (Ky nd Bons, 2009). Severl studies hve demonstrted tht pthogen TAL effectors cn trnscriptionlly ctivte host genes by directly intercting with the cis-regulting elements, nmed UPT (up-regulted by TAL effectors) boxes, in the promoters of corresponding host susceptibility genes to promote diseses or in R genes to induce defense responses (Ky et l., 2007, 2009; Römer et l., 2007, 2009, 2009b). This interction is determined by the specific piring of the repet-vrible diresidues (RVDs) of the repet domin of TAL effector nd the nucleotides of UPT box, with one RVD piring to one specific nucleotide in the UPT box (Boch et l., 2009; Moscou nd Bogdnove, 2009). Thus, bsed on the piring codes of given TAL effector, one cn predict puttive UPT box tht my interct with this TAL effector. A recent study reveled tht the TAL effector PthXo1 from Xoo strin PXO99 directly binds to UPT box, UPT PthXo1 (consisting of 25 nucleotides), in the X13 promoter to medite gene ctivtion (Römer et l., 2010). However, it is unknown whether the UPT PthXo1 box is the only cis-regulting element tht is responsible for Xoo-induced ctivtion of X13. In the present study, we nlyzed the expression of truncted nd mutted X13 promoters in rice. We lso exmined the binding of PXO99 totl proteins to the intct, incomplete, or site-mutted UPT PthXo1 box nd corresponding DNA frgments from recessive x13 lleles. Our results suggest tht, in the X13 promoter, UPT PthXo1 box is the only cis-cting element tht results in PXO99-induced X13 expression. The importnt nucleotide sites of the UPT PthXo1 box nd the neighboring sites of this box needed for efficient ctivtion of the gene re discussed. RESULTS Identifiction of the Pthogen-Responsive Region of the X13 Promoter Sequence nlysis suggested tht the puttive TATA boxes, which provide the binding sites for RNA polymerse, were t 34 for the promoters of both the dominnt X13 gene (P X13 ) nd recessive x13 gene (P x13 ) (Figure 1A). Bsed on the puttive loctions of TATA boxes, previous identifiction of the promoter regions of X13 nd x13 genes (Yun et l., 2009), nd the loction of UPT box for PthXo1 effector binding (Römer et l., 2010), the DNA frgment locted t the 1418 to 6 region of X13 nd the corresponding DNA frgment locted t the 1615 to 6 region of x13 were A -34 (TATA) -34 (TATA) P X (ATG) (ATG) P 252 x13 X13 x13-80 (UPT PthXo1 ) Corresponding to -80 of P X B P X P x P X P x P X P x P X P X P X13-R50 substitution deletion insertion Figure 1. The Structures of Promoters P X13 nd P x13 from IR24 (Crrying X13) nd IRBB13 (Crrying x13), Respectively, nd Truncted Promoters. IR24 nd IRBB13 re ner-isogenic rice lines. (A) The predicted bsl regultory element TATA in P X13 nd P x13. The trnscription initition site is indicted s +1. The nucleotide substitution, deletion, or insertion in P x13 compred with P X13 were bsed on previous report (Chu et l., 2006); the figure with sign of deletion or insertion indictes the numbers of nucleotides inserted or deleted nd the sign without figure represents singlenucleotide deletion or insertion. ATG, trnsltion strt codon. (B) The full-length nd truncted promoters. fused with the reporter gene b-glucuronidse () to detect the pthogen-responsive regions; two truncted promoters P X nd P X for P X13 nd P x nd P x for P x13 were lso fused with (Figure 1B). These constructs were trnsferred seprtely into rice, nd ech construct generted pproximtely 20 independent positive trnsgenic plnts. Ech trnsgenic plnt ws divided into two prts by seprting the tillers t the tillering stge: one prt for inocultion with Xoo strin PXO99 nd nother prt for mock-inocultion t the booting (pnicle development) stge. Becuse X13 expression ws mrkedly induced t 1 5 d fter PXO99 infection (Chu et l., 2006; Yun et l., 2009, 2010), the expression level of mrker gene in the trnsgenic plnts ws exmine from 8 h to 5 d fter infection. The expression of in the trnsgenic plnts crrying P X13 : ws strongly induced t 2 d nd incresed continully until 5 d fter PXO99 infection compred with mock-inoculted control plnts (Figure 2). Neither PXO99 infection nor mock-inocultion influenced expression in the trnsgenic plnts crrying P x13 : (Figure 2). The level in the plnts crrying P X13 :- t 5 d fter PXO99 infection ws 23-fold higher thn tht in the sme plnts t 5 d fter mock-inocultion. Plnts crrying P X nd those crrying P X showed similr induced expression pttern of to plnts crrying P X13 : fter PXO99 infection (Figure 2). However, plnts crrying P X nd those crrying P x showed significntly higher level (P, 0.01) of thn the plnts crrying P X13 : or P x13 : t 8 h fter infection or even without
3 302 Yun et l. d Rice Pthogen-Responsive cis-element pthogen infection, respectively. Compred with mockinocultion, PXO99 infection induced pproximtely two nd three-fold increses of levels in plnts crrying P X t 8 h, 2, nd 5 d fter infection, respectively. PXO99 infection did not mrkedly influence expression in plnts crrying P x compred with the sme plnts fter mock-inocultion. Plnts crrying P X nd those crrying P x showed similr levels of to the plnts crrying P X13 : or P x13 : when without pthogen infection. PXO99 infection showed pproximtely nine- nd 10-fold increses in levels in plnts crrying P X s compred with the sme plnts fter mock-inocultion t 2 nd 5 d fter infection, respectively (Figure 2). PXO99 infection did not mrkedly influence levels in the plnts crrying P x compred to the sme plnts fter mockinocultion. These results suggest the following possibilities. First, the 1418 to 935 region of P X13 nd the corresponding 1615 to 1148 region of P x13 my contin PXO99- independent cis-regulting element(s) tht suppress gene expression. Second, the 934 to 395 region of P X13 nd the corresponding 1147 to 609 region of P x13 my contin PXO99-independent cis-regulting element(s) tht stimulte pmol Mu/min/mg protein pmol Mu/min/mg protein Time fter PXO99 inocultion (h) P X13 P X P X P x13 P x P x Time fter mock inocultion (h) Figure 2. The Expression of Driven by Ntive (P X13 nd P x13 ) or Truncted (P X13-934, P X13-394, P x , nd P x ) Promoters fter PXO99-Inocultion or Mock-Inocultion t the Booting Stge. ctivity ws determined by mesuring the mount of 4- methylumbelliferone (Mu) produced under the ctlysis of in 1 mg totl protein per minute. Sixteen to 22 T 0 trnsgenic plnts crrying ech construct were used for nlyses. For ech time point exmined, lef frgments were collected from ll the plnts crrying the sme construct nd mixed to prepre smple. The ctivity t ech time point ws the verge of three mesurements 6 stndrd devition. The indictes tht significnt difference (P, 0.01) ws detected between pthogen-inoculted nd mockinoculted plnts in the sme time point. gene expression. Lst, only the 394 to 6 region of P X13 my contin PXO99-responsive element(s) tht induce gene expression. The 394 to 6 region of P X13 hrbors PXO99-responsive element, the UPT PthXo1 box, locted t 80 to 56 (Figure 1A; Römer et l., 2010). To determine whether this region my contin other PXO99-responsive elements in ddition to the UPT box, two dditionl 5 -end truncted promoters, P X nd P X13-66, nd one 3 -end truncted promoter, P X13-R50,ofP X13 were fused with (Figure 1B). The three constructs s well s the construct crrying P X13 : were trnsiently expressed in rice clli. The expression of in the clli crrying P X : ws strongly induced by PXO99-inocultion compred with mock-inoculted control clli, s ws the cse in the clli crrying P X13 : (Figure 3). PXO99-inocultion did not obviously influence expression in the clli crrying P X13-66 : or P X13-R50 : compred with mock-inoculted clli. Becuse the P X13-66 : construct only hrbored incomplete UPT PthXo1 box, these results suggest tht the 121 to 65 region of P X13 my contin nother PXO99-responsive element tht induces gene expression or the 121 to 6 region my contin only one PXO99-responsive element, the UPT PthXo1 box. However, PXO99 infection did not obviously influenced expression in the clli crrying P X13-R50 :, which hrbored the 121 to 50 region; this my be due to the lck of the bsl trnscriptionl element, the TATA box. This ssumption is pmol Mu/min/mg protein pmol Mu/min/mg protein ck P X13 Time fter PXO99 inocultion (h) P X13-66 P X P X13-72 ck Time fter mock inocultion (h) Figure 3. Trnsient Expression of Driven by Ntive (P X13 ) nd Truncted (P X13-121, P X13-66, nd P X13-R50 ) Promoters in Rice Clli. ctivity ws determined by mesuring the mount of 4- methylumbelliferone (Mu) produced under the ctlysis of in 1 mg totl protein per minute. Ech smple ws from 4.5 ml clli; ll the clli were mixed to prepre smple. The ctivity of ech smple ws the verge of three mesurements 6 stndrd devition. ck, without pthogen- or mock-inocultion. The indictes tht significnt difference (P, 0.01) ws detected between pthogen-inoculted nd mock-inoculted plnts in the sme time point. This experiment ws biologiclly repeted twice nd similr results were obtined.
4 Yun et l. d Rice Pthogen-Responsive cis-element 303 supported by evidence tht the levels in the clli crrying P X13-66 : were constntly pproximtely three-fold higher thn those in the clli crrying P X13-R50 : with either PXO99- or mock-inocultion. More Xoo Proteins Bind to the Promoter Frgment of X13 thn to the Promoter Frgment of x13 Although our findings indicted tht the 121 to 66 region my hrbor PXO99-responsive element, previous study showed tht region corresponding to the 86 to 69 region of P X13 might be responsible for PXO99-induced expression of dominnt X13, bsed on the comprison of the promoter sequences of seven rice lines crrying dominnt X13 nd 11 rice lines crrying recessive x13 or its recessive lleles (Chu et l., 2006). To determine whether the protein(s) of PXO99 could directly bind to the puttive PXO99-responsive element of P X13, 14- to 15-nt DNA probes from the 86 to 69 region of P X13, which hrbored the 5 -hlf of the UPT PthXo1 box, nd the corresponding regions of some promoters of recessive x13 nd its recessive lleles were designed bsed on sequence-specific nlysis nd used for protein binding nlyses (Figure 4A). Becuse the TAL effector PthXo1 of PXO99 trnscriptionlly ctivtes X13 (Yng et l., 2006), we expected tht PXO99 proteins would bind more intensively to the probe from P X13 thn the probes from P x13, if there ws protein binding. Unexpectedly, n electrophoretic mobility shift ssy (EMSA) showed tht PXO99 proteins bound more intensely to the four probes, R15-Tep 1, R15-IRBB13, R14-AUS274, nd R15-AC19-1 1, from the promoters of recessive x13 nd its recessive lleles thn to probe D15-IR24 from P X13 (Figure 4B). The protein-binding of D15-IR24 nd R15-Tep 1 ws reduced or bolished by the competition of unlbelled probes, indicting specificity of the binding. To determine which nucleotide influenced the binding of PXO99 proteins, three site-mutted short DNA probes (D15M1, D15M2, nd D15M3) were used for nlysis of protein binding (Figure 4A). By compring the protein binding intensity of D15M1, D15M2, nd D15M3 with tht of D15-IR24, substitution of C with A or A with G in probes D15M2 nd D15M3, respectively, ppered to be importnt for protein binding (Figure 4B). A recent study reported tht the UPT PthXo1 box of P X13 consists of 25 nucleotides (Figure 4A; Römer et l., 2010). Thus, we designed new set of long DNA probes tht hrbored the full-length UPT PthXo1 box from X13 or the corresponding regions from x13 or its recessive lleles (Figure 4A). Among these long probes, R28-IRBB13, R28-Tep 1, R28-AUS274, nd R28-AC from the promoters of recessive x13 (IRBB13) nd its recessive lleles (Tep 1, AUS274, nd AC19-1 1), respectively, hrbored DNA frgments tht hd 1-, 3-, 10-, or 16-nucleotide differences from the UPT PthXo1 box. EMSA showed tht PXO99 proteins bound intensively to probe D28-IR24 hrboring the UPT PthXo1 box, but only very wekly to probes D28-IRBB13, D28-Tep 1, D28-AUS274, nd D28-AC (Figure 4C). Substitution of the third C nucleotide of the UPT PthXo1 box with A (probe D28M2) or the fourth A nucleotide with G (D28M3) mrkedly reduced the binding (Figure 4C). However, substitution of the sixth C of the UPT PthXo1 box with A (probe D28M1) did not influence the binding ffinity of PXO99 proteins. The protein-binding signls of the probes were bolished by the competition of unlbelled probes, indicting specificity of the binding (Figure 4C). These results suggest tht n intct UPT PthXo1 box is essentil for bcteril protein binding. Furthermore, t lest the second, third, nd fourth nucleotides of the box re importnt for bcteril protein binding, wheres the sixth nucleotide of this box my not be importnt for protein binding. Muttion of UPT PthXo1 Box Influences PXO99-Induced Trnscriptionl Activity To scertin whether the differentil binding ctivities of the vrious probes to bcteril proteins ffected trnscriptionl regultion of the promoter, we constructed four site-mutted promoters (P X13D79T, P X13D78A, P X13D77G, nd P X13D75A ) of P X13 hrboring the UPT PthXo1 box, in which the second, third, fourth, nd sixth nucleotides were mutted, respectively (Figure 5A). These mutted promoters were fused with nd trnsferred seprtely into rice. Ech construct generted pproximtely 20 independent positive trnsgenic plnts. Ech plnt ws divided into two prts by seprting the tillers t the tillering stge for inocultion with Xoo strin PXO99 nd mock-inocultion, respectively. Trnsgenic plnts crrying different promoter constructs showed the similr levels of expression when mock-inoculted. The PXO99-induced expression of in the trnsgenic plnts crrying P X13D79T, P X13D78A,orP X13D77G ws completely or prtilly suppressed compred to the expression of in the plnts crrying P X13 : (Figure 5B). However, plnts crrying P X13D75A showed similr level of PXO99-induced expression to the plnts crrying P X13 :. The mutted UPT PthXo1 boxes in the promoters P X13D79T, P X13D78A, nd P X13D77G corresponded to DNA probes R28-Tep1, D28M2, nd D28M3, respectively, which showed only wek binding of PXO99 proteins (Figure 4C). The mutted UPT PthXo1 box in P X13D75A ws consistent with probe D28M1, which showed strong binding to PXO99 proteins (Figure 4C). These results suggest tht the suppression or loss of PXO99-induced trnscriptionl ctivtion in the trnsgenic plnts crrying P X13D79T, P X13D78A,or P X13D77G my hve resulted from the unvilbility or low ffinity of binding bcteril protein to the promoters due to the muttion of the key sites of the UPT PthXo1 box. These results lso suggest tht the UPT PthXo1 box is the only PXO99- responsive element in the promoter of X13. We lso constructed seven site-truncted promoters. Three to 11 nucleotides either in front of the UPT PthXo1 box (P X13-F3 ) or t 3 -terminl of the UPT PthXo1 box (P X13-E3, P X13-E5, P X13-E7, P X13-E9, P X13-E11, nd P X13-E13 ) were deleted from P X13 promoter (Figure 6A). These site-truncted constructs nd the construct crrying P X13 : were trnsiently expressed in seprte rice clli. The expression of in the clli crrying
5 304 Yun et l. d Rice Pthogen-Responsive cis-element Figure 4. The Binding Ability of the Promoter Probes of Dominnt X13 nd Recessive x13 to the Totl Proteins of Xoo Strin PXO99 Anlyzed by EMSA. The binding ssys were biologiclly repeted twice, with similr results ((B) nd (C)). (A) Probe sequences. Rice line IR24 crries dominnt X13. Rice lines IRBB13, Tep 1, AUS274, nd AC crry different lleles of recessive x13; nother five rice lines, Chinsurh Boro2 (11484), Chinsurh Boro2 (11760), Chinsurh Boro2 (50930), Long Grin (64950), nd BJ1 tht crry different x13 lleles from tht of Tep 1, hve the sme DNA sequence s Tep 1 in the region corresponding to the 86 to 69 region of P X13 (Chu et l., 2006). Probe D28-IR24 hrbors the UPT PthXo1 box of P X13 (bold itlic letters). Compred with D28-IR24, the substitution sites of the probes from the promoters of x13 nd its recessive lleles re underlined. Muttion sites re shown in lower-cse letters. (B) The binding bility of PXO99 totl proteins to different short (14- or 15- nt) probes. The lbeled probes plus 50- or 100-fold unlbelled competitor probes or without plus competitor (0) were used for the binding ssys. ck, without PXO99 proteins; +, with PXO99 proteins. (C) The binding bility of PXO99 totl proteins to different long (28-nt) probes. The lbeled probes plus 50- fold unlbelled competitor (C) probes or without plus competitor (0) were used for the binding ssys. only P X13 : or P X13-F3 : but not other constructs ws significntly induced (P, 0.01) by PXO99-inocultion compred to mock-inocultion (Figure 6B). However, level in the clli crrying P X13-F3 : ws significntly lower thn tht in the clli crrying P X13 : t 4 24 h fter infection (Figure 6B). These results suggest tht both the flnking sequence nd the 3 -terminl prt of UPT PthXo1 box my be importnt for Xoo-induced expression. DISCUSSION Xoo-induced X13 expression is criticl for X13-fcilited susceptibility (Yun et l., 2009, 2010). The PthXo1 effector of Xoo strin PXO99 trnscriptionlly ctivtes X13 by binding to cis-cting element, the UPT PthXo1 box, in the gene s promoter (Yng et l., 2006; Römer et l., 2010). We nlyzed series of end- nd site-truncted nd site-mutted promoters, nd our findings suggest tht the UPT PthXo1 box is the only PXO99- responsive element in the X13 promoter. Thus, interction of PthXo1 effector nd UPT PthXo1 box results in the susceptibility of rice to PXO99. The promoters of recessive R gene x13 nd its recessive lleles crry mutted UPT PthXo1 boxes, which is the key reson for x13-medited resistnce. Although the present study used the totl proteins of PXO99 insted of PthXo1 for DNA-protein binding nlyses, the proteins bound to the DNA probe hrboring the UPT PthXo1 box re likely minly the PthXo1 effector, s supported by the following evidence. First, EMSA showed tht PXO99 proteins bound intensively to the DNA probe hrboring the full-length UPT PthXo1 box but wekly to the probes hrboring mutted UPT PthXo1 boxes from the promoters of recessive x13 nd its recessive lleles (Figure 4C). These results gree with recent report tht His:PthXo1 fusion protein binds strongly to the DNA frgment hrboring the UPT PthXo1 box but to lesser extent to the corresponding promoter region of recessive x13 (Römer et l., 2010). Second, replcement of the second G nucleotide of the UPT PthXo1 box with T in nturl muttion (the recessive llele of x13 from rice vriety Tep 1) mrkedly
6 Yun et l. d Rice Pthogen-Responsive cis-element 305 Figure 5. Expression of Driven by Ntive (P X13 ) or Mutted (P X13D79T, P X13D75A, P X13D78A, nd P X13D77G ) Promoters fter PXO99 Infection or Mock-Inocultion t the Booting Stge. (A) The structures of mutted promoters nd the sites of muttions. The UPT PthXo1 box of P X13 is shown with bold itlic letters. The figure with sign of substitution indictes the site of nucleotides substitution. (B) Expression of in trnsgenic plnts. ctivity ws determined by mesuring the mount of 4- methylumbelliferone (Mu) produced under the ctlysis of in 1 mg totl protein per minute. Twenty to 36 T 0 trnsgenic plnts crrying ech construct were used for nlyses. For ech time point exmined, lef frgments were collected from ll the plnts crrying the sme construct nd mixed for prepring smple. The ctivity t ech time point ws the verge of three mesurements 6 stndrd devition. ck, without pthogenor mock-inocultion. The sterisk (*) indictes tht significnt difference (P, 0.01) ws detected between PXO99-inoculted plnts nd non-inoculted control (ck) plnts crrying the sme promoter. reduced protein binding (Figure 4C). Likewise, substitution of the second nucleotide of the UPT PthXo1 box with A, C, or T significntly reduced or lmost complete negted PthXo1- medited promoter ctivtion (Römer et l., 2010). Finlly, the sme muttions in the UPT PthXo1 box tht reduced PXO99 protein binding bolished PXO99-induced X13 expression (Figure 5), which ws similr to the knockout of PthXo1 in PXO99 (Yng et l., 2006). Recently, severl UPT boxes hve been predicted by using the TAL effector code, the RVDs tht re the hypervrible residues 12 nd 13 in ech repet unit of the repet domin of TAL effectors (Boch et l., 2009; Moscou nd Bogdnove, 2009). Although bout hlf of the identified RVDs of TAL effectors hve degenerted piring nucleotides bsed on the identified nd predicted UPT boxes, with some RVDs codes vrying between two to four nucleotides (Boch et l., 2009; Moscou nd Bogdnove, 2009), this degenercy ppers to be influenced by the position of RVD in TAL effectors or/nd by the position of nucleotide in UPT box. For exmple, the RVD NN ppers to recognize four types of nucleotide in UPT boxes (Boch et l., 2009; Moscou nd Bogdnove, 2009). However, mtching the NN-type RVD of PthXo1 to the 5 -end second G nucleotide but not the A, C, or T nucleotide of the UPT PthXo1 box is crucil for the interction of the PthXo1 nd UPT PthXo1 box (Römeretl.,2010). Our present results lso showed tht substitution of the second G to T in nturl muttion mrkedly reduced PXO99 protein binding nd bolished PXO99-induced gene expression. Furthermore, the 5 -end third nd forth nucleotides of the UPT PthXo1 box re lso importnt for PXO99 protein binding nd gene trnscriptionl ctivtion. Both the RVDs piring to the third nd sixth nucleotides re HD-type (Römer et l., 2010), which is suggested to hve degenerted piring nucleotides in the UPT boxes (Boch et l., 2009; Moscou nd Bogdnove, 2009). Interestingly, substitution of the third C to A in the UPT PthXo1 box bolished PXO99-induced gene expression nd substitution of the sixth C to A did not influence gene ctivtion (Figure 5). Similr results were observed in nother study. The RVDs of TAL effector AvrBs3 piring the 14th nd 15th nucleotides of the UPA AvrBs3 box (lso UPT box) in the promoter of pepper R gene Bs3 re HDtype, but substitution of the 15th nucleotide C to A in the UPA Bs3 box bolished the Bs3-medited hypersensitive response, while substitution of the 14th nucleotide C to A did not influence Bs3 function (Römeretl.,2009b).These results suggest tht the three-dimensionl positions of some RVDs my influence the interction of TAL effector nd UPT box. One RVD pirs with one nucleotide in UPT box in the host bcterium interction; thus, the number of RVDs in TAL
7 306 Yun et l. d Rice Pthogen-Responsive cis-element Figure 6. Trnsient Expression of Driven by Ntive (P X13 ) nd Site-Truncted (P X13-F3, P X13-E3, P X13-E5, P X13-E7, P X13-E9, P X13-E11, nd P X13-E13 ) Promoters in Rice Clli. (A) The structures of site-truncted promoters nd the sites of deletion. The UPT PthXo1 box of P X13 is shown with bold itlic letters. The figure with sign of deletion indictes the numbers of nucleotides deleted. (B) Expression of driven by different promoters in rice clli. ctivity ws determined by mesuring the mount of 4-methylumbelliferone (Mu) produced under the ctlysis of in 1 mg totl protein per minute. Ech smple ws from 4.5 ml clli; ll the clli were mixed to prepre smple. The ctivity of ech smple ws the verge of three mesurements 6 stndrd devition. One (*) or two (**) sterisks indicte tht significnt difference between plnts crrying P X13 : nd P X13-F3 : in the sme time point ws detected t P, 0.05 or P, 0.01, respectively. ck, without pthogen- or mock-inocultion. This experiment ws repeted twice biologiclly nd similr results were obtined. effector determines the size of the corresponding UPT box (Boch et l., 2009; Moscou nd Bogdnove, 2009). However, the length of functionl UPT box is not lwys s long s tht predicted using the TAL effector code. The nucleotides in the 3 -end of some UPT boxes pper to not be required for gene ctivtion. The AvrX27 effector contins 17 RVDs (Moscou nd Bogdnove, 2009). Omission of the lst three nucleotides of the predicted UPT AvrX27 box cn still trigger hypersensitive response by AvrX27 (Römer et l., 2009). The AvrBs3Drep16 effector contins 14 RVDs (Römer et l., 2010). Omission of the lst two nucleotides of the predicted UPA AvrBs3Drep16 box (lso UPT box) cn lso trigger hypersensitive response by AvrBs3Drep16 (Römer et l., 2009b). A recent study reported tht t lest 6.5 RVDs were required to recognize the trget DNA box nd to ctivte gene expression, nd 10.5 or more RVDs could efficiently ctivte gene expression (Boch et l., 2009). Our present results showed tht the terminl nucleotides of the UPT PthXo1 box could not provide correct pthogen protein binding (Figure 4). Even deletion of the three nucleotides t the 3 -end of the UPT PthXo1 box bolished PXO99-induced gene expression (Figure 6). Likewise, n incomplete UPA AvrBs3Drep16 box (lcking the first nucleotide) hd lower ffinity for the AvrBs3Drep16 effector thn the complete UPA AvrBs3 box (Römer et l., 2007). However, the complete UPA AvrBs3Drep16 box showed higher ffinity for AvrBs3Drep16 thn the complete UPA AvrBs3 box (Römer et l., 2009b). These results suggest tht in some cses, n incomplete UPT box my result in non-specific protein binding. The 5 -terminl Tof UPT boxes hs been reported to be crucil to trnscriptionl ctivtion by TAL effectors (Boch et l., 2009;
8 Yun et l. d Rice Pthogen-Responsive cis-element 307 Römer et l., 2009b, 2010). Interestingly, the flnking sequence of the UPT PthXo1 box ppers to influence PXO99-induced gene expression. The deletion of the three nucleotides flnking the 5 -end of the UPT PthXo1 significntly reduced the expression levelofthegenectivtedbypxo99(figure6). Theneighboring nucleotides of t lest some plnt cis-cting elements lso contributetohigh-ffinitybindingofregultingproteins(ciolkowski et l., 2008). It remins to be demonstrted whether it is common feture tht neighboring nucleotides of UPT boxes contributetobindingffinityoftaleffectors. Inconclusion, the moleculr mechnism of the specific interctions of TAL effectors nd UPT boxes still needs to be refined. Investigting the binding of TAL effectors to UPT boxes t the three-dimensionl level my help to clrify these issues. METHODS Constructing End-Truncted Promoters Truncted promoters of dominnt X13 gene (P X13 ) nd recessive x13 gene (P x13 ) were obtined by PCR mplifiction from the 5 -end using the intermedite vector contining P X13 nd P x13 (Yun et l., 2009), respectively, s templte. The 5 -endprimersofx13p-f(5 -GGATCCGATGTTGAGCTTTAGGAT- TAGCGGGTT-3 ), 5 -deletion-1147 (5 -GGATCCTCCCTTTCTT- CAAGTTACCTCTCTC-3 ), nd 5 -deletion-608 (5 -GGATCCGCAT CATTGTCCATGGTTGT-3 ), which were specific to both P X13 nd P x13 nd contined the BmHI digestion site (underlined), s well s primers XP-90F (5 -GGATCCGAAATATCAAGCACAAG- 3 ) nd XP-60F (5 -GGATCCCTGTACACCACCAAAAG-3 ), which were specific to P X13, were used in combintion with the 3 - end primer X13-promR (5 -GGCAAGCTTGGCCTTGGCCATGGCT- CAGT-3 ), which ws specific to both P X13 nd P x13 nd contined the HindIII digestion site (underlined). The 5 -end primer XP-90F ws lso used in combintion with the 3 -end primer XP-60R (5 -AAGCTTCTTTTGGTGGTGTACAG-3 ), which ws specific to P X13 nd contined the HindIII digestion site (underlined). The PCR products were ligted to vector pgem- T (Promeg Corportion, Mdison, WI, USA) for sequencing, then the truncted promoter frgments were digested with BmHI nd HindIII nd ligted to vector pcambia1381 to form truncted promoters fused with reporter gene. Rice Trnsformtion The promoter constructs were trnsferred into rice vriety Mudnjing 8 (Oryz stiv L. ssp. jponic) byagrobcteriummedited trnsformtion (Lin nd Zhng, 2005). A pir of PCR primers, GusF (5#-CCAGGCAGTTTTAACGATCAGTTCGC-3#) nd GusR (5#-GAGTGAAGATCCCTTTCTTGTTACC), designed ccording to the sequence of ws used for detecting positive trnsgenic plnts. Pthogen Inocultion Rice plnts were inoculted with Xoo strin PXO99 by the lefclipping method t the booting (pnicle development) stge (Sun et l., 2004). Mock-inoculted plnts were treted under the sme conditions except tht the Xoo suspension ws replced with wter. Anlysis of Activity Lef frgments bout 1 cm long right next to the inocultion sites were used for nlysis of expression. Quntittive nlyses of ctivity were conducted s described previously (Ci et l., 2007). Totl protein concentrtion in the superntnt ws quntified with the Brdford ssy (Brdford, 1976). protein in the superntnt ws determined fluorometriclly with n INFINITE 200 (Tecn Austri Gmbh, Ltd, Grodig, Austri). Agrobcterium-Medited Trnsient Expression The clli of rice vriety Zhonghu 11 (O. stiv ssp. jponic) were prepred s described previously (Lin nd Zhng, 2005). Agrobcteri contining different trnsformtion construct were co-cultured with the clli for over 16 h in MS medium. The clli were then wshed 10 times using utoclved wter nd dried in lminr flow cbinet. The clli were treted with Xoo strin PXO99 t 10 9 cfu ml 1 or mock-treted with utoclved wter for certin period of time. Site-Directed Muttion nd Trunction The GeneTilor Site-Directed Mutgenesis System (Invitrogen Life Technologies, Crlsbd, CA, USA) ws used for sitedirected muttion of X13 promoter s described previously (Ci et l., 2007). The puc19 plsmid tht contined the ntive promoter (P X13 ) used s PCR templte ws methylted before use. The mutgenic primer pir, in which the regultory element ws mutted, ws used to mplify the promotercontining trget muttion. Primer pirs X13PM1F (5 -AAAG CAAAGGTTAGATATTCATCTCCCCCT-3 )/X13PM1R (5 -ATATC- TAACCTTTGCTTTTTTTTTTC-3 ), X13PM2F (5 -CAAAGGTTAGA TATGCATATCCCCCTACTG-3 )/X13PM2R (5 -ATGCATATCTAAC- CTTTGCTTTTTTTTTTC-3 ), X13PM4F (5 -AAGCAAAGGTTAGA- TATGAATCTCCCCCT-3 )/X13PM4R (5 -CATATCTAACCTTTGCTT TTTTTTTTC-3 ), nd X13PM5F (5 -AGCAAAGGTTAGATATGCG- TCTCCCCCTAC-3 )/X13PM5R (5 -GCATATCTAACCTTTGCTTTTT- TTTTTC-3 ) were used for site-directed muttion of P X13,in which the muttion points were underlined. To help select the mutted construct, the PCR product ws trnsferred into Escherichi coli strin DH5-T1, in which the methylted plsmid could not replicte. The site-directed trunction of X13 promoter ws performed by nested PCR mplifiction using the intermedite vector contining P X13 (Yun et l., 2009) s templte. First, the forwrd primer BX13(IR24)M17F (5 -TAGATATGCATCTCCCCC- TACAAAAGTGGAG-3 ), whichcontineddeletioninthetrget site, ws used in combintion with the reverse primer X13-promR to mplify the downstrem of the deletion site. Simultneously, the reverse primer BX13(IR24)M17R (5 -GGGGGAGATGCATATCTAACCTTTGCTTTT-3 ), which ws
9 308 Yun et l. d Rice Pthogen-Responsive cis-element overlpped with BX13(IR24)M17F nd lso contined the sme deletion s in BX13(IR24)M17F, ws pired with the forwrd primer X13P-F to mplify the upstrem of the deletion site. The mplifiction products from the two PCR rections were purified nd mixed nd used s the templte for the second round of PCR using primers X13P-F nd X13-promR. Another six pirs of primers, BX13(IR24)M15F (5 -TAGATATGCATCTCCCCC- CAAAAGTGGAGGG-3 )/BX13(IR24)M15R (5 -GGGAGATGCA- TATCTAACCTTTGCTTTTTT-3 ), BX13(IR24)M19F (5 -GATATGC ATCTCCCCCTACTCAAAAGTGGAG-3 )/BX13(IR24)M19R (5 -TA GGGGGAGATGCATATCTAACCTTTGCTT-3 ), BX13(IR24)M21F (5 -TATGCATCTCCCCCTACTGTCAAAAGTGGAG-3 )/BX13(IR24) M21R (5 -AGTAGGGGGAGATGCATATCTAACCTTTGC-3 ), BX13 (IR24)M23F (5 -TGCATCTCCCCCTACTGTACCAAAAGTGGAG-3 )/ BX13(IR24)M23R(5 -ACAGTAGGGGGAGATGCATATCTAACCTT T-3 ), BX13(IR24)M25F(5 -CATCTCCCCCTACTGTACACCAAAAG TGGAG-3 )/BX13(IR24)M25R (5 -GTACAGTAGGGGGAGATG- CATATCTAACCT-3 ), nd BX13(IR24)M-3F (5 -GAAAAAAAAAA GCAAAGGTTAGTGCATCTCCCC-3 )/BX13(IR24)M-3R (5 -AACC TTTGCTTTTTTTTTTCTTGTGCTTGA-3 ), were lso used to construct other site-directed truncted promoters in the sme wy s described bove. Electrophoretic Mobility Shift Assy To isolte the totl proteins of Xoo strin PXO99, the fresh bcteri were ground with liquid nitrogen nd suspended in buffer (10 mm Tris-HCl t ph 8.0, 1 mm DTT, 200 lm phenylmethnesulfonyl fluoride) nd homogenized completely. The mixture ws centrifuged t 4 C t 1000 g to collect the superntnt. The protein content in the nucler extrct nd in the totl proteins of Xoo strin PXO99 ws quntified using the Brdford ssy. EMSA ws pplied s described previously (Qiu et l., 2007). Promoter Sequence Anlysis The TATA boxes of promoters P X13 nd P x13 were predicted using the computer progrms TSSP provided t the Softberry website ( nd PROSCAN ( bims.dcrt.nih.gov/molbio/proscn). Sttisticl Anlysis The significnt differences between control nd tretment of the smples were nlyzed by the pir-wise t-test instlled in the Microsoft Office Excel progrm. FUNDING This work ws supported by grnts from the Ntionl Nturl Science Foundtion of Chin ( nd ) nd the Ntionl Progrm of Trnsgenic Vriety Development of Chin (2008ZX ). No conflict of interest declred. REFERENCES Boch, J., Scholze, H., Schornck, S., Lndgrf, A., Hhn, S., Ky, S., Lhye, T., Nickstdt, A., nd Bons, U. (2009). Breking the code of DNA binding specificity of TAL-type III effectors. Science. 326, Brdford, M.M. (1976). A rpid nd sensitive method for the quntittion of microgrm quntities of protein utilizing the principle of protein dye binding. Anl. Biochem. 72, Ci, M., Wei, J., Li, X., Xu, C., nd Wng, S. (2007). A rice promoter contining both novel positive nd negtive cis-elements for regulting green-tissue-specific gene expression in trnsgenic plnts. Plnt Biotechnol. J. 5, Chu, Z., nd Wng, S. (2007). Isoltion, structure, function reltionship, nd moleculr evolution of disese resistnce genes. In Genetics nd Improvement of Resistnce to Bcteril Blight in Rice, Zhng Q., ed. (Beijing: Science Press), pp Chu, Z., et l. (2006). Promoter muttions of n essentil gene for pollen development result in disese resistnce in rice. Genes Dev. 20, Ciolkowski, I., Wnke, D., Birkenbihl, R.P., nd Somssich, I.E. (2008). Studies on DNA-binding selectivity of WRKY trnscription fctors lend structurl clues into WRKY-domin function. Plnt Mol. Biol. 68, Ky, S., nd Bons, U. (2009). How Xnthomons type III effectors mnipulte the host plnt. Curr. Opin. Microb. 12, Ky, S., Hhn, S., Mrols, E., Huse, G., nd Bons, U. (2007). A bcteril effector cts s plnt trnscription fctor nd induces cell size regultor. Science. 318, Ky, S., Hhn, S., Mrols, E., Wieduwild, R., nd Bons, U. (2009). Detiled nlysis of the DNA recognition motifs of the Xnthomons type III effectors AvrBs3 nd AvrBs3Drep16. Plnt J. 59, Lin, Y.J., nd Zhng, Q. (2005). Optimising the tissue culture conditions for high efficiency trnsformtion of indic rice. Plnt Cell Rep. 23, Moscou, M.J., nd Bogdnove, A.J. (2009). A simple cipher governs DNA recognition by TAL effectors. Science. 326, Qiu, D., Xio, J., Ding, X., Xiong, M., Ci, M., Co, Y., Li, X., Xu, C., nd Wng, S. (2007). OsWRKY13 medites rice disese resistnce by regulting defense-relted genes in slicylte- nd jsmontedependent signling. Mol. Plnt Microbe Interct. 20, Römer, P., Fecht, S., Strub, T., Elssser, J., Schornck, S., Boch, J., Wng, S., nd Lhye, T. (2010). Promoter elements of rice susceptibility genes re bound nd ctivted by specific TAL effectors from the bcteril blight pthogen, Xnthomons oryze pv. oryze. New Phytologist. 187, Römer, P., Hhn, S., Jordn, T., Struss, T., Bons, U., nd Lhye, T. (2007). Plnt pthogen recognition medited by promoter ctivtion of the pepper Bs3 resistnce gene. Science. 318, Römer, P., Recht, S., nd Lhye, T. (2009). A single plnt resistnce genepromoterengineeredtorecognizemultipletaleffectorsfrom disprte pthogens. Proc. Ntl Acd. Sci. U S A. 106, Römer, P., Struss, T., Hhn, S., Scholze, H., Morbitzer, R., Gru, J., Bons, U., nd Lhye, T. (2009b). Recognition of AvrBs3-like proteins is medited by specific binding to promoters of mtching pepper Bs3 lleles. Plnt Physiol. 150, Sun, X., Co, Y., Yng, Z., Xu, C., Li, X., Wng, S., nd Zhng, Q. (2004). X26, gene conferring resistnce to Xnthomons oryze pv. oryze in rice, encodes n LRR receptor kinse-like protein. Plnt J. 37,
10 Yun et l. d Rice Pthogen-Responsive cis-element 309 Yng, B., Sugio, A., nd White, F.F. (2006). Os8N3 is host disesesusceptibility gene for bcteril blight of rice. Proc. Ntl Acd. Sci. U S A. 103, Yun, M., Chu, Z., Li, X., Xu, C., nd Wng, S. (2009). Pthogeninduced expressionl loss of function is the key fctor in rcespecific bcteril resistnce conferred by recessive R gene x13 in rice. Plnt Cell Physiol. 50, Yun, M., Chu, Z., Li, X., Xu, C., nd Wng, S. (2010). The bcteril pthogen Xnthomons oryze overcomes rice defenses by regulting host copper redistribution. Plnt Cell. 22,
Best Practices for PCR Assays in Seed Health Tests Version 3.0; June 2018
Best Prctices for PCR Assys in Seed Helth Tests Version 3.0; June 2018 Polymerse Chin Rection (PCR) is currently the most commonly utilized moleculr technique in seed helth testing. This document provides
More informationChickpeas Respond Well To Inoculation With TagTeam
Chickpes Respond Well To Inocultion With TgTem S.M. Phelps, nd E. Hgele Philom Bios Inc., 318-111 Reserch Drive, Ssktoon, SK S7N 3R2 Abstrct Rhizobi strins were tested in TgTem pet nd grnule formultions
More informationA Little More Advanced Biotechnology Tools. Engineered plasmids. Selection for plasmid uptake. Better Plasmids. Antibiotic becomes a selecting agent
A Little More Advnced Biotechnology Tools Better Plsmids Engineered plsmids Building custom plsmids restriction enzyme sites ntibiotic resistnce genes s selectble mrker EcoRI BmHI HindIII restriction sites
More informationBiofilm Formation by Escherichia coli csga and fima mutants
Journl of Undergrdute Reserch t Minnesot Stte University, Mnkto Volume 14 Article 9 2014 Biofilm Formtion by Escherichi coli csga nd fima mutnts Nicole Snyder Minnesot Stte University, Mnkto Sen Willert
More informationSUPPLEMENTARY INFORMATION
SI Fig. PrpS is single copy gene k 3. 9... EcoRV EcoRV k 5 BmH Pst c well k HindIII HindIII HindIII.3.5 3.. Southern lots of Ppver genomic DNA from plnts with SS8 hplotypes, hyridized with PrpS proe..
More informationCrop Performance and Plant Microbe-Interactions are Affected by the Sequence and Frequency of Pulse Crops in the Canadian Prairie
Crop Performnce nd Plnt Microbe-Interctions re Affected by the Sequence nd Frequency of Pulse Crops in the Cndin Pririe Nvrro-Borrell A 1,2 ; Di M 2 ; Hmel C 1,2 ; Fernndez MR 2 ; Gn Y 2 ; Germid J 1.
More informationtheir response to inoculation with the bacterium which causes walnut blight. Tested germplasm was selectedj for its unusual
WALNUT BLIGHT: SUSCEPTIBILITY OF GERMPLASM AND THE RETENTION OF OVERWINTERING PATHOGN POPULATIONS Keith Woeste, Gle McGrnhn, Roy Yri nd M.N. Schroth ABSTRACT Aspects of the susceptibility of English wlnu~
More informationPrimer in Population Genetics
Primer in Popultion Genetics Hierrchicl Orgniztion of Genetics Diversity Primer in Popultion Genetics Defining Genetic Diversity within Popultions Polymorphism number of loci with > 1 llele Number of lleles
More informationSupplementary Figure 1. Zhang et al.
Supplementry Figure 1. Zhng et l. T30-SurA: GGCAGTTTCATCATGAATGTGCAGGAGCTTGCAACAATTAAGGTGGAGAATCTCCC T30-SurB: GGCAGTTTCATCATGAATGTGCAGGAGCTAGCAACTATTAAGGTGGAGAATCTCCC T41-SurA: ACTGAATAATCAACACTTGGGAATGGTGGTTCAATGGGAGGATCGGTTCTAT
More information2016 Prelim Essay Question 2
216 Prelim Essy Question 2 In recent yers, the price of nturl fertilisers for orgnic brown rice production hs risen nd helthy living cmpigns re seeing more consumers switching from nonorgnic white rice
More informationRice OsPAD4 functions differently from Arabidopsis AtPAD4 in host-pathogen interactions
The Plnt Journl (21) 78, 619 631 doi: 1.1111/tpj.125 Rice OsPAD functions differently from Aridopsis AtPAD in host-pthogen interctions Yinggen Ke, Hongo Liu, Xinghu Li, Jinghu Xio nd Shiping Wng Ntionl
More informationNumerical Analysis of a Reinforced Concrete Slab-Column Connection Subjected to Lateral & Vertical Loading
, Mrch 15-17, 2017, Hong Kong Numericl Anlysis of Reinforced Concrete Slb-Column Connection Subjected to Lterl & Verticl Loding Mostfiz Emtiz, A.S.M. Aluddin Al Azd, H. M. Shhin b nd Sultn Al Shfin c Abstrct
More informationCOS-1 cells transiently transfected with either HA hgr wt, HA hgr S211A or HA hgr S226A
1 SUPPLEMENTRY FIGURES Fig. 1 & Specificity of the nti-p-s211 nd nti-p-s226 ntibodies COS-1 cells trnsiently trnsfected with either H hgr wt, H hgr S211 or H hgr S226 were treted with 1nM Dex for 1 hour.
More informationEVALUATION OF STRIP-TILLAGE AND FERTILIZER PLACEMENT IN SOUTHERN IDAHO CORN PRODUCTION. D.Tarkalson and D. Bjorneberg USDA-ARS, Kimberly, ID
EVALUATION OF STRIP-TILLAGE AND FERTILIZER PLACEMENT IN SOUTHERN IDAHO CORN PRODUCTION D.Trklson nd D. Bjorneberg USDA-ARS, Kimberly, ID ABSTRACT Strip tillge (ST) nd ssocited nutrient plcement cn potentilly
More informationSpatiotemporal Variability of Productivity and Nutrient Availability in Flooded Rice Soils across Field Scales
2006-2011 Mission Kerney Foundtion of Soil Science: Understnding nd Mnging Soil-Ecosystem Functions Across Sptil nd Temporl Scles Finl Report: 2007017, 1/1/2009-12/31/2009 Sptiotemporl Vribility of Productivity
More informationSLASH PINE FAMILIES IDENTIFIED WITH HIGH RESISTANCE TO FUSIFORM RUST. C. H. Walkinshaw '
SLASH PINE FAMILIES IDENTIFIED WITH HIGH RESISTANCE TO FUSIFORM RUST C. H. Wlkinshw ' Abstrct.--Fusiform rust redily kills slsh pine, Pinus elliottii Engelm. vr. elliottii. When the number of rust-infected
More informationSupplemental Data. Antosz et al. Plant Cell (2017) /tpc SPT6/SPT6L. genomic DNA ACT2 +RT -RT +RT -RT
A B C SPT6/SPT6L genomic DNA ACT2 +RT -RT Col- seedlings +RT -RT PSB-D cells Supplementl Figure 1. Expression of SPT6L nd SPT6. (Supports Figure 1.) Trnscript levels of of SPT6L (At1g6544) nd SPT6 (At1g6321)
More informationFluorescence Intensities of. GFP-PAC-1 Strains
DOI: 10.1038/ncb3168 Arbitrry Fluorescence Units 2500 2000 1500 1000 500 0 full length (1-4) Fluorescence Intensities of GFP-PAC-1 Strins ΔPH 392-838 575-4 GFP-PAC-1 Strins 2-610 1-574 b control c pc-1(3
More informationThe Presence of Tobacco Mosaic Virus in the Compost Extract of Cigar Tobacco Debris
HAYATI Journl of Biosciences, September 28, p 118122 Vol. 1, No. 3 ISSN: 1978319 The Presence of Tobcco Mosic Virus in the Compost Extrct of Cigr Tobcco Debris WIWIEK SRI WAHYUNI, MUHAMMAD HANAPI, IGNASIUS
More informationTree Shelters Fail to Enhance Height Growth of Northern Red Oak in the Upper Peninsula of Michigan. 1
Tree Shelters Fil to Enhnce Height Growth of Northern Red Ok in the Upper Peninsul of Michign. 1 Dougls O. Lntgne, Associte Professor, MSU Deprtment of Forestry nd Rymond Miller, Resident Forester, Upper
More informationENVIRONMENTAL AUDIT OF THE SITES IMPACTED BY THE PROBO KOALA TOXIC WASTE DUMPING IN ABIDJAN, CÔTE D IVOIRE
ENVIRONMENTAL AUDIT OF THE SITES IMPACTED BY THE PROBO KOALA TOXIC WASTE DUMPING IN ABIDJAN, CÔTE D IVOIRE This series of fct sheets ws prepred s prt of UN Environment s environmentl udit of the sites
More informationIn situ evaluation of DGT techniques for measurement of trace. metals in estuarine waters: a comparison of four binding layers
Electronic Supplementry Mteril (ESI) for Environmentl Science: Processes & Impcts. This journl is The Royl Society of Chemistry 2015 Supplementry Informtion for: In situ evlution of DGT techniques for
More informationEFFECT OF FOLIAR CHAPERONE TM APPLICATIONS UNDER ELEVATED TEMPERATURES ON THE PROTEIN CONCENTRATIONS AND PHYSIOLOGICAL RESPONSES OF COTTON
AAES Reserch Series 521 EFFECT OF FOLIAR CHAPERONE TM APPLICATIONS UNDER ELEVATED TEMPERATURES ON THE PROTEIN CONCENTRATIONS AND PHYSIOLOGICAL RESPONSES OF COTTON R.S. Brown nd D.M. Oosterhuis 1 RESEARCH
More informationFigure S1 Yoo et al.
doi:.38/nture6543 8 8 6 6 4 4 d Protoplsts Leves Reltive promoter ctivity (%) Reltive trnscript level 2 2 88 66 44 22 32 2 2 MKK-MYC MPK ctivity nti-mpk6 c ctr MKK - 4 5 4 5 MKK-MYC MPK3 ctivity MPK6 ctivity
More informationSpecies-Specific Signals for the Splicing of a Short Drosophila Intron In Vitro
MOLECULAR AND CELLULAR BIOLOGY, Feb. 1993, P. 114-1118 27-736/93/2114-15$2./ Copyright 1993, Americn Society for Microbiology Vol. 13, No. 2 Species-Specific Signls for the Splicing of Short Drosophil
More informationThree-Phase Wound-Rotor Induction Machine with Rotor Resistance
Exercise 2 Three-Phse Wound-Rotor Induction Mchine with Rotor Resistnce EXERCISE OBJECTIVE When you hve completed this exercise, you will know the effects of vrying the rotor resistnce of three-phse wound-rotor
More informationDetection of amplified Y chromosome-specific sequence by capillary electrophoresis with laser-induced fluorescence*
FERTILITY AND STERILITY Copyright @ 1995 Americn Society for Reproductive Medicine Vol. 64, No., August 1995 Printed on cid free pper in U. S. A. Detection of mplified Y chromosome-specific sequence by
More informationInterplay between NS3 protease and human La protein---- by Ray and Das Supplementary fig 1. NS3 pro
Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 1 1 2 3 4 UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES RNA ws UV-crosslinked to incresing concentrtions (0.1, 0.2 nd 0.4µM) in
More informationElectronic supplementary information: High specific detection and near-infrared photothermal. therapy of lung cancer cells with high SERS active
Electronic supplementry informtion: High specific detection nd ner-infrred phototherml therpy of lung cncer cells with high SERS ctive ptmer-silver-gold shell-core nnostructures Ping Wu, Yng Go, Yimei
More informationNOTICE CONCERNING COPYRIGHT RESTRICTIONS
NOTICE CONCERNING COPYRIGHT RESTRICTIONS This document my contin copyrighted mterils. These mterils hve been mde vilble for use in reserch, teching, nd privte study, but my not be used for ny commercil
More informationThe Effect of SFAS No. 131 on the Diversification Discount
The Effect of SFAS No. 131 on the Diversifiction Discount Seoungpil Ahn Sogng Business School, Sogng University PA706, 35 Bekbeom-ro, Mpo-gu, Seoul 121-742, Kore E-mil: sphn@sogng.c.kr Received: July 2,
More informationDual Physically Cross-Linked Hydrogels with High. Stretchability, Toughness and Good Self-
Dul Physiclly Cross-Linked Hydrogels with High Stretchility, Toughness nd Good Self- Recoverility Yng Hu,, Zhengshn Du, Xioln Deng, To Wng, Zhuohong Yng, Wuyi Zhou,*, Choyng Wng*, Reserch Institute of
More informationThe signal for growth rate control and stringent sensitivity in E. coli is not restricted to a particular sequence motif within the promoter region
.n) 199 Oxford University Press Nucleic Acids Reserch, Vol. 18, No. 21 6271 The signl for growth rte control nd stringent sensitivity in E. coli is not restricted to prticulr sequence motif within the
More informationPamela Strange (SGS Australia), William Wang (OLAM), Steve Katis (OLAM), Ian Lonie (Tanuki), Stephen Phillips (Tanuki).
The effects of folir ppliction of () Verno FG Cu3+Zn3, () NORDOX 75 WG nd (3) Cupric Hydroxide, during the kernel dry weight ccumultion period for nuts nd ud differentition period for wood, in ering Nonpriel
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture10177 MDYKDHDGDYKDHDIDYKDD DDKMAPKKKRKVGIHGVPAA MAERPFQCRICMRKFAQSGD LTRHTKIHTGEKPFQCRICM RNFSRSDVLSEHIRTHTGEK PFACDICGKKFADRSNRIKH TKIHTGSQKPFQCRICMRNF SRSDNLSEHIRTHTGEKPFA
More informationWestern Illinois University- School of Agriculture Organic Research Program 2013 Dry Humate/Fertility Studies Dr. Joel Gruver and Andy Clayton
Western Illinois University- School of Agriculture Orgnic Reserch Progrm 0 Dry Humte/Fertility Studies Dr. Joel Gruver nd Andy Clyton Introduction Orgnic grin frmers generlly use less purchsed inputs thn
More informationMultiple Antibiotic Resistance in Escherichia coli
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1994, p. 1773-1779 Vol. 38, No. 8 0066-4804/94/$04.OO+O Copyright 1994, Americn Society for Microbiology Genetic Reltionship between soxrs nd mr Loci in Promoting
More informationSupplemental Figure S1
Supplementl Figure S1 TG nrt1.5- Li et l., 1 nrt1.5- Lin et l., 8 F L CTGCCT R T 5'UTR 3'UTR 1 3 81p (k) nrt1.5- C nrt1.5- Supplementl Figure S1. Phenotypes of the T-DN insertion mutnts (this pper), nrt1.5-
More informationa b c Nature Neuroscience: doi: /nn.3632
c Supplementry Figure 1. The reltion etween stndrd devition (STD) nd men of inter-press intervls (IPIs) under different schedules. -c, Disproportionlly fster decrese of the stndrd devition compred to the
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09470 prmt5-1 prmt5-2 Premture Stop Codon () GGA TGA PRMT5 Hypocotyl Length (Reltive to Drk) 0.5 0.3 0.1 ** 30 *** c prmt5-1 d ** *** 150 prmt5-2 ** *** 28 100 26 24 50 prmt5-1 prmt5-2
More information[ HOCl] Chapter 16. Problem. Equilibria in Solutions of Weak Acids. Equilibria in Solutions of Weak Acids
Equilibri in Solutions of Wek Acids Chpter 16 Acid-Bse Equilibri Dr. Peter Wrburton peterw@mun.c http://www.chem.mun.c/zcourses/1011.php The dissocition of wek cid is n equilibrium sitution with n equilibrium
More informationObserving Patterns in Inherited Traits. Chapter 10
Observing Ptterns in Inherited Trits Chpter 10 10.1 Mendel, Pe Plnts, nd Inheritnce Ptterns By experimenting with pe plnts, Mendel ws the first to gther evidence of ptterns by which prents trnsmit genes
More informationMutations in the arac Regulatory Gene of Escherichia coli B/r That Affect Repressor and Activator Functions of AraC Protein
JOURNAL OF BACTERIOLOGY, June 1986, p. 892-900 0021-9193/86/060892-09$02.00/0 Copyright 1986, Americn Society for Microbiology Vol. 166, No. 3 Muttions in the rc Regultory Gene of Escherichi coli B/r Tht
More informationFunctional Analysis of cis- and trans-acting Elements of the Candida albicans CDR2 Promoter with a Novel Promoter Reporter System
EUKARYOTIC CELL, Aug. 2009, p. 1250 1267 Vol. 8, No. 8 1535-9778/09/$08.00 0 doi:10.1128/ec.00069-09 Copyright 2009, Americn Society for Microbiology. All Rights Reserved. Functionl Anlysis of cis- nd
More informationEconomic Profitability and Sustainability of Canola Production Systems in Western Canada
Economic Profitility nd Sustinility of Cnol Production Systems in Western Cnd Elwin Smith, R. Blckshw, Agriculture nd Agri-Food Cnd (AAFC), Lethridge, AB, N. Hrker, J. O'Donovn, AAFC Lcome AB, S. Brndt,
More informationBethesda, Maryland the adenovirus ElA protein (9). Typical zinc finger motifs. are not present within the AlL and G8R ORFs, although the
JORNL OF VIROLOGY, Ot. 1993, p. 5749-5753 0022-538X/93/105749-05$02.00/0 opyright ) 1993, mericn Society for Microbiology Vol. 67, No. 10 Muttionl nlysis of Predicted Zinc-inding Motif in the 26-Kilodlton
More informationCONSERVATION TILLAGE IMPROVES SOIL PHYSICAL PROPERTIES ON DIFFERENT LANDSCAPE POSITIONS OF A COASTAL PLAIN SOIL.
CONSERVATION TILLAGE IMPROVES SOIL PHYSICAL PROPERTIES ON DIFFERENT LANDSCAPE POSITIONS OF A COASTAL PLAIN SOIL Frncisco J. Arrig* 1, Andre S. Biscro 2, Kipling S. Blkcom 1, Joey N. Shw 3, Edzrd vn Snten
More informationThe Effect of Nitrogen Fertilizers (Urea, Sulfur Coated Urea) with Manure on the Saffron Yield
The Effect of Nitrogen Fertilizers (Ure, Sulfur Coted Ure) with Mnure on the Sffron Yield Seed Rezin nd Mjid Forouhr Soil nd Wter Deprtment griculturl Reserch Center of Khorsn Mshhd, Torough Sttion, 91735
More informationH. Randall Smith; Ph.D. Agronomy and Wayne Porter: Ph.D. Horticulture Mississippi State University Extension Service
Effect of SumGrow on growth, development nd yield of Irish pottoes (Solnum tuerosum) t the Beumont Reserch Sttion (Mississippi Stte University) during 217 H. Rndll Smith; Ph.D. Agronomy nd yne Porter:
More informationComplex Regulation of the Muscle-Specific Contractile Protein
MOLECULAR AND CELLULAR BIOLOGY, Sept. 1987, p. 3065-3075 Vol. 7, No. 9 0270-7306/87/093065-11$02.00/0 Copyright 1987, Americn Society for Microbiology Complex Regultion of the Muscle-Specific Contrctile
More informationMovement of yeast transposable elements by gene conversion (gene replacement/recombination/transposition/controlling elements/gene expression)
Proc. NtL Acd. Sci. USA Vol. 79, pp. 5621-5625, September 1982 Genetics Movement of yest trnsposble elements by gene conversion (gene replcement/recombintion/trnsposition/controlling elements/gene expression)
More information6.1 Damage Tolerance Analysis Procedure
6. Dmge Tolernce Anlysis Procedure For intct structure the nlysis procedures for Slow Crck Growth nd Fil Sfe structure re essentilly the sme. An initil flw is ssumed nd its growth is nlyzed until filure
More informationPAPER CHEMISTRY, APPLETON, WISCONSIN IPC TECHNICAL PAPER SERIES NUMBER 163 W. J. WHITSITT OCTOBER, 1985
163 THE INSTITUTE OF PAPER CHEMISTRY, APPLETON, WISCONSIN O E G? o IPC TECHNICAL PAPER SERIES NUMBER 163 O4 o= o COMPRESSIVE STRENGTH RELATIONSHIPS AND FACTORS, C) t C= c. Md Qy W. J. WHITSITT OCTOBER,
More informationEffect of Tantalum Additions to a Cobalt-Chromium-Nickel
Effect of Tntlum Additions to Coblt-Chromium-Nickel Bse Alloy A. P. ROWE, W. C. BIGELOW, nd K. ASGAR University of Michign, School of Dentistry, Ann Arbor, Michign 48104, USA An investigtion by electron
More informationWesternBright TM MCF and MCF-IR
WesternBright TM MCF nd MCF-IR Quntittive, multi-color fluorescent Western lotting kits WesternBright MCF visile nd ner infrred (IR) fluorescent Western lotting kits llow the ssy of two proteins t once,
More informationCONSERVATION VS CONVENTIONAL TILLAGE,FALL DOUBLE CROPPING
262 Southern Conservtion Systems Conference, Amrillo TX, June 26-28, 26 CONSERVATION VS CONVENTIONAL TILLAGE,FALL DOUBLE CROPPING AND COVER CROP EFFECTS ON CROP WATER USE IN SUBTROPICAL SOUTH TEXAS Bo
More informationSTATUS OF LAND-BASED WIND ENERGY DEVELOPMENT IN GERMANY
Yer STATUS OF LAND-BASED WIND ENERGY Deutsche WindGurd GmbH - Oldenburger Strße 65-26316 Vrel - Germny +49 (4451)/9515 - info@windgurd.de - www.windgurd.com Annul Added Cpcity [MW] Cumultive Cpcity [MW]
More informationDeveloping Optimal Controlled Atmosphere Conditions for Thompson Seedless Table Grapes
Developing Optiml Controlled Atmosphere Conditions for Thompson Seedless Tle Grpes C.H. Crisosto, D. Grner, nd G. Crisosto Deprtment of Pomology University of Cliforni, Dvis, t Kerney Agriculturl Center
More informationEngrailed, a homeodomain protein, can repress in vitro transcription by competition with the TATA boxbinding
Proc. Nti. Acd. Sci. USA Vol. 87, pp. 22892293, Mrch 1990 Biochemistry Engriled, homeodomin protein, cn repress in vitro trnscription by competition with the boxbinding protein trnscription fctor lid (generl
More informationApplication of Actiwave for Improving the Rooting of Camellia Cuttings
Appliction of Actiwve for Improving the Rooting of Cmelli Cuttings A. Ferrnte nd A. Trivellini Dept. Agriculture nd Environmentl Sciences Università degli Studi di Milno Itly P. Vernieri Dip. Scienze Agrrie,
More informationcomponent in Salmonella typhimurium (hisp gene/hisq gene/hisj gene/transport operon/protein interaction)
Proc. Ntl. Acd. Sci. USA Vol. 75, No. 11, pp. 5447-5451, November 1978 Biochemistry dentifiction of membrne protein s histidine trnsport component in Slmonell typhimurium (hisp gene/hisq gene/hisj gene/trnsport
More informationInvasive Pneumococcal Disease Quarterly Report. January March 2017
Invsive Pneumococcl Disese Qurterly Report Jnury Mrch 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Ali Bormn Helen Heffernn My 2017 Acknowledgements This report could not
More informationevolution reaction (RNA ampflcadon/selfish RNA/RNA polymerase/promoter)
Proc. Ntl. Acd. Sci. USA Vol. 91, pp. 6093-6097, June 1994 Biochemistry Emergence of replicting species from n in vitro RNA evolution rection (RNA mpflcdon/selfish RNA/RNA polymerse/promoter) RONALD R.
More informationnm nm nm nm nm nm. Seed surface. oi-ab. oi-ad. ii-ab. ii-ad/endothelium. endosperm.
B 360-370nm Seed surfce oi- 90-100nm A 630-640nm oi-d ii- ii-d/endothelium 230-240nm 220-230nm 240-280nm 1mm endosperm C oi-d D ii-d/endothelium ii- endosperm Supplementry Figure 1 Cell wll thickness mesurements
More informationChapter 9. Mapping and characterizing whole genomes. Structural Genomics Functional genomics
Chpter 9 Mpping nd chrcterizing whole genomes Structurl Genomics Functionl genomics How mny genes hs humn? 5,500 27,000 Interprettion of genomic informtion: high throughput technologies re used to get
More informationEffects of Crop Stubble on Physicochemical Properties of Continuous Cropping Soil and Cucumber Yield and Quality
Nturl Resources, 2012, 3, 88-94 http://dx.doi.org/10.4236/nr.2012.33013 Published Online September 2012 (http://www.scirp.org/journl/nr) Effects of Crop Stubble on Physicochemicl Properties of Continuous
More informationrecessive lozenge-shaped-fly-eye "alleles" in trans: recessive lozenge-shaped-fly-eye "alleles" in trans:
Wht do we men (wht hve we ment) y " gene": Reding for lectures 15-17 (We F27, Fr F29, We M5) Chp 8: from 258 (Nonoverlpping...) to 261 ( Crcking) & from 285 (8.6) to 293 (end of "essentil concepts) Chp
More informationDirect Power Comparisons between Simple LOD Scores and NPL Scores for Linkage Analysis in Complex Diseases
Am. J. Hum. Genet. 65:847 857, 1999 Direct Power Comprisons between Simple LOD Scores nd NPL Scores for Linkge Anlysis in Complex Diseses Pul C. Abreu, 1 Dvid A. Greenberg, 3 nd Susn E. Hodge 1,2,4 1 Division
More informationOptimizing the Effectiveness of Induced Resistance in Tomato for Bacterial Disease Management. Cheryl Trueman
Optimizing the Effectiveness of Induced Resistnce in Tomto for Bcteril Disese Mngement by Cheryl Truemn A Thesis presented to The University of Guelph In prtil fulfilment of requirements for the degree
More informationNonlinear Mixed Effects Model for Swine Growth
Nonliner Mixed Effects Model for Swine Growth A. P. Schinckel nd B. A. Crig Deprtment of Animl Sciences nd Deprtment of Sttistics, Purdue University Introduction Severl nonliner growth functions model
More informationThe Role of Ambrosia and Bark Beetles in Sudden Oak Death
The Role of Amrosi nd Brk Beetles in Sudden Ok Deth Brice A McPherson 1 Dvid L. Wood 1 Ndir Erilgin 1 Pvel Svihr 2 Andrew J. Storer 3 Richrd B. Stndiford 1 1 University of Cliforni Berkeley 2 University
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture10970 I. GN directly grown on the h-bn relese lyer Figure S1 shows X-ry diffrction with the 2θ/ω configurtion nd n opticl microscopy imge for the GN directly grown on the h-bn relese lyer.
More informationChandoga M., Jaroševič A., Sedlák J., Sedlák E. 3rd fib International Congress
Chndog M., Jroševič A., Sedlák J., Sedlák E. 3rd fib Interntionl Congress - 2010 EXPERIMENTAL AND IN SITU STUDY OF BRIDGE BEAMS SUPPORTED BY BOTTOM EXTERNAL TENDONS Doc. Ing. Miln Chndog, PhD., Projstr
More informationJournal of Integrative Agriculture 2017, 16(0): Available online at ScienceDirect
Journl of Integrtive Agriculture 217, 16(): 6345-7 Aville online t www.sciencedirect.com ScienceDirect RESEARCH ARTICLE Functionl chrcteriztion of MdMYB73 revels its involvement in cold stress response
More informationStudy on the effectiveness of Trichoderma spp. on the growth of bean and tomato plants under greenhouse condition
7 th HUON SEMINAR ACHIEVING VISION 2050 THROUGH HIGHER EDUCATION, RESEARCH, SCIENCE & TECHNOLOGY November 13 th to 14 th 2013, Ppu New Guine University of Technology, Le, Ppu New Guine HS7-2013-060 Study
More informationEffects of Rice Straw Management on Sclerotium oryzae Inoculum, Stem Rot Severity, and Yield of Rice in California
Reserch Effects of Rice Strw Mngement on Sclerotium oryze Inoculum, Stem Rot Severity, nd Yield of Rice in Cliforni N. A. Cints nd R. K. Webster, Deprtment of Plnt Pthology, University of Cliforni, Dvis
More informationPlasmid ptic58. expressed at intermediate (virg) or very low (virb, virc, vird, and vire) levels and show under laboratory conditions
JOURNAL OF BACTERIOLOGY, Nov. 1987, p. 5101-5112 Vol. 169, No. 11 0021-9193/87/115102-12$02.00/0 Copyright C) 1987, Americn Society for Microbiology Regultion of the vir Genes of Agrobcterium tumefciens
More informationOrganic Cover Crop Research at WSU Puyallup
Orgnic Cover Crop Reserch t WSU Puyllup Ferury 8 Crig Cogger, Andy Bry, nd Liz Myhre Wshington Stte University Puyllup Reserch nd Extension Center Astrct: Cover crops re loclly grown source of orgnic mtter
More information3-PG transport was measured as follows; an aliquot (25,ul) of cell suspension prepared as described above was incubated
JOURNAL OF BACTERIOLOGY, Sept. 1988, p. 4304-4308 0021-9193/88/094304-05$02.00/0 Copyright C 1988, Americn Society for Microbiology Vol. 170, No. 9 Genetic Evidence for Modultion of the Activtor by Two
More informationEVALUATION OF DIFFERENT TECHNIQUES FOR QUANTIFYING THE PHYSIOLOGICAL RESPONSE OF COTTON UNDER HIGH TEMPERATURES
EVALUATION OF DIFFERENT TECHNIQUES FOR QUANTIFYING THE PHYSIOLOGICAL RESPONSE OF COTTON UNDER HIGH TEMPERATURES A.C. Bii, D.M. Oosterhuis, E.D. Gonis, nd F.M. Bourlnd 1 RESEARCH PROBLEM Extreme vriility
More informationCis-regulatory evolution of Chalcone-synthase expression in the genus Arabidopsis. Running title: Cis-regulatory evolution in the genus Arabidopsis
Genetics: Published Articles Ahed of Print, published on October 8, 2006 s 10.1534/genetics.106.064543 Cis-regultory evolution of Chlcone-synthse expression in the genus Arbidopsis Running title: Cis-regultory
More informationPHOSPHORUS SOURCE EFFECTS ON DRYLAND WINTER WHEAT IN CROP- FALLOW ROTATIONS IN EASTERN WASHINGTON
PHOSPHORUS SOURCE EFFECTS ON DRYLAND WINTER WHEAT IN CROP- FALLOW ROTATIONS IN EASTERN WASHINGTON Richrd Koenig, Deprtment of Crop nd Soil Sciences Aron Esser, Lincoln/Adms County Extension Wshington Stte
More informationCharacterization of a New RNase HII and Its Essential Amino Acid Residues in the Archaeon Sulfolobus tokodaii Reveals a Regulatory C-Terminus
ISSN 0006-2979, Biochemistry (Moscow), 2010, Vol. 75, No. 7, pp. 930-937. Pleides Pulishing, Ltd., 2010. Originlly pulished in Biochemistry (Moscow) On-Line Ppers in Press, s Mnuscript BM10-084, My 30,
More informationThe ovalbumin gene: Cloning of the natural gene* (gene splicing/recombinant phage screening/ intervening sequence expression/restriction mapping)
Proc. Ntl. Acd. Sci. USA Vol. 75, No. 8, pp. 3688-3692, August 1978 Biochemistry The ovlbumin gene: Cloning of the nturl gene* (gene splicing/recombinnt phge screening/ intervening sequence expression/restriction
More informationSTOP THE ROT!! Exploring the Relationship Between Nitrogen and Bacterial Diseases of Onions. Introduction. Acknowledgements.
3/16/1 Cornell Coopertive Extension Vegetle Progrm STOP THE ROT!! Exploring the Reltionship etween Nitrogen nd cteril Diseses of Onions Christy Hoepting Cornell Coopertive Extension Vegetle Progrm cteril
More informationIn Vitro Determination of the Effect of Indoleglycerol Phosphate on the Interaction of Purified TrpI Protein with Its DNA-Binding Sites
JOURNAL OF BACTERIOLOGY, Mr. 1991, p. 159-1597 21-9193/91/5159-8$2./ Copyright X) 1991, Americn Society for Microbiology Vol. 173, No. 5 In Vitro Determintion of the Effect of Indoleglycerol Phosphte on
More informationThe Exploration and Application of Urban Agriculture in China. Dr. WEI Lingling Managing Director Beijing IEDA Protected Horticulture Co., Ltd.
The Explortion nd Appliction of Urbn Agriculture in Chin Dr. WEI Lingling Mnging Director Beijing Protected Horticulture Co., Ltd. 1 WHO WE ARE 2 WHAT WE NEED 3 WELCOME TO OUR PARK About Beijing Protected
More informationThree-Phase Wound-Rotor Induction Machine with a Short- Circuited Rotor
Exercise 1 Three-Phse Wound-Rotor Induction Mchine with Short- Circuited Rotor EXERCISE OBJECTIVE When you hve completed this exercise, you will know how three-phse woundrotor induction mchine cn operte
More informationNUTRIENT MANAGEMENT IN DUAL-USE WHEAT PRODUCTION
232 Southern Conservtion Systems Conference, Amrillo TX, June 26-28, 6 NUTRIENT MANAGEMENT IN DUAL-USE WHEAT PRODUCTION John Sij 1* nd Kurt Lemon 1 1 Texs Agriculturl Experiment Sttion, P.O. Box 1658,
More informationBacteria. Bacterial genome. Transformation 2/4/2015. Bacteria review. Single circular chromosome. one-celled prokaryotes reproduce by mitosis
Bcteri Bcteri review one-celled prokryotes reproduce by mitosis binry fission rpid growth genertion every ~20 minutes 10 8 (100 million) colony overnight! incredibly diverse Bcteril genome Single circulr
More information1 Information, Persuasion, and Signalling
ECON 312: Advertising 1 We will now exmine nother strtegic vrible vilble to firms, tht of dvertising. Industril Orgniztion Advertising 1 Informtion, Persusion, nd Signlling 1.1 Persusion versus Informtion
More informationComparison of Two Different WeedGuardPlus Paper Mulches and Black Plastic Mulch on the Production of Onions and Broccoli
Comprison of Two Different WeedGurdPlus Pper Mulches nd Blck Plstic Mulch on the Production of Onions nd Broccoli Dr. Frnk Stonker, Colordo Stte University Deprtment of Horticulture nd Lndscpe Architecture,
More informationGenetics of heredity. October 10 Lecture notes Genetics of heredity
October 10 Lecture notes Review: Meiosis, digrmmed on blckbord. Meiosis: The division of single nucleus (nd the cell tht contins it) into four dughter nuclei (nd cells tht contin them). The four dughter
More informationEfficiencies of bacterial transmission from plants to seeds and from seeds to plantlets. Marie-Agnès Jacques
Efficiencies of bcteril trnsmission from plnts to seeds nd from seeds to plntlets Mrie-Agnès Jcques Seeds: vectors of diversified microbiot Plnt pthogenic MO? PGPR Pthogenic MO (E. coli STEC O14:H4) Seed
More informationFood Arthropod Abundance Associated with Rest-Rotation Livestock Grazing. Hayes B. Goosey. Department of Animal and Range Sciences
Food Arthropod Aundnce Associted with Rest-Rottion Livestock Grzing Hyes B. Goosey Deprtment of Animl nd Rnge Sciences Montn Stte University We hve completed the second seson of investigtion into the response
More informationPREPARATION OF NOVOLACS USING PHENOLIC RICH COMPONENTS AS PARTIAL SUBSTITUTE OF PHENOL FROM BIOMASS PYROLYSIS OILS
, 251-257. ISSN 1011-3924 Printed in Ethiopi 2010 Chemicl Society of Ethiopi PREPARATION OF NOVOLACS USING PHENOLIC RICH COMPONENTS AS PARTIAL SUBSTITUTE OF PHENOL FROM BIOMASS PYROLYSIS OILS Xu Junming
More informationPre-Plant Broadcast Urea in Direct Seeding, A Logistical Return to the Past? Tom Jensen
Pre-Plnt Brodcst Ure in Direct Seeding, A Logisticl Return to the Pst? Tom Jensen Interntionl Plnt Nutrition Institute (IPNI), Northern Gret Plins Director 102-411 Downey Rd., Ssktoon, SK S7N 4L8 Ph: 306-652-3467
More informationConservation Tillage Strategies For Corn, Sorghum And Cotton
(93%) cotton nd percent lint ws similr in oth pickers. The 15-inch row system with 27 plnts/a gve higher lint yield (1491 l/a) compred to 4-inch row cotton with 5 plnts/a (136 l/a). Plnt cnopy closed 3
More informationNew Phytologist. Research
Reserch New Phytologist Moleculr nlysis of common whet genes encoding three types of cytosolic het shock protein 90 (Hsp90): functionl involvement of cytosolic Hsp90s in the control of whet seedling growth
More informationExperimental Research on Heat/Mass Transfer Features of Corrugated Plate Spray Humidification Air Coolers
379 A publiction of CHEMICAL ENGINEERING TRANSACTIONS VOL. 6, 017 Guest Editors: Fei Song, Hibo Wng, Fng He Copyright 017, AIDIC Servizi S.r.l. ISBN 978-88-95608-60-0; ISSN 83-916 The Itlin Assocition
More information